ID: 1190738164

View in Genome Browser
Species Human (GRCh38)
Location X:53269413-53269435
Sequence CAGTCTCTCCACCTGGACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 276}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190738159_1190738164 -4 Left 1190738159 X:53269394-53269416 CCCCTCTAGCATTTAGGGCCAGT 0: 1
1: 0
2: 0
3: 3
4: 97
Right 1190738164 X:53269413-53269435 CAGTCTCTCCACCTGGACTCTGG 0: 1
1: 1
2: 1
3: 32
4: 276
1190738161_1190738164 -6 Left 1190738161 X:53269396-53269418 CCTCTAGCATTTAGGGCCAGTCT 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1190738164 X:53269413-53269435 CAGTCTCTCCACCTGGACTCTGG 0: 1
1: 1
2: 1
3: 32
4: 276
1190738156_1190738164 16 Left 1190738156 X:53269374-53269396 CCTCTGTAAGAAAGAGGGGGCCC 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1190738164 X:53269413-53269435 CAGTCTCTCCACCTGGACTCTGG 0: 1
1: 1
2: 1
3: 32
4: 276
1190738160_1190738164 -5 Left 1190738160 X:53269395-53269417 CCCTCTAGCATTTAGGGCCAGTC 0: 1
1: 0
2: 1
3: 8
4: 57
Right 1190738164 X:53269413-53269435 CAGTCTCTCCACCTGGACTCTGG 0: 1
1: 1
2: 1
3: 32
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190738164 Original CRISPR CAGTCTCTCCACCTGGACTC TGG Intronic
900111231 1:1006430-1006452 CTGTCTCTCCACCTGGGACCAGG - Intergenic
900150337 1:1176078-1176100 CAGTCTCTCCACCTGCACAGCGG - Intronic
900590211 1:3456098-3456120 CCCTCCCTCCACCTGGACACTGG + Intronic
900626173 1:3609713-3609735 CTGCCTCTGCACCTGGGCTCGGG - Intronic
901902549 1:12377737-12377759 CAATCTCTCCTCCTGGGTTCAGG - Intronic
902756463 1:18552497-18552519 CAGTCTCTCCACCTGGACCCTGG + Intergenic
903553027 1:24171567-24171589 CAGCCTCTACTCCTGGGCTCAGG + Intronic
904910246 1:33929218-33929240 CTGTCCCTCCACCTCTACTCCGG + Intronic
905396391 1:37669286-37669308 CAGCCTCTCCACCTGTGCTCGGG + Intergenic
905434534 1:37947453-37947475 CAGTTTCTCCACCTGGAAAATGG - Intergenic
905441991 1:38001520-38001542 TAGTCTATCCAGCTGGGCTCTGG + Intronic
905632724 1:39527574-39527596 CAGCCCCTCCACCTGGACCAGGG + Intergenic
905665092 1:39758843-39758865 CAGCCCCTCCACCTGGACCAGGG - Exonic
905901827 1:41586407-41586429 CAGTGTTGCCACCTGGACCCAGG + Intronic
906800541 1:48733307-48733329 GATTCTCTCCATCTGGGCTCTGG - Intronic
907158477 1:52355030-52355052 CAATCTCTCCACCTGCATTTTGG + Intronic
907498638 1:54862055-54862077 CAGCCTCTCCACCTGAGCTCAGG + Intronic
908246740 1:62233332-62233354 CAGTCTCCACAGCTCGACTCAGG + Intergenic
912709050 1:111936813-111936835 CTGTCTCTCCATCTAGACACTGG + Intronic
913247138 1:116879722-116879744 CAGCCTCTCCACCTGGACAGTGG + Intergenic
913374260 1:118133293-118133315 CTCTCTCTCCATCTGCACTCTGG - Intronic
915130712 1:153693666-153693688 CCTGCTCTCCACCTGGACTCAGG + Exonic
916456359 1:164974820-164974842 CCCTCTCTCCACATGGTCTCAGG + Intergenic
917309009 1:173657745-173657767 GAGCCTCTGCACCTGGCCTCTGG + Intronic
917502742 1:175600065-175600087 CAGACTCTGGAACTGGACTCGGG + Intronic
920027119 1:203007239-203007261 CTCTCTCTCCACCTGGAACCCGG + Intergenic
920178955 1:204120794-204120816 CTATCTCTCCACCTGGATGCTGG + Intronic
920316508 1:205079337-205079359 CAGTCTCTCCATCTGGAAAATGG + Intergenic
920415421 1:205796159-205796181 CTCTCTCTCCACCTGCCCTCTGG - Intronic
921909283 1:220528982-220529004 CAGGGTCTCCACCTGGAGCCCGG + Intronic
922087592 1:222365609-222365631 CAGTTTCTCCTCCTGCCCTCAGG + Intergenic
922608750 1:226908624-226908646 CAGTGTCGCCATCTGGAGTCGGG - Exonic
1065130367 10:22613783-22613805 CTGTCTCTGCACCTGCACCCTGG - Intronic
1067806673 10:49397635-49397657 CAGTCTCTTGACCTGGGCTAAGG - Intergenic
1067941781 10:50662635-50662657 CCTTCTCTCCACCTGGCCGCTGG + Intergenic
1068595522 10:58899195-58899217 CAGTTTCTCTACAAGGACTCAGG - Intergenic
1069717681 10:70531411-70531433 CAGGCTCTCCACCCGGACCCCGG - Exonic
1070863028 10:79687593-79687615 CCTTCTCTCCACCTGGCCGCTGG + Intergenic
1072185148 10:93030280-93030302 CAGTCTGCCCACCTGAGCTCAGG + Intronic
1072578174 10:96719144-96719166 CTGGCTCTCCAGCTGGGCTCTGG - Intronic
1072717088 10:97759438-97759460 CACTCTCTCCAGCTGGATTCTGG + Exonic
1076327361 10:129636213-129636235 CAGTATCTCCGGCTGGACTCGGG - Intronic
1076366750 10:129926314-129926336 CAGTCCCTCCACAGGGTCTCAGG - Intronic
1076401779 10:130189789-130189811 CAGTAGCACCACCTGGACCCTGG - Intergenic
1076528065 10:131125025-131125047 CAGTTTTTCCACCTGGACAGTGG - Intronic
1076579394 10:131496531-131496553 CAGGCTCTGCACATGGACCCAGG + Intergenic
1076662302 10:132063633-132063655 CAGTGTCTCCCTCTGGGCTCCGG + Intergenic
1077227391 11:1444423-1444445 CCTTCTCTCCACCCTGACTCAGG - Intronic
1077333027 11:1991657-1991679 CAGCCCCTCAACCTGGACCCCGG - Intergenic
1077374342 11:2198518-2198540 CAGTATCTTCACCTGGGATCAGG + Intergenic
1080064002 11:27988412-27988434 TAATCTCTCCACCTGGCCTCTGG - Intergenic
1081654556 11:44848866-44848888 CTGTCTCTTCAGCTGTACTCAGG + Intronic
1083880796 11:65547376-65547398 CTGTCTCTCCACCTGGGGTGGGG - Intronic
1083991209 11:66246834-66246856 GAGTCTTTCCACCTGGCCTGTGG + Intergenic
1084661346 11:70548358-70548380 GAGTCTCCCCACCTGGGATCAGG - Intronic
1087237617 11:95737670-95737692 CTGTCTCTGCCACTGGACTCTGG + Intergenic
1088286005 11:108188754-108188776 CAGTCTGTCCTCCTGGAATGAGG - Intronic
1089605325 11:119638228-119638250 CAGGTTGTCCACCTGGACCCAGG - Intronic
1090722533 11:129489600-129489622 CACTTGCTCCACCAGGACTCTGG - Intergenic
1202816010 11_KI270721v1_random:46835-46857 CAGCCCCTCAACCTGGACCCCGG - Intergenic
1092166863 12:6347884-6347906 CAGTTCCTCCACCTGTCCTCTGG - Exonic
1092257658 12:6936208-6936230 CAGCCTCTCCCCCTGGCCTGGGG + Exonic
1092260131 12:6948917-6948939 GAGTCTCTCCCGCTGCACTCAGG - Intronic
1092377166 12:7965776-7965798 CAGCCTCACCTCCTGGCCTCAGG + Intergenic
1093718803 12:22414312-22414334 GAGCCACTGCACCTGGACTCAGG - Intronic
1094229849 12:28090550-28090572 CAGTTTCTCCAACTTGTCTCTGG + Intergenic
1095404323 12:41851158-41851180 CAATTTCCCCACCTGGAGTCTGG - Intergenic
1095561759 12:43574256-43574278 AACTCTCTCCAACTGGAGTCAGG - Intergenic
1096414294 12:51400184-51400206 CAGTCTTTCCTCCTGATCTCTGG - Intronic
1097244722 12:57601136-57601158 CAGGCTCTCCCCCAGCACTCTGG - Intronic
1098486262 12:71025449-71025471 TAGTCTCTTCACCTGGACTAAGG - Intergenic
1099104620 12:78483214-78483236 CAGACTCTCCACCTGCACTTTGG - Intergenic
1100248450 12:92789416-92789438 CAACCTCTCCATCTGAACTCTGG + Intronic
1101045072 12:100796313-100796335 CAGTCTCTCCTCCTGCTCTTTGG + Intronic
1102047822 12:109840793-109840815 CTTCCTCTCCACCTGGCCTCAGG - Intergenic
1102189411 12:110975391-110975413 CAGTGTCTCCACCTGGAAAATGG + Intergenic
1102520814 12:113476650-113476672 CACTCTCCCCGCCTGGGCTCCGG - Intergenic
1105027111 12:132856759-132856781 CAGTCCCTCCACCAGCACCCGGG - Intronic
1106852702 13:33812324-33812346 AAATCTCTCTGCCTGGACTCAGG - Intergenic
1113147940 13:107229685-107229707 CCCTCTCTCCACCCTGACTCAGG + Intronic
1113648984 13:112020776-112020798 CAGTCTCTCTCCCTCTACTCAGG + Intergenic
1113873598 13:113580458-113580480 CTGTCTCTCCAGTTTGACTCTGG + Intergenic
1117329838 14:54701647-54701669 CAGCCTCACCCCCAGGACTCTGG + Intronic
1118360679 14:65053982-65054004 CAGTCTCTCCAGCTGTCTTCTGG - Intronic
1118994204 14:70822153-70822175 CAGTTTCCCCACGTGGACGCGGG + Intergenic
1120357889 14:83457832-83457854 CATTCTCTCTGCCTGGAATCAGG - Intergenic
1121011946 14:90524825-90524847 CAGTCTCCCCACCTGCAATGTGG - Exonic
1122280014 14:100616445-100616467 CAGTCGCTCCACGTGGAGGCTGG + Intergenic
1124136860 15:27042695-27042717 CAGTCTCTCCACATGCCCTTGGG + Intronic
1125730974 15:41892757-41892779 CAGCCACTCCTCCTGTACTCAGG + Intronic
1125782342 15:42280972-42280994 CTGTGTCTCCTCCTGGACTGTGG - Intronic
1126012063 15:44312528-44312550 CAGCCTCTCTACCTGTTCTCTGG + Intronic
1128235844 15:66066565-66066587 CAGGGTCTCCACTTGGACGCAGG - Intronic
1128395636 15:67222631-67222653 CAGTCCCTCCACTTGTACACTGG + Intronic
1128527089 15:68419993-68420015 CAGTCTCTCCACCTGTGCAATGG + Intronic
1129323710 15:74788739-74788761 CAGTCTCCCCACCTAGAATGTGG + Intronic
1129613051 15:77075539-77075561 CAGTCTTTCTCCCTGCACTCAGG + Intronic
1130766471 15:86876340-86876362 CTTTCCCTCCACCTGGCCTCTGG - Intronic
1135117440 16:19735640-19735662 CTGTCTGGCCACTTGGACTCCGG + Intronic
1136119898 16:28126047-28126069 CTGTCTCTGTCCCTGGACTCTGG - Intronic
1136994873 16:35182568-35182590 CAGTCTCTCCACCTGCAGTATGG + Intergenic
1138194888 16:55044717-55044739 CAGTCCCTGCAGCTGGAATCTGG - Intergenic
1138203610 16:55108085-55108107 CAGTTTCTTCACCTATACTCTGG + Intergenic
1138431731 16:56973215-56973237 CAGTTTCCCCATCTGCACTCTGG + Intronic
1138562590 16:57810801-57810823 CAGTCTCTCCATCTGTACAATGG - Intronic
1139955632 16:70691724-70691746 CAGCCTCTCCAGCTGGCCTGGGG + Intronic
1141065759 16:80912369-80912391 AACTCTCTACACCTGGAGTCTGG + Intergenic
1141272292 16:82552464-82552486 CAGGCTCTATGCCTGGACTCTGG + Intergenic
1141669293 16:85483411-85483433 CAGTTTCCCCACCTGTACCCTGG + Intergenic
1141981803 16:87555182-87555204 CACTGTCTCCTCCTGGACGCTGG - Intergenic
1142692859 17:1617292-1617314 CAGTCTCCCCACATGGACAGAGG - Intronic
1144203941 17:12965866-12965888 GAGTCACTGCACCTGGCCTCAGG - Intronic
1144580694 17:16457449-16457471 CCGTCTCTCCTCCTGCCCTCTGG - Intronic
1145093323 17:20003696-20003718 CGTTCTCTCCACCGGGTCTCTGG - Intergenic
1147584644 17:41647345-41647367 CAGCATCTCCACCTGGACAGAGG - Intergenic
1148131689 17:45266239-45266261 CAGTCTCTTGACCTGGAGTCAGG - Intronic
1148515704 17:48215068-48215090 GAGTCACTGCACCTGGCCTCTGG + Intronic
1149133223 17:53333514-53333536 CAGTCTCTCTTCCTGGCCCCAGG + Intergenic
1149792825 17:59494173-59494195 CTGTCACTCCAACTGGACTCTGG + Intergenic
1149866025 17:60151375-60151397 CAGCCTCTCCACCGGGCCCCTGG + Intronic
1150548592 17:66188448-66188470 TATTCCCTCCACCTGGAGTCAGG + Intronic
1152562260 17:81084423-81084445 CAGACTGTCCACCTGGCCTGAGG + Intronic
1152914908 17:83029109-83029131 AAGTCTCTGCACCTTGACTGGGG + Intronic
1153063948 18:1023825-1023847 CAGTCTGTTCTCCTGCACTCAGG + Intergenic
1155286381 18:24293351-24293373 CATTCTCTCCAGCCGGACTGTGG - Intronic
1155505436 18:26528415-26528437 CAATCACTCCACCTGTCCTCAGG + Intronic
1155611156 18:27669234-27669256 CAGTCTTTTCACCTAGACTCTGG - Intergenic
1156193483 18:34746628-34746650 TAGTCTCCCCACAGGGACTCTGG + Intronic
1157504936 18:48219468-48219490 CAGTGTCCCCACCTGGAATGTGG - Intronic
1157564897 18:48673157-48673179 CAGACTCCCTTCCTGGACTCTGG + Intronic
1157624708 18:49041746-49041768 CAGCCTCTCCTCCAGGCCTCTGG - Exonic
1157850681 18:51047121-51047143 CACTCTCTCCACCTTGTCTATGG - Exonic
1158361278 18:56676790-56676812 CAGTCTGTCTTCCTGGGCTCAGG + Intronic
1160773993 19:846484-846506 CAGTCTCCCCACCTGGAAGGTGG + Intronic
1160816515 19:1038474-1038496 CACTTTCTCCACCTGGCCCCGGG - Exonic
1160935792 19:1593850-1593872 CAGTTTCTCCAGCTGGAGGCAGG - Intergenic
1161114309 19:2488349-2488371 CACTCCCTCCACCCGGACGCCGG + Intergenic
1161196627 19:2990029-2990051 CAGTTTCCCCACCTGGACACAGG + Intronic
1161548248 19:4895578-4895600 CCGCCTCTGCACCTGGACTCGGG + Intronic
1162456922 19:10790845-10790867 CAGCCTCACCACTTGGGCTCAGG + Intronic
1163503174 19:17688059-17688081 AAGTCCAGCCACCTGGACTCGGG + Intronic
1164620002 19:29689745-29689767 CACCATCTCCACCTGCACTCAGG - Intergenic
1165107125 19:33477091-33477113 CTGTCTCTCCAACTGTTCTCGGG + Intronic
1165393542 19:35551619-35551641 GAGGCTCTCCGCCGGGACTCAGG - Intronic
1167323896 19:48812523-48812545 CAGACTCCCCAGCTGGACCCAGG - Intergenic
1167650770 19:50727407-50727429 CAGTGTCTCCATCTGTACTGTGG + Intergenic
1168186532 19:54703859-54703881 CATTCTCTCCACCTGTTCTGGGG - Intergenic
1168707612 19:58478878-58478900 GAGTGTCTCCATCTGGTCTCAGG - Intronic
925847178 2:8044493-8044515 CTTTCTCTCCACCTGGACCTGGG + Intergenic
925915066 2:8599351-8599373 CACTCCCACCACCTGGGCTCAGG - Intergenic
927198915 2:20566504-20566526 CACTCTGGCCACCTGCACTCTGG + Intronic
927857297 2:26535650-26535672 CAGTCTCTCCACACTGACTCTGG + Intronic
928393581 2:30927547-30927569 CCATCCCTCCACCTGTACTCTGG - Intronic
930634863 2:53792926-53792948 CAGCCTGACCTCCTGGACTCAGG - Intronic
931867304 2:66426419-66426441 CTTTCTCCCCAGCTGGACTCGGG - Intergenic
936633221 2:114227090-114227112 CTGGGTCCCCACCTGGACTCAGG - Intergenic
939363627 2:141205426-141205448 CAGGCTCTCCACATGGAATGGGG + Intronic
940977955 2:159967671-159967693 CATTTTCTCCTCCAGGACTCTGG - Exonic
940984425 2:160038489-160038511 AAGTCTCCCCACCTGGGCTCTGG - Intronic
941580934 2:167294153-167294175 CAGTGGCCCCACCTGGACGCCGG - Intergenic
941924931 2:170885261-170885283 CAGCCTCACCACTTGGGCTCAGG - Intergenic
942320678 2:174733032-174733054 CTGTCACTCCACCTGAAGTCGGG + Intergenic
943611258 2:190037683-190037705 TAGTCTCTGCAGCTTGACTCTGG - Intronic
944799000 2:203217306-203217328 CAGTTTCTCCAGCTGAAATCTGG - Exonic
944906861 2:204270469-204270491 TGGTCTCTTCACATGGACTCAGG - Intergenic
945235779 2:207630155-207630177 CAGTCCTTCCACCTGGCCACAGG + Intergenic
946442259 2:219706722-219706744 TAGTCTCTCCACCCAGACCCTGG - Intergenic
947954736 2:234178892-234178914 CAGGCTCTCCTGCTGCACTCTGG + Intergenic
948405818 2:237718121-237718143 AGGGCTCTCCACCAGGACTCGGG + Intronic
1169835483 20:9873336-9873358 GACTGACTCCACCTGGACTCTGG + Intergenic
1169973906 20:11302047-11302069 CCCTCTCCCCACCTGGCCTCAGG - Intergenic
1171769493 20:29311508-29311530 AAGCCACTGCACCTGGACTCCGG - Intergenic
1171850668 20:30305802-30305824 CAGTCTCTTCCCCTTGGCTCAGG - Intergenic
1172187044 20:33037378-33037400 CAGTCTACCCACCTGTACACTGG + Intronic
1174404565 20:50294924-50294946 CAGTCCCTGCCCCTGGACTGTGG - Intergenic
1175180564 20:57143566-57143588 GAGTCTCTACACCTGGCCTGTGG - Intergenic
1175479760 20:59302464-59302486 CACTCTCTCCACATGGCCCCAGG - Intronic
1176014328 20:62921546-62921568 CATTCTCTCCACCTGAACTTAGG - Intronic
1178977153 21:37229946-37229968 CAGCCTCACCTCCTGGGCTCAGG + Intronic
1179040508 21:37798278-37798300 CAGCCCCTCCACATGGGCTCTGG + Intronic
1179130967 21:38636775-38636797 AACTCTCTCAACCTGGATTCCGG + Intronic
1179288379 21:39997222-39997244 CAGTCTGTTCTCCTGGATTCTGG + Intergenic
1179933275 21:44586108-44586130 CTGGCTCTCCTGCTGGACTCAGG + Intronic
1180731241 22:17984172-17984194 CACTCTCAACACCTAGACTCAGG + Intronic
1180756779 22:18167879-18167901 CAGTCTCTCCACCTGCAAGAGGG - Exonic
1181074985 22:20369564-20369586 CAGTCTCTCCACCTGCAAGAGGG + Exonic
1181374606 22:22446804-22446826 CAGCCTCTCCAGCTGGAGTGGGG + Intergenic
1181406386 22:22687692-22687714 CATTCTCTCCTCCTGATCTCAGG - Intergenic
1181741925 22:24928101-24928123 CAGTCTCTAAACATGGACTCAGG + Intergenic
1182275347 22:29185055-29185077 CAGTCTCTTCACCTGTACGCTGG - Intergenic
1182740077 22:32561239-32561261 CTGTCTCTCCTGCTGGCCTCAGG - Intronic
1183335816 22:37245216-37245238 AGGGCTCTCCACGTGGACTCGGG + Intergenic
1184176806 22:42793545-42793567 CCGTCTGTCCACCTGGGCTGCGG - Intergenic
949774986 3:7622806-7622828 CAGTCTGCCCTCATGGACTCTGG - Intronic
950265424 3:11569537-11569559 TCTTGTCTCCACCTGGACTCTGG - Intronic
952552645 3:34496611-34496633 TTGTCTCTCCCACTGGACTCTGG - Intergenic
953305072 3:41821541-41821563 CTGTCCCTCCACTTGGGCTCAGG + Intronic
953842399 3:46399637-46399659 TAATCTCTCCCCCTGCACTCTGG - Intergenic
954430190 3:50466734-50466756 CAGTCTGACCGCCTGCACTCAGG + Intronic
954672468 3:52298361-52298383 CAGACTCTCCACCTGGGCAGTGG + Intergenic
954753391 3:52826263-52826285 CCTTCTCTCCACCTGGCCCCAGG + Intronic
955057789 3:55471787-55471809 CACTCACACCACGTGGACTCTGG - Intronic
955101944 3:55859141-55859163 ATGTCTCTCCATCTGGACTAGGG - Intronic
955335858 3:58085422-58085444 CGGTCTCTCTTCCTGGGCTCAGG - Intronic
956511152 3:69994787-69994809 CAGTTTCTCCACCTGCAATCTGG + Intergenic
956786573 3:72647781-72647803 CTTTCTCTCCACCTTGTCTCTGG - Intergenic
960076595 3:113492804-113492826 GAGTCTTTCCACTTGGAGTCAGG - Intronic
960173609 3:114491579-114491601 CCATCTCTCCACTTGTACTCAGG + Intronic
961106936 3:124250289-124250311 CACACTCTCCAGCTGGGCTCTGG - Intronic
961203343 3:125061658-125061680 CAGTCTGTCCACCTGGGCTACGG - Intergenic
961406309 3:126682205-126682227 CAGTTTCCCCATCTGGGCTCAGG + Intergenic
963852772 3:150224664-150224686 CAGTGCCTCCACCTGGACTTTGG - Intergenic
964087588 3:152835763-152835785 CATTCTCTCCTCCTCGACTTAGG - Exonic
966068160 3:175841550-175841572 CTATCTCTCCAACTGGACTGTGG + Intergenic
968040999 3:195589185-195589207 CAGCACCTCCACCTGCACTCTGG - Intergenic
968360051 3:198140220-198140242 CAGCCTTTCCACCTGCACCCTGG + Intergenic
970507411 4:16745317-16745339 CAGTCTCCCCGCCTGGGCTCTGG - Intronic
971265599 4:25093880-25093902 CTGTCTCTCCACGTGTACCCTGG + Intergenic
973728069 4:53795759-53795781 CAGTATGTCCCCCTGGACTTAGG - Intronic
978619402 4:110623234-110623256 CAGTCCCTCCACCGCGGCTCGGG - Intronic
980053816 4:128061612-128061634 CCGTCTCTCCGCCGGGACACCGG - Intronic
980768126 4:137335122-137335144 CTGTCTCTCCACCTCTTCTCAGG - Intergenic
981578803 4:146231862-146231884 GACTCTCTCCTCCTGGATTCTGG + Intergenic
982026709 4:151258839-151258861 CACTCCCTGCCCCTGGACTCAGG - Intronic
985979071 5:3447698-3447720 CATGCTCTTCACCTGGTCTCAGG + Intergenic
988526351 5:31990517-31990539 CGGTCTCTCCAACTGGACCAGGG + Intronic
989758254 5:44982572-44982594 CAGTCTCTCAATCTTGTCTCTGG - Intergenic
990851592 5:60211061-60211083 CTTTCTCTCCACCTGGGCGCTGG + Intronic
991425102 5:66482528-66482550 CTGTCTCTCCAGCTGGATACTGG + Intergenic
992169704 5:74089568-74089590 CAGACTCTCCTGCTGGCCTCTGG - Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
995285111 5:110379131-110379153 CAGCCTGTACACCTGGAATCTGG - Intronic
995831589 5:116361125-116361147 CAGACTCCCTGCCTGGACTCTGG - Intronic
997005667 5:129813875-129813897 CAGGCTACCCACCTGGAATCAGG + Intergenic
997271134 5:132539044-132539066 CAGCCTCACCTCCTGGGCTCAGG + Intergenic
998957620 5:147453671-147453693 CATTCACTCCACCTGATCTCGGG - Intronic
999265059 5:150261435-150261457 CAGTCACTCCACCAGGAGACAGG - Intronic
999819542 5:155212169-155212191 CAGTCTCTTCTCCTTGCCTCAGG - Intergenic
999964582 5:156795743-156795765 CAGGCTACCCAGCTGGACTCTGG + Intergenic
1000013678 5:157257920-157257942 CACTCTCTCACCCTGCACTCTGG - Intergenic
1001081746 5:168672321-168672343 TAGTCTCTGCAGGTGGACTCTGG + Intronic
1001218456 5:169877780-169877802 CAGTCTGTCCAGGTGGACCCTGG + Intronic
1001451093 5:171824974-171824996 CACTCTCTTCACCTTGACTTTGG + Intergenic
1002350616 5:178580925-178580947 CAGCCTCCGCTCCTGGACTCAGG - Intronic
1002527010 5:179820612-179820634 CAGCCTCTGCACCTGGGATCAGG - Intronic
1003024067 6:2537833-2537855 CAGACTCTCCATCTGGGCCCTGG + Intergenic
1003337228 6:5185602-5185624 TTGTCTCTCCTCCTGGACTGTGG - Intronic
1003451725 6:6240591-6240613 CAGTCTCTCCACCTGCACTTTGG + Intronic
1005019327 6:21402430-21402452 CACTCTCACCCCCAGGACTCTGG - Intergenic
1005314190 6:24588384-24588406 CAGTCTCCTCTCCTGGACTATGG + Intronic
1006716955 6:36126574-36126596 CAGTCTCTCCATCTGTACCAGGG + Intergenic
1007781871 6:44259051-44259073 CAGTCCCTCCTCCTCGGCTCAGG + Exonic
1009958864 6:70494411-70494433 CAGTCTCATTTCCTGGACTCAGG - Intronic
1010648794 6:78426345-78426367 GAGTCACTGCACCTGGCCTCTGG - Intergenic
1012956749 6:105579189-105579211 CAGTTTCTTCACCTGGAAACAGG + Intergenic
1013623126 6:111909608-111909630 CAGTCTTTACACTTGAACTCTGG - Intergenic
1014773028 6:125478441-125478463 CAGACTCTGCAACTGAACTCTGG - Intergenic
1014961979 6:127697331-127697353 CATTCTTACCACCTGGATTCCGG + Intergenic
1016222188 6:141688574-141688596 AATTCTCTCCACTTGGCCTCTGG - Intergenic
1016276912 6:142364631-142364653 CAGTTTCTCCACCTTTACACTGG - Intronic
1016936529 6:149452293-149452315 CAGTCCCTTCACCTGGCCCCTGG - Intronic
1017086504 6:150717624-150717646 CAGTGTCCCCACCTGGAGTGGGG - Intronic
1017765165 6:157601044-157601066 CAGCCTCTCCATCTGCAGTCAGG - Intronic
1017905035 6:158752066-158752088 CAGGCGCTCCACCCGGGCTCGGG - Intronic
1018982032 6:168608384-168608406 CTGTCTCCCTGCCTGGACTCAGG - Intronic
1019558599 7:1644880-1644902 CAGGGCCTCCGCCTGGACTCTGG + Intergenic
1019748169 7:2712329-2712351 GAGACTCTACACCTGGACTCAGG + Exonic
1020506351 7:8993604-8993626 CAGTCTGTCCAGCTGGGTTCTGG + Intergenic
1020721573 7:11751548-11751570 CATTTTGACCACCTGGACTCTGG - Intronic
1022105579 7:27193966-27193988 CCGTCTCTGCTCCTGAACTCGGG + Intronic
1023860136 7:44213548-44213570 CAGTCTGCCCACCTGTGCTCAGG + Exonic
1029432538 7:100540190-100540212 TAGTATCTACACCTGAACTCTGG - Intronic
1030224388 7:107132652-107132674 CAGTCACTCCAGCTAGACACTGG - Intronic
1031466499 7:122118888-122118910 TAATCTCTCCACCTTGGCTCCGG + Intronic
1035043391 7:155947211-155947233 GAGTCGCTGCACCTGGCCTCTGG + Intergenic
1035122286 7:156578776-156578798 CAGGCTCTCCACCTGCAAGCTGG + Intergenic
1035282145 7:157785161-157785183 CAGGCTCTCCACAGGGGCTCTGG + Intronic
1035315115 7:157992772-157992794 CAGTGATTCCAGCTGGACTCTGG - Intronic
1035418650 7:158709378-158709400 GAGTCACTGCACCTGGCCTCAGG - Intergenic
1036081907 8:5566575-5566597 AAGTTTCTTCACTTGGACTCTGG - Intergenic
1042102557 8:65289093-65289115 CAGTCACTTCAACTGGACTTAGG + Intergenic
1045213333 8:100121756-100121778 CAGTCTCTCCAACAGTACTTGGG - Intronic
1046195925 8:110862298-110862320 CAGTCTCTCTCCCTTGGCTCTGG + Intergenic
1047567612 8:126062752-126062774 CTGTCTTTCCTCCTGGAGTCTGG - Intergenic
1049289085 8:141792039-141792061 CAGTCCTCCCACCTGGCCTCCGG + Intergenic
1049789176 8:144465295-144465317 CCGTCGCTCCTCCTGGACCCGGG - Intronic
1051045181 9:12864733-12864755 CTGTCTCTCCAACTCCACTCTGG - Intergenic
1051181401 9:14415712-14415734 CACTCTCTCCATATGGACTGTGG + Intergenic
1056499065 9:87190179-87190201 GAGTCACTGCACCTGGACACAGG - Intergenic
1057481294 9:95447384-95447406 CAGCAGCCCCACCTGGACTCAGG - Exonic
1057900595 9:98944847-98944869 CAGTTTCTCCAGCAGAACTCAGG + Intronic
1058523493 9:105834977-105834999 CACTCTCTCCACCTGCATTCAGG + Intergenic
1060189987 9:121586447-121586469 CAGTCTCTCCAACTGGAAGCAGG - Intronic
1061200779 9:129137351-129137373 CAGTTTCCTCACCTGGACACTGG - Intronic
1061824115 9:133247235-133247257 CAGTCTCCCCACATGGACAATGG - Intergenic
1062744757 9:138204061-138204083 CAGCCTTTCCACCTGCACCCTGG + Intergenic
1188335509 X:28927266-28927288 CAGCCTTTCCACTTGGACTCTGG + Intronic
1189266105 X:39717300-39717322 CTGTCTCTCCATGTGGCCTCTGG + Intergenic
1190738164 X:53269413-53269435 CAGTCTCTCCACCTGGACTCTGG + Intronic
1191145842 X:57164359-57164381 CACTGTCTCCACCTGGAATCTGG - Intergenic
1197584312 X:128326369-128326391 CATTCTCTCCACCTCCACCCAGG + Intergenic
1197596754 X:128472978-128473000 CAGTGAGTCAACCTGGACTCTGG - Intergenic
1198317039 X:135478234-135478256 CAGTCTCCCCATCTGTACTCTGG + Intergenic
1198728173 X:139698988-139699010 CAGTCTCCTCACCTGGAATGTGG - Intronic
1198951532 X:142077873-142077895 CAGTGCCTCAACCTGGCCTCAGG - Intergenic
1200259376 X:154604202-154604224 GAGTCATTCCACCTGGAATCTGG + Intergenic
1200884637 Y:8254908-8254930 CAGTCTCTGCACCTTGAAACAGG - Intergenic
1201075102 Y:10180922-10180944 GAGCCACTGCACCTGGACTCTGG + Intergenic
1202251746 Y:22880192-22880214 GAGTCTCTTCACCTGGATGCTGG + Intergenic
1202404734 Y:24513941-24513963 GAGTCTCTTCACCTGGATGCTGG + Intergenic
1202466045 Y:25156141-25156163 GAGTCTCTTCACCTGGATGCTGG - Intergenic