ID: 1190736485

View in Genome Browser
Species Human (GRCh38)
Location X:53258729-53258751
Sequence CTGCCTCAGCAGGAGATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 2, 2: 1, 3: 23, 4: 240}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190736485_1190736490 6 Left 1190736485 X:53258729-53258751 CCTGAAATCTCCTGCTGAGGCAG 0: 1
1: 2
2: 1
3: 23
4: 240
Right 1190736490 X:53258758-53258780 CACTTGAATCCAGGAGGCAGAGG 0: 565
1: 11436
2: 38258
3: 80519
4: 117718
1190736485_1190736488 -3 Left 1190736485 X:53258729-53258751 CCTGAAATCTCCTGCTGAGGCAG 0: 1
1: 2
2: 1
3: 23
4: 240
Right 1190736488 X:53258749-53258771 CAGGAGAATCACTTGAATCCAGG 0: 2037
1: 40996
2: 111138
3: 163941
4: 210328
1190736485_1190736489 0 Left 1190736485 X:53258729-53258751 CCTGAAATCTCCTGCTGAGGCAG 0: 1
1: 2
2: 1
3: 23
4: 240
Right 1190736489 X:53258752-53258774 GAGAATCACTTGAATCCAGGAGG 0: 1313
1: 26071
2: 72097
3: 129739
4: 160135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190736485 Original CRISPR CTGCCTCAGCAGGAGATTTC AGG (reversed) Intronic
901875452 1:12164777-12164799 CGGCCTCAGCAGGAGAAGCCAGG + Intergenic
902950268 1:19877250-19877272 CTGCCTCAGAAGGATGTTTAAGG - Intergenic
905274975 1:36811664-36811686 CTGCCCCAGGAGGGAATTTCGGG + Intronic
907448360 1:54524856-54524878 CTGCGTCAGCAGCAGACTTGCGG - Intergenic
908011374 1:59780901-59780923 CAGCCTCAGCATGAGGATTCTGG + Intergenic
910652310 1:89582775-89582797 CTGCGTCAGCTGGAGAGCTCCGG - Exonic
911090765 1:94015308-94015330 CTGACTCAGGAGGAGCTTTTTGG + Intronic
912223714 1:107707251-107707273 CTGCCTCAGCAGCAGTTTCAGGG - Intronic
912725542 1:112056317-112056339 GAGCCTCAGCAGGAGATTTTTGG - Intergenic
915594334 1:156887753-156887775 CTCCCTCAGCAGGAGGTTGAAGG - Intergenic
915670006 1:157480553-157480575 ATGGCTCAACAGCAGATTTCAGG + Intergenic
916197126 1:162234898-162234920 CTGCCTCAACAGCCGATTGCAGG - Intronic
917623732 1:176824773-176824795 CTGCCTCACCAGGCGATGTGAGG + Intronic
919141598 1:193579553-193579575 CTGCCACATCTGTAGATTTCTGG + Intergenic
923121848 1:230999244-230999266 CTGCTTCAACAGGAGAGTGCAGG - Intronic
924323667 1:242874187-242874209 CTGGCTCAGCAGAAGACTGCTGG - Intergenic
924543790 1:245006422-245006444 CTGCCTCAGCCTGTGATTACAGG + Intronic
1063238456 10:4143613-4143635 CTGCCTCAGCAGGAGATTACAGG + Intergenic
1064769613 10:18710532-18710554 CAGCCGCAGCAGGAGCTTCCCGG - Intergenic
1066062641 10:31737614-31737636 TTACCTCAGCAGCAGTTTTCAGG + Intergenic
1067155238 10:43776049-43776071 CTCCATCATCAGGAGATTGCAGG - Intergenic
1067308699 10:45092145-45092167 CTCCCTCAGCAGGGGATTCAGGG + Intergenic
1068632116 10:59308833-59308855 CTGACTCAGCACGAGCTTTAGGG - Intronic
1069326955 10:67242852-67242874 CTCCAATAGCAGGAGATTTCAGG + Intronic
1070237224 10:74641257-74641279 CTGCCTCAGCCTGGGATTTTAGG - Intronic
1071306869 10:84307215-84307237 CTGACTCAGCAGGATCTTGCTGG + Intergenic
1072717881 10:97763407-97763429 CTGCCTCACAGGAAGATTTCTGG - Intergenic
1072823700 10:98584441-98584463 CTTCCTGACCAGGAGTTTTCTGG - Intronic
1073116923 10:101096494-101096516 CTGCCTCAGTAGGTGATGTAAGG - Intronic
1075556352 10:123435332-123435354 CTGCCCCAGCAGGAGGCCTCGGG + Intergenic
1076039267 10:127229109-127229131 CTGCCTCAGCCTGGGATTACAGG - Intronic
1076363574 10:129907517-129907539 CTGCCTCAGAAGGAAATGTGAGG + Intronic
1078122761 11:8527082-8527104 CTGCCTCAGCCTGGGATTACAGG + Intronic
1078879977 11:15438411-15438433 CTGCCTGACCAGTAGACTTCGGG - Intergenic
1078953380 11:16161619-16161641 TTGTCTCAGCAGGAGTTTTGTGG - Intronic
1080031111 11:27662113-27662135 CTGCCTCAGCAGGAGGTAGCTGG + Intronic
1081963660 11:47156457-47156479 CTGACTCATCAGCAGCTTTCAGG + Intronic
1082184777 11:49165523-49165545 CTGACTCAGGAGGAGTTTTGGGG + Intronic
1084633062 11:70368486-70368508 CTTCCTCAGCTGCAGACTTCAGG + Intronic
1085805663 11:79633660-79633682 CTGCCTACTCTGGAGATTTCAGG + Intergenic
1085869464 11:80332385-80332407 ATACCTCAGTAAGAGATTTCTGG + Intergenic
1086681563 11:89679836-89679858 CTGACTCAGGAGGAGTTTTGGGG - Intergenic
1088200539 11:107328480-107328502 CTGCTTCAGCAGCAGACTGCAGG + Intronic
1090000241 11:122949947-122949969 CTGCCTCAGCAGGAGTATCTGGG + Intronic
1090236159 11:125148990-125149012 AAGCCTGAGCAGGAGGTTTCAGG + Intergenic
1090666522 11:128918297-128918319 CGGGGTCAGCAGGAGAATTCGGG + Exonic
1091286500 11:134411463-134411485 CCCCCTCAGCAGGTGGTTTCTGG - Intronic
1092838374 12:12514364-12514386 CTGCATCTGCAGAAGGTTTCAGG - Intronic
1093377327 12:18446344-18446366 CAGTCTCAGCAGGAGATTACAGG + Intronic
1096490787 12:52011765-52011787 ATGCTTCAGCAGGAGATCCCTGG + Intronic
1096686113 12:53289319-53289341 CTGCCCCAGCAGGAGTCTTGGGG - Intronic
1098763039 12:74448855-74448877 TTGCCTCAGCACCACATTTCAGG + Intergenic
1100052343 12:90463590-90463612 CAGCCTCTGCAAAAGATTTCAGG + Intergenic
1100629780 12:96376124-96376146 CTGCCTGAGCAGGAGTTTCCTGG - Intronic
1102905871 12:116674829-116674851 CTGCCTAGGCAGAAGAGTTCAGG - Intergenic
1104097666 12:125573023-125573045 CTGCCTCTACAGGATATATCAGG + Intronic
1104582394 12:130020617-130020639 CTGCCTCAGCCTGGGATTACAGG + Intergenic
1105300956 13:19134156-19134178 CTGCCTCAGCAGGAGGAGCCTGG + Intergenic
1106345041 13:28868510-28868532 TTTCATCAGCAGGAGAATTCAGG + Intronic
1106518204 13:30473188-30473210 CTGCCTCAGCCCGAGTTTTCCGG + Intronic
1107935454 13:45341733-45341755 CTGCCCCAGCTGGAGTTTTTGGG + Intergenic
1108035960 13:46290954-46290976 CTGCCTCTGCATGAAATCTCTGG - Intergenic
1111008502 13:82281510-82281532 CTGCCCCTGCAGCAGACTTCTGG + Intergenic
1111412281 13:87892723-87892745 CTACCTCATCAGGAGATTGTTGG - Intergenic
1111413691 13:87911280-87911302 GTGTCTCAGAAGGAGATGTCAGG + Intergenic
1112005421 13:95249514-95249536 TTGGATCAGCAGGAGGTTTCCGG - Intronic
1113169291 13:107481643-107481665 CTGCTTCACCAGGAGATTCTCGG - Intronic
1113640122 13:111951403-111951425 CTGGCTCAGCAGGAGACACCAGG - Intergenic
1114808637 14:25869448-25869470 CTGCTTCAGCAAAAGATGTCTGG - Intergenic
1117710274 14:58521306-58521328 CTGCCTCCACATCAGATTTCTGG - Intronic
1119536823 14:75409520-75409542 CTGTCTCAGCAGGATGTCTCAGG - Intergenic
1122964800 14:105117805-105117827 CTACCACAGCAGGACAATTCTGG - Intergenic
1123455444 15:20418670-20418692 CTGCCTCAGCCTGGGATTACAGG - Intergenic
1124632695 15:31346523-31346545 CTTCCTCTGCAGGAGCTTCCAGG + Intronic
1124849354 15:33321353-33321375 CTGCCCCAGCAGGACCTCTCAGG - Intronic
1128325828 15:66723427-66723449 CTGCCTCAGCCTGGGATTACAGG - Intronic
1130214390 15:81954508-81954530 AAGCATCAGCAGGACATTTCTGG + Intergenic
1131022412 15:89110181-89110203 CTGCCTCAGCCTGGGATTACAGG + Intronic
1134060617 16:11197541-11197563 CCGCCTCAACATGAGGTTTCAGG + Intergenic
1136351907 16:29715867-29715889 CTGCCTCAGCCTGGGATTACAGG + Intergenic
1136463055 16:30423979-30424001 CTGTCTCAGCAGGTGATGACGGG - Exonic
1136582490 16:31161546-31161568 CTGCCTCAGCCTGGGATTACAGG - Intergenic
1137541130 16:49362553-49362575 CTGTCTCAGCAGGGCATCTCAGG - Intergenic
1137898407 16:52238388-52238410 GTGCCACAGCAGGGGCTTTCAGG - Intergenic
1139208203 16:65049981-65050003 CTGCCCCAGAAGCAGCTTTCTGG + Intronic
1139429605 16:66904114-66904136 CTGCCTCAGCAGGGGGAATCTGG + Intergenic
1139623367 16:68164276-68164298 CTGCCTCAGCCTGCGATTGCAGG - Intronic
1140975011 16:80051305-80051327 CTGTCTCAGCTGGAGATGCCTGG - Intergenic
1141325880 16:83058996-83059018 CTGCCTTAGTTGGAGATTCCCGG + Intronic
1141742779 16:85905108-85905130 CTGCCCCACCAGGAGATATTTGG - Intronic
1142553850 17:758670-758692 CTGCCTCAGCCTGGGATTACAGG - Intronic
1142943924 17:3408888-3408910 CTGCCCCAGCAAGTGAATTCCGG + Intergenic
1142999528 17:3783685-3783707 TTTACTCAGCAGTAGATTTCAGG + Intronic
1144334556 17:14257088-14257110 CTGCCTCAGCCTGGGATTACCGG + Intergenic
1144438180 17:15259823-15259845 CTGCCTCAGCCTGGGATTACAGG - Intronic
1146731439 17:35195888-35195910 CTGCCTCAGCCTGCGATTGCAGG - Intergenic
1148859290 17:50595700-50595722 CTGCCCCAGCACCAGAATTCGGG + Intronic
1149183276 17:53966515-53966537 ATGCCTAAGAATGAGATTTCTGG + Intergenic
1149567140 17:57648525-57648547 CTGCCTCAGGAGGAGGAGTCTGG + Intronic
1151137894 17:71965192-71965214 CTGCCTCAGCTTGGGATTACAGG - Intergenic
1151372801 17:73659550-73659572 TGGCCTCAGCTGGAGATGTCTGG + Intergenic
1151403615 17:73872411-73872433 CTGCCTCAGCCTGGGATTACAGG - Intergenic
1151656209 17:75497229-75497251 ATGCCTAAGCAGGAGGTGTCTGG + Intronic
1153655030 18:7274619-7274641 CTGCCTCAGCCTGGGATTACAGG + Intergenic
1154330495 18:13425654-13425676 TGGCCTCAGCAGGAGCGTTCAGG + Intronic
1157409143 18:47449191-47449213 CTTCCTCAGCCTGAAATTTCTGG - Intergenic
1157543583 18:48531251-48531273 TTGCCTCATCAGCAGCTTTCTGG - Intergenic
1157677705 18:49579386-49579408 CTGCCTCAGCCTGAGATTACAGG + Intronic
1159252989 18:65906203-65906225 CTGCTTCAGCAGGAAAATTGAGG - Intergenic
1159492880 18:69161661-69161683 TTGCCTCAGCAATAGGTTTCAGG - Intergenic
1162665734 19:12210238-12210260 TTGCCTCAGCCTGAGATTACAGG + Intergenic
1163088762 19:15003357-15003379 CTGCCTTTGCAGGAGATGACAGG + Intronic
1164719287 19:30420382-30420404 ATGCCTCCCCAGGAGCTTTCCGG - Intronic
1166295927 19:41889403-41889425 CTGCCTCATCCGGAGGCTTCTGG - Intronic
1167063418 19:47166060-47166082 TTGTCTGGGCAGGAGATTTCAGG - Intronic
1167399910 19:49258228-49258250 CTGCCTTAGCAGCAGGTTGCTGG - Intergenic
1168419551 19:56192407-56192429 CTGCCTCAGGATGGGACTTCTGG + Intronic
1168421448 19:56206718-56206740 CTGCCTCAGGATGGTATTTCTGG - Intronic
925295071 2:2770895-2770917 CTGCCTCAGCCTGAGACTACAGG + Intergenic
925404600 2:3597801-3597823 CTGCCTCAGCAGCAGTATTTTGG - Intronic
925639228 2:5971510-5971532 CTGGCTCAGCAGGTGATACCTGG - Intergenic
926480443 2:13386578-13386600 CTGCCTCAGCCTGAGATTACAGG + Intergenic
926712023 2:15889550-15889572 CTGCCCCAGCTGGAGAGCTCGGG - Intergenic
927264916 2:21135736-21135758 ATGCCTCAGCAGTCTATTTCTGG + Intronic
930219333 2:48729716-48729738 CGGCCTCAGCACGAGATTTTGGG - Intronic
930324765 2:49901389-49901411 CTGCATAATCAGCAGATTTCTGG + Intergenic
931266125 2:60661865-60661887 CGGCTTGAGCAGCAGATTTCGGG - Intergenic
931667061 2:64617272-64617294 TTGACTCAGCTGGGGATTTCTGG + Intergenic
932040506 2:68294406-68294428 CTGCCTCAGCCTGGGATTACAGG - Intronic
933980888 2:87549846-87549868 CAGCCTCAGCAGGAGAATGGGGG + Intergenic
934659622 2:96136308-96136330 CTGCCTCAGCCAGAGATGCCCGG - Intronic
936312942 2:111400939-111400961 CAGCCTCAGCAGGAGAATGGGGG - Intergenic
937168114 2:119840067-119840089 TTTCTTCAGCAGGTGATTTCTGG + Intronic
937954988 2:127417090-127417112 GTGCCTCAGCAGGAGGCATCTGG + Intergenic
938022973 2:127921266-127921288 CTGCCTCAGCAGGAGATTACAGG + Intergenic
938707784 2:133948179-133948201 ATACCTCAGCATGAAATTTCTGG - Intergenic
940652559 2:156452428-156452450 CTGCCTCAGCCTGCGATTGCAGG - Intronic
942021171 2:171867507-171867529 CTGCCTCAGCCTGCGATTGCAGG - Intronic
942989239 2:182179296-182179318 CTGTTTCAGCAGGAGTTTTCTGG - Intronic
944199991 2:197096345-197096367 CTGCCTCAACAGCAGAATTAGGG - Intronic
946154471 2:217798237-217798259 CTGGCTTAGCAGGAGATAGCTGG - Intergenic
946978358 2:225178099-225178121 CTGCCTCAACGTGAGTTTTCAGG + Intergenic
947919589 2:233857549-233857571 CTTCCCCAGCAGCAGGTTTCTGG + Intergenic
1170468994 20:16649532-16649554 CTGCCTTAGATGGAGATTTGTGG + Intergenic
1170836357 20:19888074-19888096 CTGCCTTCTCAGGAGGTTTCTGG + Intronic
1171231398 20:23489696-23489718 CTGCCTCACCAGGAACTTTCTGG + Intergenic
1172238372 20:33394273-33394295 CTGCCTCAGCCTGGGATTACAGG + Intronic
1172408823 20:34707883-34707905 CTGCCTCAGCCTGGGATTACAGG + Intronic
1173545971 20:43898236-43898258 CTGCCTCAGCCTGGGATTACAGG - Intergenic
1174985174 20:55443691-55443713 AAGCCCCAGCAGGAGATTTGAGG + Intergenic
1175782928 20:61695245-61695267 CTGCCTCTGCCGGAGGTTACAGG + Intronic
1176233712 20:64044627-64044649 CTGCCCCAGCAGGACCTTGCTGG + Intronic
1178570648 21:33733008-33733030 CTGCCTTAGAAGGGGATTTTTGG - Intronic
1178605223 21:34030331-34030353 CTGCCTCAGCATGTGATACCTGG + Intergenic
1179523858 21:41962783-41962805 CTTCCTCTGCAGGGGATGTCAGG + Intergenic
1179983046 21:44906305-44906327 CTGCCGCAGCAGGAGAATGTTGG + Intronic
1182001278 22:26921832-26921854 CTGCCCCAGCAGTAGAATGCAGG - Intergenic
1183871217 22:40743919-40743941 CTGCCTGAGCTGGAGATTACAGG + Intergenic
1183984248 22:41560885-41560907 CTGACTCAGGAGGTGATGTCTGG + Exonic
949142498 3:651716-651738 ATGCCTCAGAAGTAGATTTTAGG - Intergenic
949584598 3:5425420-5425442 TCCCCTCAGCTGGAGATTTCTGG - Intergenic
949863043 3:8523860-8523882 CTGTCTCAGGAGGAGAGGTCAGG + Intronic
950004902 3:9685370-9685392 CTGCCTCAGGAGGAGATGACAGG - Intronic
951092871 3:18595710-18595732 CTGGCTCATGAGGAGATTTGAGG - Intergenic
951663071 3:25092126-25092148 GTGCCTCGTCAGCAGATTTCTGG - Intergenic
953200293 3:40772266-40772288 CTGCCTCAGCCTGGGATTACAGG - Intergenic
953410650 3:42688791-42688813 CTGCCCCGGCAGGTGATTGCAGG + Intronic
953901266 3:46845515-46845537 CAGCCACAGCTGGCGATTTCGGG + Intergenic
954419465 3:50411016-50411038 GTGCCTCAGGAGGGGAGTTCTGG - Intronic
955702859 3:61699318-61699340 CTGCCTCAGCAGAAGACAGCTGG + Intronic
958142439 3:89579464-89579486 CTATCTCAGAGGGAGATTTCTGG - Intergenic
958976106 3:100669419-100669441 GTGCCTCAGCAGGAGACTACAGG - Intronic
961004254 3:123394015-123394037 CTGCCTCAGCTTGGGATTACAGG - Intronic
962846494 3:139278633-139278655 CTGCCACAGCAGGAGCTTTCTGG - Intronic
964465104 3:156983436-156983458 CAGCCTCAGGACCAGATTTCTGG + Intronic
964880877 3:161421320-161421342 CTGCTGCAGCAGGAGATATTTGG + Intergenic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
967726906 3:192870596-192870618 CTGCCTCAGCCTGGGATTACAGG - Intronic
969289308 4:6228442-6228464 CTCCCTCAGCAGGACATTTTTGG + Intergenic
969652176 4:8474350-8474372 CTGCCTTAACAGGAGACTTCAGG + Intronic
973076057 4:45927513-45927535 CTGACTCTGTAAGAGATTTCTGG + Intergenic
975087800 4:70364639-70364661 CTGCTTCACCAAGATATTTCAGG - Intronic
975089711 4:70387669-70387691 CTGCTTCACCAAGATATTTCAGG - Intronic
975171933 4:71241965-71241987 CTGACACAGCAAGAGATGTCAGG - Intronic
975218302 4:71782757-71782779 CTGCTTCAGTAGGATTTTTCAGG + Intronic
976187610 4:82458171-82458193 CTGCCTCAGCAGTGGAAGTCTGG - Intronic
976248740 4:83029356-83029378 CTGCAACAACAGGAGATTCCTGG + Intergenic
978691774 4:111522166-111522188 TTGCTTTTGCAGGAGATTTCAGG - Intergenic
979699190 4:123648566-123648588 CTGCCTCAGCCTGGGATTACAGG - Intergenic
980460563 4:133105854-133105876 CTGCCTCAATAGGAGATTCATGG - Intergenic
981570685 4:146147664-146147686 CTTGATCAGTAGGAGATTTCAGG + Intergenic
985358660 4:189148105-189148127 CTGCCACACCAGCAGATTTGTGG - Intergenic
986281912 5:6330392-6330414 CTGCCCCTGCAGCAGACTTCTGG - Intergenic
987052231 5:14157261-14157283 CTGCCTCAGTGCGGGATTTCTGG + Intronic
988195170 5:27995908-27995930 CGGCCTCAGCAGAAGATGACTGG + Intergenic
988601203 5:32640903-32640925 CCACCGCAGCAGGAGGTTTCTGG - Intergenic
992828723 5:80573434-80573456 CTTCCACAGCAGGAGAGTTAAGG + Intergenic
995433513 5:112109373-112109395 TTGCCTCAGCTGGAGATGCCTGG + Intergenic
995767593 5:115635954-115635976 CTGCCTTCCCAGGAGATTTGGGG + Intergenic
996331951 5:122339600-122339622 CTATCTCAGTAGGAGATTTCCGG + Intronic
996709307 5:126528324-126528346 CTGCCTCAGCCTGGGATTACAGG - Intergenic
997439631 5:133900002-133900024 TTGCATCCGCAGGAGATCTCTGG - Intergenic
1000866704 5:166523223-166523245 CAGCCTCAGCAGGATTTCTCAGG + Intergenic
1001487893 5:172132851-172132873 CTCCCTCAGCTGGTGATTTTGGG - Intronic
1004640133 6:17507078-17507100 TGGCCTAAGCAGGAGAATTCAGG - Intronic
1007391484 6:41551995-41552017 CTGTCTCAGCTGGGGGTTTCAGG - Intronic
1007697154 6:43741026-43741048 ACCCCTCAGCAGGGGATTTCCGG - Intergenic
1009723091 6:67501281-67501303 CTGCCTTAGCTGGAGATTAAAGG - Intergenic
1009901609 6:69813754-69813776 CTGTCTCAGAAGGAGGTTACTGG + Intergenic
1011079049 6:83469579-83469601 CTGCCCCTGGAGCAGATTTCTGG + Intergenic
1012061721 6:94493332-94493354 CTCCCTCAGCCTGAGATTACAGG + Intergenic
1012408914 6:98933484-98933506 CAGCCTCAGTTGAAGATTTCAGG - Intronic
1012462616 6:99480549-99480571 CTGCCTCAGCCTGGGATTACAGG - Intronic
1013157755 6:107509639-107509661 CTGGCTCAGCAGGAAACTCCAGG - Intronic
1013803730 6:113974289-113974311 CTGCCTCCGCAGGAGGCCTCCGG + Intronic
1016730282 6:147421085-147421107 CTGTCTCAGCAAGAGTGTTCCGG + Intergenic
1016781167 6:147960281-147960303 AGGGCTCAGCAGCAGATTTCAGG - Intergenic
1018078640 6:160239538-160239560 ATGGGTCAGCAGGACATTTCTGG - Intronic
1018492050 6:164303792-164303814 CTGCTTCCAAAGGAGATTTCAGG + Intergenic
1018645934 6:165948595-165948617 CTTCCTTAGCAGGAGTATTCGGG - Intronic
1020062262 7:5161167-5161189 CCGCCTCAGCAGGTGACTTGGGG + Intergenic
1020222709 7:6253328-6253350 GTGCCTCAGCTTGAGATTTCAGG + Intronic
1020480783 7:8657639-8657661 CTCCAGCAGCAGGAGATGTCAGG + Intronic
1021292840 7:18866934-18866956 CTTCCTCAGAATCAGATTTCTGG - Intronic
1021656829 7:22881307-22881329 CTGCCACAGCAGGAATTCTCTGG + Intergenic
1023158799 7:37277865-37277887 CTGCCTAGGCAGGAGACTTCTGG - Intronic
1023546860 7:41326833-41326855 CTGCCTGGACAGGAAATTTCTGG + Intergenic
1024229076 7:47350267-47350289 CTGCCCCATCAGGACATGTCCGG - Intronic
1026852043 7:73730635-73730657 CTGGCTCAGCAAGATATTTCAGG - Intergenic
1027648341 7:80833346-80833368 CTGCCTCTGCAGGAGAATTGAGG - Intronic
1028872554 7:95785162-95785184 CTGCCTCAGCCTGGGATTACAGG - Intronic
1029099913 7:98120884-98120906 CTGCCACAGCAGTACAATTCGGG + Intronic
1029295951 7:99540652-99540674 CAGCCTCAGCATGACATTTGTGG - Intergenic
1029811550 7:103054135-103054157 CTGCCTCAGCCTCAGATTACAGG - Intronic
1031420528 7:121546067-121546089 CTGACTGAGCAGGAGAGTTTAGG + Intergenic
1034517789 7:151594153-151594175 CTGCCTCAGCCTGAGCCTTCGGG - Intronic
1035633541 8:1126891-1126913 CTGCCTCAGGAGGAGCTGGCTGG - Intergenic
1036064456 8:5363439-5363461 CTTCCTCATCATGAAATTTCTGG + Intergenic
1038543831 8:28410965-28410987 CTGCCTCAGCCTGGGATTACAGG - Intronic
1038767558 8:30443008-30443030 CTGCCACAGGTGGATATTTCAGG - Intronic
1040746018 8:50643426-50643448 CTGGCTCAGCAGTGGTTTTCAGG + Intronic
1041591297 8:59587843-59587865 CTGCCTCAGTTGGAGTTCTCTGG + Intergenic
1042358442 8:67855070-67855092 GAGCCTCAGCAGGAGATCTCTGG + Intergenic
1045402790 8:101835353-101835375 CTGCCAAACCAGGAGATATCTGG + Intronic
1045587912 8:103560059-103560081 CTGCTTCAGCAACAGATTTGGGG - Intronic
1048307798 8:133296133-133296155 CAGCCTCGGGAGGAGATTTCGGG - Intronic
1049854511 8:144852999-144853021 CTGCATCAGCCGGGGATTGCCGG - Intronic
1052027348 9:23588224-23588246 CTGAAGCAGCTGGAGATTTCTGG + Intergenic
1056188447 9:84160792-84160814 CTGCCTCTGCTGGAGTTGTCAGG + Intergenic
1056946436 9:91001520-91001542 CTGCTTCATCAGGATATCTCAGG - Intergenic
1057831234 9:98408898-98408920 CTGCCTCAGCCTGCGATTACAGG + Intronic
1058728588 9:107827138-107827160 CTGCCTCAGCCTCAGATGTCAGG - Intergenic
1059023026 9:110596968-110596990 TTGCCTCTGCAGCAGAATTCTGG + Intergenic
1060250735 9:121984994-121985016 GTTCCTCAGCAGCAGATTACAGG + Intronic
1060267088 9:122118185-122118207 CTGCCTCTGCAAGAAATGTCAGG + Intergenic
1060505960 9:124198669-124198691 CTGCCCCAACAAGAGAGTTCGGG + Intergenic
1061162301 9:128902391-128902413 CTGCCTCAGAAGGAGGAGTCTGG + Intronic
1203497450 Un_GL000224v1:165545-165567 AGACCTCAGCAGGAGAGTTCTGG + Intergenic
1203510009 Un_KI270741v1:107601-107623 AGACCTCAGCAGGAGAGTTCTGG + Intergenic
1186245592 X:7613191-7613213 CTCCCTCACCAGGAGACTGCAGG - Intergenic
1189921387 X:45906297-45906319 CTGCCTGAGAAGGAGCTTGCAGG + Intergenic
1190620663 X:52284441-52284463 CTGCCAGAGCAGCAGACTTCAGG - Intergenic
1190736485 X:53258729-53258751 CTGCCTCAGCAGGAGATTTCAGG - Intronic
1190942452 X:55055562-55055584 CTTCATCTCCAGGAGATTTCTGG + Intergenic
1192207410 X:69105599-69105621 CAGCCTCAGCAGGTGAATTGGGG + Intergenic
1195097007 X:101512256-101512278 CTGCCTCAGCCTGAGATTACAGG - Intronic
1201354246 Y:13081472-13081494 CTGCCTCAGCCTGGGATTACAGG + Intergenic