ID: 1190738870

View in Genome Browser
Species Human (GRCh38)
Location X:53274749-53274771
Sequence CAGCTAAAGCAGGCCGGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 699
Summary {0: 2, 1: 0, 2: 5, 3: 83, 4: 609}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190738870_1190738875 5 Left 1190738870 X:53274749-53274771 CCGCACCCGGCCTGCTTTAGCTG 0: 2
1: 0
2: 5
3: 83
4: 609
Right 1190738875 X:53274777-53274799 CTTTAACTATTAGTAAGCTTGGG 0: 1
1: 0
2: 0
3: 10
4: 155
1190738870_1190738874 4 Left 1190738870 X:53274749-53274771 CCGCACCCGGCCTGCTTTAGCTG 0: 2
1: 0
2: 5
3: 83
4: 609
Right 1190738874 X:53274776-53274798 TCTTTAACTATTAGTAAGCTTGG 0: 1
1: 0
2: 0
3: 12
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190738870 Original CRISPR CAGCTAAAGCAGGCCGGGTG CGG (reversed) Intronic
900121148 1:1049170-1049192 CAGCTCAGGTAGGCGGGGTGGGG + Intronic
900278331 1:1848087-1848109 ATGAAAAAGCAGGCCGGGTGCGG + Intronic
900666265 1:3817528-3817550 CAGCTAAAGCGGGACAGGAGTGG - Intronic
901880119 1:12188879-12188901 CAGCAAATGCTCGCCGGGTGAGG + Exonic
902227432 1:15005493-15005515 AACCTAAAGGGGGCCGGGTGCGG + Intronic
903171350 1:21556325-21556347 CAGCTTCAGCAGACCTGGTGTGG + Intronic
903474526 1:23610416-23610438 AAGCTGTAACAGGCCGGGTGTGG - Intronic
903517073 1:23918465-23918487 AAACAGAAGCAGGCCGGGTGCGG + Intergenic
903527434 1:24002519-24002541 AAGATAAAAGAGGCCGGGTGTGG + Intergenic
903850744 1:26304392-26304414 AACATAAAGCAGGCCGGGAGCGG + Intronic
904134229 1:28298798-28298820 AAGAGAAGGCAGGCCGGGTGCGG + Intergenic
904582264 1:31553159-31553181 GAGCTAAGGAAGGCTGGGTGCGG - Intergenic
904582643 1:31557713-31557735 AAGGTAAAACAGGCCGTGTGCGG - Intergenic
904612757 1:31734406-31734428 CAGCTAGTGCAGACGGGGTGAGG + Intronic
904748493 1:32725869-32725891 CAGCTTAAGCTGTCAGGGTGAGG - Intergenic
905399286 1:37690273-37690295 AAGCTGAGGCAGGCCGGGCGCGG - Intronic
905652328 1:39664777-39664799 CAAGAAAAGCAGGCCAGGTGCGG - Intronic
906157393 1:43621789-43621811 CAGCTACATCAGGCAGTGTGCGG - Intronic
906232838 1:44180288-44180310 TAGCTCAAGCAGGCCGGGCAGGG + Intergenic
906283608 1:44570781-44570803 AAGATAAATCAGGCCGAGTGTGG + Intronic
906314884 1:44780096-44780118 CCCAAAAAGCAGGCCGGGTGCGG - Intergenic
906383014 1:45344838-45344860 CAGGGAAAGCAGGATGGGTGAGG - Exonic
906959105 1:50404788-50404810 CAGAAAAAGTTGGCCGGGTGTGG - Intergenic
907822549 1:57985196-57985218 ATACTAAAGCAGGCCGGGTGTGG - Intronic
908806011 1:67933156-67933178 CAAGTAAAACAGGCTGGGTGTGG - Intergenic
909195904 1:72622810-72622832 CAGATAAAATAGGCCGGGTGTGG - Intergenic
909799002 1:79781480-79781502 CAGCTAAAGCAGGGCGAGAGTGG + Intergenic
910190735 1:84592657-84592679 AAGCTTAAGCAGGCCGGGTGTGG + Intergenic
910834694 1:91496958-91496980 GAAATAAAGCAGACCGGGTGTGG - Intergenic
910885148 1:91956315-91956337 CAGGAAAAGCAGGCAGGGGGTGG - Intronic
910931124 1:92443447-92443469 CAGAGGAGGCAGGCCGGGTGCGG + Intergenic
911105715 1:94129831-94129853 AAGCTAAATCGGGCCGGGAGCGG + Intergenic
912357168 1:109063865-109063887 CAGCTATAGTAGGCCAGGCGCGG + Intronic
912382487 1:109254954-109254976 CACCAAAGGCAGGCTGGGTGTGG - Intronic
913119047 1:115722755-115722777 AAGCATAAGCAGGCCGGGCGTGG + Intronic
914429502 1:147608021-147608043 CAGATAAAGAAGGCCTGGAGAGG + Intronic
914683984 1:149961641-149961663 CAGTTAATGCTGGCCGGATGCGG - Intronic
914750555 1:150532195-150532217 AAGCAAAGGCTGGCCGGGTGCGG - Intergenic
914935890 1:151979919-151979941 TAGATAAAGCAGGCCAGGCGCGG - Intergenic
915233416 1:154463092-154463114 AAGCAAAATAAGGCCGGGTGTGG - Intronic
915574355 1:156765761-156765783 TGGATAAAGTAGGCCGGGTGTGG - Intronic
916622115 1:166510637-166510659 CACCTAAAGAAGGCCGAGTTTGG + Intergenic
917336128 1:173926092-173926114 CAGCAAAGGGAGGCTGGGTGCGG + Intergenic
917877582 1:179300049-179300071 CAGCAAAATGAAGCCGGGTGCGG - Intronic
918422068 1:184374236-184374258 AAGCTGAGGCAGGCCGGGTGCGG + Intergenic
919596397 1:199568752-199568774 TAGAAAAAGCAGGCCAGGTGTGG + Intergenic
921039897 1:211420441-211420463 CAGCTAAAGTAGGCTGGAGGGGG - Intergenic
921223112 1:212988366-212988388 GAGCTAAGGCTGGCAGGGTGGGG + Intronic
921767796 1:218992853-218992875 ATGGTAAACCAGGCCGGGTGCGG - Intergenic
923561039 1:235042019-235042041 AAGTTAAAGCAGGCTGGCTGTGG - Intergenic
923576584 1:235164035-235164057 AAACAAAAGGAGGCCGGGTGCGG + Intronic
924473554 1:244364393-244364415 AATAAAAAGCAGGCCGGGTGTGG - Intronic
924738212 1:246778317-246778339 AAGATAAGGCAGGCCAGGTGTGG - Intergenic
924921008 1:248629114-248629136 CAGTAAAAACAGGCCAGGTGTGG + Intergenic
1063244084 10:4200801-4200823 TAGACAAAGCAGGCCGGGCGTGG + Intergenic
1063253254 10:4297284-4297306 GATCAAAAGCAGGCTGGGTGTGG - Intergenic
1064298115 10:14096842-14096864 CAAAAAAAGCAGGCCGGGTGCGG + Intronic
1064318677 10:14281280-14281302 AAGCAAAACCAGGCTGGGTGTGG - Intronic
1065781102 10:29168541-29168563 TATCTAAATCAGGCCAGGTGTGG + Intergenic
1066116400 10:32244039-32244061 AAGTTGCAGCAGGCCGGGTGCGG - Intergenic
1066386231 10:34943757-34943779 CAGCCAAACTCGGCCGGGTGCGG + Intergenic
1066702157 10:38141817-38141839 AGGCTAAAGCGGGCTGGGTGTGG + Intergenic
1067376710 10:45733937-45733959 AACCTACAGTAGGCCGGGTGCGG + Intronic
1067884405 10:50074628-50074650 AACCTACAGTAGGCCGGGTGCGG + Intronic
1068222473 10:54061932-54061954 AAACTAAATGAGGCCGGGTGTGG + Intronic
1068716260 10:60192180-60192202 CAAATAAAATAGGCCGGGTGCGG - Intronic
1068920530 10:62478528-62478550 CAGCTCAAGCAGGAAGGATGGGG + Intronic
1069004621 10:63303594-63303616 AAGCACAAGCAGGCCGGGTATGG - Intronic
1069114524 10:64488864-64488886 CAGATCTTGCAGGCCGGGTGTGG + Intergenic
1069157573 10:65050901-65050923 AAGAGAAAACAGGCCGGGTGCGG - Intergenic
1069526434 10:69176138-69176160 TAGCAAAAGCAGGCCGGGCGCGG + Intergenic
1069535730 10:69251384-69251406 CTTATAAAGTAGGCCGGGTGTGG - Intronic
1070371256 10:75784407-75784429 TAGATAATGCTGGCCGGGTGCGG + Intronic
1071190940 10:83099872-83099894 AAACAAAAGCTGGCCGGGTGAGG + Intergenic
1071417180 10:85452223-85452245 AAGCAACAGAAGGCCGGGTGCGG - Intergenic
1071931609 10:90478067-90478089 TAGCTAAGTCAGGCCAGGTGCGG + Intergenic
1072450484 10:95535750-95535772 CAGCTAATGGAGGTGGGGTGAGG + Intronic
1072534124 10:96347382-96347404 AAGCTAAATCTGGCTGGGTGCGG - Intronic
1072583745 10:96763388-96763410 GAGATAATGCAGGCCGGGCGCGG + Intergenic
1072644356 10:97241028-97241050 AAGATACAGCAGGCTGGGTGCGG + Intronic
1073372862 10:103006494-103006516 AATCTAAAGCAGGCCAGGAGTGG - Intronic
1074603575 10:114938537-114938559 CAGGTACTGCAGCCCGGGTGGGG + Exonic
1074748922 10:116564968-116564990 GAGCTAAAAGGGGCCGGGTGTGG + Intronic
1074790875 10:116886912-116886934 CAGCTAAGTGAGGGCGGGTGGGG - Intronic
1075342755 10:121660683-121660705 CATTTAAATCAGGCCAGGTGTGG - Intergenic
1075471440 10:122693189-122693211 AAGCTAAAGAAGGCTGAGTGTGG - Intergenic
1075582135 10:123627770-123627792 CAAAAAAAGCAGGCCAGGTGTGG - Intergenic
1077051870 11:570260-570282 CAGGGAAAACAGGCCGGGTGTGG + Intergenic
1077893081 11:6433465-6433487 TAGCTAAGATAGGCCGGGTGTGG - Intronic
1078211570 11:9274207-9274229 AAGCTCAAACAGGCTGGGTGTGG - Intergenic
1078298782 11:10103788-10103810 CAGATAATGAAGGCCAGGTGCGG + Intronic
1079642155 11:22819479-22819501 TAGCCAATGCAGGCCGGGCGCGG + Exonic
1081151571 11:39639282-39639304 CTATGAAAGCAGGCCGGGTGCGG + Intergenic
1081696635 11:45115637-45115659 AAGCTAGAGCAGGCCAGGTGTGG + Intronic
1081796086 11:45820968-45820990 CAGAAAAAGTAGGCCGGGCGCGG + Intergenic
1083368551 11:62158757-62158779 CTTGTAAAGCAGGCCTGGTGGGG - Intergenic
1083557660 11:63644679-63644701 TAGATAAATCTGGCCGGGTGTGG - Intronic
1084198074 11:67537224-67537246 AAGCTAGGCCAGGCCGGGTGTGG + Intergenic
1084286491 11:68134604-68134626 CAGGTGAAGCCGGCCGGGCGCGG + Intergenic
1084311407 11:68318333-68318355 AAAAAAAAGCAGGCCGGGTGTGG - Intronic
1085543471 11:77295339-77295361 AATCTAAAGCTGGCCAGGTGTGG + Intronic
1086990269 11:93295202-93295224 AAACAAAAACAGGCCGGGTGTGG - Intergenic
1088879578 11:113962981-113963003 AAGTCACAGCAGGCCGGGTGTGG + Intergenic
1089271123 11:117302041-117302063 AACGTAAAGCTGGCCGGGTGCGG + Intronic
1089427750 11:118393884-118393906 TAGAAAAAGCAGGCTGGGTGAGG - Intronic
1091529700 12:1342172-1342194 AAGTTAATGCGGGCCGGGTGCGG + Intronic
1091964410 12:4725842-4725864 CTTCAAAAGCAGGCCGGGCGTGG - Intronic
1092146654 12:6219294-6219316 AAGCCCATGCAGGCCGGGTGCGG - Intronic
1092394940 12:8117527-8117549 GAGCCCAAGCAGGCTGGGTGCGG - Intergenic
1093176966 12:15923310-15923332 AAGCAAAAACAGGCCGGGCGCGG - Intronic
1093178458 12:15940639-15940661 GAAGTAAAGCAGGCCGGATGCGG - Intronic
1093504412 12:19848383-19848405 AAGCTGAAGCAAGCCAGGTGTGG + Intergenic
1093639758 12:21512780-21512802 CAATTAAATAAGGCCGGGTGTGG + Intronic
1093941811 12:25063340-25063362 AAAGTAAAACAGGCCGGGTGCGG - Intronic
1094215613 12:27939070-27939092 AAACAAAAGTAGGCCGGGTGTGG + Intergenic
1094632666 12:32192139-32192161 AAGATAAAGCAGGCCAGGTGCGG + Intronic
1095745585 12:45654718-45654740 AAAGTAAAACAGGCCGGGTGCGG + Intergenic
1096253133 12:50046158-50046180 GATCTAATCCAGGCCGGGTGCGG - Intergenic
1096276730 12:50215761-50215783 AAAATAAAGCAGGCCGGGCGCGG - Intronic
1096302637 12:50445009-50445031 CAGCTAACTCGGGCCGGGGGTGG - Intronic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096768329 12:53913242-53913264 AAGCAAAAGCAGGCCAGGCGCGG - Intergenic
1096933857 12:55247160-55247182 CTGTTAAAGGAGGTCGGGTGTGG + Intergenic
1098556426 12:71824070-71824092 CAGCTAAGACAGGCTGGGTCTGG + Intergenic
1098900410 12:76106161-76106183 AAACTTAAACAGGCCGGGTGCGG - Intergenic
1098946890 12:76599612-76599634 AGGTTACAGCAGGCCGGGTGTGG - Intergenic
1099855756 12:88163905-88163927 CATCAAAATCAGGCCAGGTGTGG + Intronic
1099907197 12:88785601-88785623 CAAGTAAAGCAGGCCAGGCGCGG + Intergenic
1100228980 12:92588200-92588222 AAAATAAACCAGGCCGGGTGCGG + Intergenic
1100542476 12:95570982-95571004 CATGTAAGTCAGGCCGGGTGTGG - Intergenic
1100543164 12:95577042-95577064 AAACTGAAGCAGGCCGGGCGTGG - Intergenic
1101119660 12:101565694-101565716 AAGCTAAAGTTGGCCGGGCGCGG + Intergenic
1102338236 12:112100906-112100928 CAGTGGAATCAGGCCGGGTGTGG - Intronic
1102338303 12:112101464-112101486 AAGATAATACAGGCCGGGTGCGG + Intronic
1102867660 12:116386849-116386871 CAGGTCAAGTGGGCCGGGTGTGG - Intergenic
1103365662 12:120381058-120381080 GAGCTACATCTGGCCGGGTGCGG + Intergenic
1103413391 12:120728235-120728257 CAGTTCAAGCAGGCCGGGCACGG - Intronic
1104613938 12:130253283-130253305 CAGCACAAGGAGGCAGGGTGAGG + Intergenic
1105036648 12:132929115-132929137 CAGATGAAGCAGGCTGGCTGCGG + Intronic
1106199093 13:27521305-27521327 AAGTAAAAGCAGGCTGGGTGCGG + Intergenic
1106207493 13:27613479-27613501 CAGTGGAAGCAGGCCGGGCGTGG + Intronic
1106597662 13:31161070-31161092 CAGCTCAGAGAGGCCGGGTGGGG + Intronic
1107170178 13:37332136-37332158 CTGATAGAGCTGGCCGGGTGCGG - Intergenic
1110107312 13:71693606-71693628 AAGCAAAACCAGGCCGGGCGCGG - Intronic
1110616057 13:77543371-77543393 AAGCTAAAGTTGGCCGGGCGCGG - Intronic
1111700135 13:91676359-91676381 CAGCCAAAGGTGGCCGGGTGCGG - Intronic
1112315086 13:98353666-98353688 TACAAAAAGCAGGCCGGGTGTGG - Intronic
1112749394 13:102566596-102566618 CAGATAAAGCAGGTGGGGAGGGG + Intergenic
1113426347 13:110211401-110211423 CAGCGGAAGGAGGCCTGGTGTGG - Intronic
1114007464 14:18330631-18330653 TAACAAATGCAGGCCGGGTGCGG - Intergenic
1114416591 14:22548948-22548970 TAAGAAAAGCAGGCCGGGTGTGG - Intergenic
1114447514 14:22800642-22800664 TTGATAAAGAAGGCCGGGTGCGG + Intronic
1114511631 14:23266699-23266721 GATTTAAATCAGGCCGGGTGTGG - Intronic
1115204608 14:30888489-30888511 CTGCTAAATGAGGCCAGGTGTGG + Intronic
1115542187 14:34431455-34431477 ATGCTAAATCAGGCCGGGCGTGG + Intronic
1116844256 14:49850376-49850398 CACCTAAAACAGACCAGGTGCGG - Intronic
1116966334 14:51019143-51019165 CAGCTAAAGCAGACCTGGGAAGG + Intronic
1117281772 14:54248334-54248356 CATCCCCAGCAGGCCGGGTGGGG - Intergenic
1117366568 14:55035149-55035171 GAGCTAATGCAGGCCGGGCACGG - Intronic
1117386649 14:55221022-55221044 CAGTTACATCAGGCCTGGTGCGG + Intergenic
1117477337 14:56109836-56109858 AAGTGAATGCAGGCCGGGTGTGG + Intergenic
1118296355 14:64573620-64573642 AAGCGAAAATAGGCCGGGTGTGG + Intronic
1118360230 14:65050303-65050325 TAACTAAAGCTGGCCGGGCGTGG + Intronic
1118825748 14:69379228-69379250 AAGCTAAAATAGGCCGGGTGCGG - Intergenic
1119225344 14:72940879-72940901 CTGCTGAAGAAGGCTGGGTGTGG - Intronic
1120120427 14:80673351-80673373 GCACTAAAGCAGGCCGGGCGCGG + Intronic
1120124345 14:80723114-80723136 AAGATAAAGAGGGCCGGGTGCGG - Intronic
1121529046 14:94639915-94639937 CAGAAAAACCAGGCAGGGTGAGG + Intergenic
1122231585 14:100308809-100308831 GAGCTGAGGCAGGCCGTGTGAGG + Intergenic
1122537758 14:102478038-102478060 AAACAAAAACAGGCCGGGTGCGG - Intronic
1122673317 14:103389072-103389094 AAGAAAAGGCAGGCCGGGTGTGG + Intronic
1122709399 14:103644546-103644568 CAGGTCATGCAGGCCGGGCGCGG - Intronic
1202879811 14_KI270722v1_random:47260-47282 AAGAACAAGCAGGCCGGGTGCGG + Intergenic
1123902697 15:24892488-24892510 TAGCAAAATCAGGCCGGGTGTGG + Intronic
1124611390 15:31211861-31211883 AAGATAAAACAGGCTGGGTGTGG + Intergenic
1124964334 15:34422114-34422136 CTGCTACAGGAGGCGGGGTGGGG - Intronic
1124980953 15:34568342-34568364 CTGCTACAGGAGGCGGGGTGGGG - Intronic
1125501833 15:40244686-40244708 TAGAAAAAGCAGGCTGGGTGTGG - Intronic
1125632460 15:41158448-41158470 AAGCTACAGTAGGCCGGGCGCGG + Intergenic
1125662648 15:41406255-41406277 CAACAAAAACAGGCCGGGCGCGG - Intergenic
1125779853 15:42255420-42255442 AAGCAAAAGTTGGCCGGGTGCGG - Intronic
1125850222 15:42896033-42896055 CAGAAAAGACAGGCCGGGTGTGG + Intronic
1125913996 15:43468252-43468274 AAGCTAAAGAAGGCCAGGTACGG + Intronic
1125968780 15:43895072-43895094 CAACAAACACAGGCCGGGTGTGG - Intronic
1126146118 15:45474538-45474560 GAGATAAAACAGGCCGGGCGCGG + Intergenic
1126821931 15:52513138-52513160 CAGAATAAGCTGGCCGGGTGCGG + Intronic
1127098404 15:55536137-55536159 GAAATATAGCAGGCCGGGTGCGG - Intergenic
1128979796 15:72178016-72178038 AAGCTAAAGCCGGCCAGGTGCGG - Intronic
1129354634 15:74981647-74981669 AAACAAAAACAGGCCGGGTGCGG + Intronic
1129802611 15:78427445-78427467 CAGCTAAAGCTGGCCTGTTTGGG + Intergenic
1130220092 15:82012059-82012081 CAACAAAAACAGTCCGGGTGCGG - Intergenic
1130374338 15:83314729-83314751 TAGTAAATGCAGGCCGGGTGTGG - Intergenic
1130423464 15:83772142-83772164 GAGCCAAAGGAGGCCGGGCGTGG - Intronic
1130620710 15:85459487-85459509 AAGAAAAAGCAGGCTGGGTGTGG - Intronic
1130751276 15:86715766-86715788 AATATAAATCAGGCCGGGTGCGG + Intronic
1130949389 15:88573529-88573551 GAGCCAAGGCTGGCCGGGTGTGG - Intergenic
1132397464 15:101484679-101484701 CACACAAAGCAGGCCGGGCGTGG - Intronic
1132755019 16:1479783-1479805 TAAATAAAGCCGGCCGGGTGCGG + Intergenic
1133157875 16:3888566-3888588 AACTGAAAGCAGGCCGGGTGCGG - Intergenic
1135021317 16:18965398-18965420 AACACAAAGCAGGCCGGGTGCGG + Intergenic
1135031684 16:19043860-19043882 AAACAAAAGCAGGCCGGGCGCGG - Intronic
1135032285 16:19047987-19048009 CATCAAGAGTAGGCCGGGTGCGG - Intronic
1136624543 16:31454014-31454036 ATAATAAAGCAGGCCGGGTGTGG + Intergenic
1137495719 16:48967660-48967682 CTGCTAAAGCAGGTCTGGGGTGG + Intergenic
1137549553 16:49427921-49427943 CACCAAAAGCAGGCTAGGTGGGG - Intergenic
1137549566 16:49427973-49427995 CACCGAGAGCAGGCTGGGTGGGG - Intergenic
1138686010 16:58726469-58726491 TAAATAAAGCAGGCCGGGGGCGG - Intronic
1139332195 16:66201957-66201979 AAACTAAAGCAGGCCTGGCGTGG - Intergenic
1139424497 16:66870970-66870992 CTGCAGAAGAAGGCCGGGTGCGG + Intronic
1139529828 16:67537640-67537662 CAGGGGAAGCAGGCCGGGTTTGG + Intronic
1139718223 16:68831378-68831400 AAGCTAAAGCAGTCCGGGCGTGG - Intronic
1140737170 16:77908623-77908645 CAGGAAAAGGAGGCCGGGCGCGG + Intronic
1141081599 16:81057739-81057761 AACCTGAAACAGGCCGGGTGTGG + Intronic
1141528993 16:84633109-84633131 AAGTAAAAGCAGGCTGGGTGCGG + Intergenic
1141731720 16:85827454-85827476 GATGTAAAGCAGGCTGGGTGTGG + Intergenic
1141867562 16:86761179-86761201 CACCGAAAGCAGGCTTGGTGTGG - Intergenic
1142523995 17:525396-525418 GATCTAAAGCAGGCAGGGTGTGG + Intronic
1143273246 17:5690916-5690938 CAGCAAAAGAGGGCCCGGTGTGG - Intergenic
1143477500 17:7211221-7211243 CAACTAAAGCAGGACGGGAAAGG + Intronic
1144101827 17:11948518-11948540 GAGCCAGAGGAGGCCGGGTGCGG - Intronic
1144394695 17:14832839-14832861 AAGAAAAAGCAGGCCGGGCGCGG - Intergenic
1144555000 17:16274430-16274452 GAAGTAAAGGAGGCCGGGTGCGG + Intronic
1144886682 17:18467730-18467752 CAGAAAAAGTAGGCCAGGTGCGG + Intergenic
1145032540 17:19515877-19515899 CATTTAAAACAGGCCGGGAGTGG - Intronic
1145081654 17:19899243-19899265 GAGGTAAAGGAGGCCAGGTGTGG - Intergenic
1145783137 17:27577276-27577298 CAGCTGAAGCAGACTCGGTGGGG - Intronic
1145830758 17:27914296-27914318 AAACTAAACTAGGCCGGGTGCGG - Intergenic
1145891148 17:28416624-28416646 AAGCTAAAGTGAGCCGGGTGTGG - Intergenic
1145900903 17:28489981-28490003 TAGATAATCCAGGCCGGGTGTGG + Intronic
1146198534 17:30833970-30833992 AAGTTAAACCAGGCCAGGTGCGG - Intronic
1146486841 17:33249780-33249802 CACCAAAGGCAGGGCGGGTGGGG + Intronic
1146756304 17:35434592-35434614 AAGCTAGCGCAGGCCGGGTGCGG + Intergenic
1147006735 17:37409377-37409399 AAGTGAAAGCAGGCTGGGTGTGG - Intronic
1147223137 17:38952034-38952056 CAAACAAAACAGGCCGGGTGCGG + Intronic
1147939471 17:44036127-44036149 CAGCGGAGGCAGGCCGGGGGAGG - Exonic
1147942598 17:44059872-44059894 AAGTTAGAGTAGGCCGGGTGTGG + Intronic
1149384437 17:56127602-56127624 AAGCTCAGGCTGGCCGGGTGCGG - Intronic
1149467817 17:56893523-56893545 CAGCTGCAGCAGGCTTGGTGGGG - Intronic
1149493624 17:57102760-57102782 TAGCTCAAGGAGGCTGGGTGCGG - Intronic
1149732994 17:58964751-58964773 CAGAAAAAACAGGCCGGGTGCGG + Intronic
1149789076 17:59461638-59461660 AGGCTAAGGAAGGCCGGGTGTGG + Intergenic
1150632568 17:66890324-66890346 GAGCAAAAGCAGCCCTGGTGAGG - Intergenic
1150700917 17:67446233-67446255 CAGTCAAAGAAGGCTGGGTGTGG - Intronic
1151580276 17:74973517-74973539 CATCAAAACAAGGCCGGGTGCGG + Intergenic
1151706373 17:75770716-75770738 AAACTAAAACAGGCTGGGTGTGG - Intergenic
1152086374 17:78221623-78221645 AAGACAAAACAGGCCGGGTGCGG - Intronic
1152192108 17:78894988-78895010 CAGCAAAAGAAGGACAGGTGTGG + Intronic
1152477840 17:80529761-80529783 AAGCTAAGGAAGGCTGGGTGTGG + Intergenic
1152513061 17:80803374-80803396 CAGACACAGCAGGACGGGTGGGG - Intronic
1152692869 17:81728428-81728450 CAGCTAGAGCTGGCCAGGTGCGG - Intergenic
1152775506 17:82199185-82199207 AAGCTATAGCAGGCTGGGTGTGG + Intronic
1152872502 17:82764352-82764374 AGGAGAAAGCAGGCCGGGTGCGG + Intronic
1153211498 18:2770910-2770932 CAGCAAACGTAGGCTGGGTGTGG - Intronic
1153276663 18:3374249-3374271 CAGGGAATGCAGGCTGGGTGGGG + Intergenic
1153579734 18:6560799-6560821 TATCTAAAGCAGGCTGGGCGTGG - Intronic
1155164991 18:23224857-23224879 AAGAAAAAGAAGGCCGGGTGCGG - Intronic
1155234530 18:23806148-23806170 CACCAAAAGCAAGGCGGGTGTGG - Intronic
1155472904 18:26209187-26209209 AAAGTAAAGCAGGCTGGGTGTGG + Intergenic
1156245953 18:35298308-35298330 CATCTAAAGCAAGCTGGGTGTGG - Intergenic
1156310521 18:35918174-35918196 CAAGCAAAACAGGCCGGGTGCGG - Intergenic
1156606014 18:38668363-38668385 GATGCAAAGCAGGCCGGGTGCGG + Intergenic
1157319785 18:46625156-46625178 GAACTAAAGCTGGCAGGGTGGGG - Intronic
1158345625 18:56513683-56513705 CAGTTAATGCAGGCCGGGTGCGG + Intergenic
1159262916 18:66039190-66039212 CAGCTAAAACAGGTCTGATGTGG + Intergenic
1159566600 18:70058224-70058246 AAAGTAAAACAGGCCGGGTGCGG + Intronic
1159931646 18:74318498-74318520 CAGCTTAAGAGGGCCGGGCGTGG + Intronic
1160207840 18:76850892-76850914 CACTTCAAGCAGGCCGGGGGTGG - Intronic
1161071067 19:2261362-2261384 TAGCAAAAATAGGCCGGGTGTGG - Intronic
1161195774 19:2985707-2985729 GACTTCAAGCAGGCCGGGTGCGG - Intronic
1161207481 19:3048803-3048825 AAACAAAAGCAGGCCGGGCGCGG - Intergenic
1161236325 19:3200021-3200043 CAGCTGAACCAGGCAGAGTGCGG + Intronic
1161346058 19:3769376-3769398 AAGCTAAACCAGGCCAGGTGCGG - Exonic
1161516364 19:4698866-4698888 ATGCAAAAGAAGGCCGGGTGTGG + Intronic
1161742154 19:6028050-6028072 AAACAAAAGCAGGCAGGGTGTGG - Intronic
1161795807 19:6386093-6386115 AAACTAAAACAGGCCGGGCGTGG + Intronic
1161817855 19:6510821-6510843 CAGTTTAAGGAGGCCGGATGTGG + Intergenic
1162364826 19:10242215-10242237 AAGCAAAAAGAGGCCGGGTGCGG + Intergenic
1162407956 19:10486904-10486926 ATGCAAAAGCAGGCCGGGCGTGG + Intronic
1162729335 19:12708574-12708596 CATGTAATACAGGCCGGGTGCGG + Intronic
1162731718 19:12722304-12722326 CAGCTAGAACGGGCCGGGCGGGG - Intronic
1163401611 19:17096978-17097000 CAGCAACAACAGGCCGGGCGTGG - Intronic
1163575215 19:18107104-18107126 TAGCCAGAGTAGGCCGGGTGCGG - Intronic
1163590225 19:18189426-18189448 CTCCTAATGCTGGCCGGGTGCGG + Intergenic
1163689901 19:18732798-18732820 TAACTACAGGAGGCCGGGTGTGG + Intronic
1163995285 19:21039754-21039776 AAGCAAAAGTAGGCCGGGTGCGG - Intronic
1164177609 19:22789962-22789984 CAACAGAAGCAGGCCGGGTGCGG - Intergenic
1164488242 19:28680635-28680657 CAGCTCAAGCAGGCCTTATGAGG - Intergenic
1164674047 19:30090218-30090240 CAGCTAAGGTGGGCAGGGTGGGG - Intergenic
1164800737 19:31074053-31074075 CAGCCAAAAGAGGCCGGCTGGGG + Intergenic
1164972856 19:32547435-32547457 TAACTGAAGCAGGCTGGGTGCGG - Intergenic
1165003864 19:32788400-32788422 AAAGTAAAGCAGGCTGGGTGTGG - Intronic
1165016368 19:32883361-32883383 CAACAAATGCTGGCCGGGTGCGG + Intronic
1165025293 19:32956342-32956364 AAGAAAAAACAGGCCGGGTGCGG - Intronic
1165056241 19:33177793-33177815 CAGCTGCAGACGGCCGGGTGTGG + Intronic
1165525770 19:36353408-36353430 CAGCTCATGTAGGCCGGGTGTGG + Intronic
1165659357 19:37562090-37562112 AAGATAATGTAGGCCGGGTGCGG + Intronic
1165814512 19:38633406-38633428 AAACTAAGGAAGGCCGGGTGCGG + Intronic
1165839138 19:38776757-38776779 TAGTTAATGTAGGCCGGGTGTGG + Intergenic
1165992034 19:39821479-39821501 CAATGAAAGCAGGCTGGGTGCGG - Intergenic
1166037012 19:40175900-40175922 AATAAAAAGCAGGCCGGGTGCGG - Intergenic
1166144116 19:40822529-40822551 TAGCTAGAGCTGGCCGGGCGCGG + Intronic
1166174974 19:41061337-41061359 AAGCTAAGATAGGCCGGGTGTGG - Intergenic
1166183496 19:41124551-41124573 TAGCTAGAGCTGGCCGGGCGCGG - Intronic
1167087069 19:47317690-47317712 TAGAAAAACCAGGCCGGGTGTGG + Intronic
1167256371 19:48432198-48432220 AAGAAAAAGAAGGCCGGGTGCGG - Intronic
1167259065 19:48447669-48447691 AAACTGAAGGAGGCCGGGTGTGG - Intronic
1167371223 19:49083484-49083506 CAAATAAAATAGGCCGGGTGTGG - Intergenic
1167396231 19:49231235-49231257 AAACTAAAACAGGCCGGGCGTGG - Intergenic
1167507758 19:49880146-49880168 AAGGTACAGCAGGCCGGGTGCGG - Intronic
1167695229 19:51011319-51011341 CAGATGGAGCAGGCCAGGTGCGG - Intergenic
1167771077 19:51519003-51519025 CAGCTAATCAAAGCCGGGTGCGG + Intergenic
1168217076 19:54934229-54934251 TACCAAAAACAGGCCGGGTGCGG - Intronic
1168231713 19:55036720-55036742 AAGTTAAAACAGGCTGGGTGCGG + Intronic
1168368558 19:55811470-55811492 CAGCTGCAGCAGGGCTGGTGTGG + Intronic
1168495516 19:56844883-56844905 AAGCAATAGCAGGCCGGGTGCGG - Intergenic
1202655429 1_KI270708v1_random:16279-16301 AAGAACAAGCAGGCCGGGTGTGG + Intergenic
925612821 2:5717423-5717445 TAGCAAAAGTAGGCTGGGTGTGG - Intergenic
926172842 2:10564029-10564051 AAGAAAAAGCAGGCCAGGTGCGG + Intergenic
927129107 2:20042253-20042275 AAGCCAATGCAGGCTGGGTGCGG - Intronic
927205586 2:20608282-20608304 TAGCAGAAACAGGCCGGGTGTGG + Intronic
927663021 2:25008805-25008827 GAGAGAAAGCAGGCCGGGTGTGG - Intergenic
928305862 2:30169913-30169935 CAACAACAGAAGGCCGGGTGTGG - Intergenic
928951033 2:36813128-36813150 AAGCAAAAACAGGCTGGGTGCGG - Intronic
929218806 2:39442360-39442382 CAACCAAAATAGGCCGGGTGCGG - Intergenic
929544103 2:42844517-42844539 AGGGCAAAGCAGGCCGGGTGCGG - Intergenic
929887133 2:45888934-45888956 CAGCAAAACCAGCCCGTGTGGGG + Intronic
931360243 2:61571815-61571837 AAGACAAAGCAGGCCGGGCGCGG + Intergenic
932193345 2:69760120-69760142 AAGATAAAACAGGCCGGGCGTGG - Intronic
932224251 2:70026958-70026980 AAGCTATAGCAGGCTGGGTGTGG + Intergenic
932241041 2:70157162-70157184 CACCAAAATAAGGCCGGGTGCGG + Intronic
932621088 2:73265309-73265331 CAGCCATAGCAGGCCCGGGGCGG + Exonic
932688614 2:73893906-73893928 CAGGTGAGGCAGGCTGGGTGTGG + Intronic
935652747 2:105396352-105396374 CAGCTCAAGCAGTCCGGCAGGGG + Intronic
935757616 2:106288732-106288754 AACCTAAAAAAGGCCGGGTGCGG - Intergenic
935766777 2:106375642-106375664 GTGCTACAGAAGGCCGGGTGTGG - Intergenic
936100202 2:109570810-109570832 TACCTAATACAGGCCGGGTGTGG - Intronic
936366228 2:111859190-111859212 GTGCTACAGAAGGCCGGGTGTGG + Intronic
936456694 2:112680628-112680650 AAATTAAAGCAGGCCAGGTGAGG - Intergenic
936637289 2:114273293-114273315 AAGTCATAGCAGGCCGGGTGTGG + Intergenic
938375362 2:130801823-130801845 AAGGTACAGCAGGCCGGGCGCGG + Intergenic
940314048 2:152308873-152308895 CAATTAACTCAGGCCGGGTGAGG + Intergenic
941470118 2:165874054-165874076 CAACAAAAACAGGCTGGGTGCGG + Exonic
941821738 2:169850467-169850489 GATCCAGAGCAGGCCGGGTGCGG - Intronic
942147248 2:173039165-173039187 AAGTTCAAGCAGGCCAGGTGTGG + Intronic
942653577 2:178193730-178193752 CACCGAACGCAGGCCGGGAGTGG + Intergenic
944160352 2:196652968-196652990 GAGCTAAAGCAGCCAGGATGTGG + Intronic
944341232 2:198603141-198603163 CAGCAAAATAAGGCCGGGCGCGG + Intergenic
944504625 2:200397926-200397948 CAGCCAGAGCAGGCAGGGAGAGG + Intronic
944609720 2:201390252-201390274 CATGTATAGCTGGCCGGGTGCGG + Intronic
944809346 2:203312486-203312508 AATTTAAAGCCGGCCGGGTGTGG + Intergenic
945086351 2:206136340-206136362 AAGCTGATGCAGGCTGGGTGCGG - Intronic
945199227 2:207264704-207264726 AAGCCAAAGTAGGCCGGGTGCGG + Intergenic
945243814 2:207699958-207699980 AAACTAAATGAGGCCGGGTGCGG - Intergenic
946539112 2:220664150-220664172 AAGAACAAGCAGGCCGGGTGTGG - Intergenic
946953823 2:224906767-224906789 AAGATAAACAAGGCCGGGTGCGG - Intronic
948398167 2:237662798-237662820 TAGCTAAAACAGGCCCGGTGGGG + Intronic
948431927 2:237924295-237924317 CAGGTAAAAAAGGCCGGGCGCGG + Intergenic
1169233049 20:3905635-3905657 AAGAGATAGCAGGCCGGGTGTGG - Intronic
1169261939 20:4145642-4145664 CACCCAAAACAGGCCGGGCGCGG + Intronic
1169275475 20:4230880-4230902 CAGCTGAGCCAGGCTGGGTGGGG - Intronic
1169770768 20:9197683-9197705 AAACTAAACCAGGCCGGGCGCGG + Intronic
1169899543 20:10538815-10538837 CAGCCAAAGAAGGTCTGGTGCGG - Intronic
1170604296 20:17864080-17864102 CAGCCCAGGCAGGCAGGGTGCGG + Intergenic
1170623734 20:18015028-18015050 GAGCAAAATCAGGCCGGGCGCGG + Intronic
1171059278 20:21940519-21940541 AAGCTAAAACAGGCTGGGTGTGG - Intergenic
1172103712 20:32502618-32502640 AAAATAATGCAGGCCGGGTGTGG + Intronic
1172233837 20:33356033-33356055 AAGGTAAAACAGGCCGGGTGTGG - Intergenic
1172283861 20:33727352-33727374 AAACTAAAACAGGCCGGGCGTGG + Intergenic
1172364876 20:34341470-34341492 CAGGCAAAACAGGCCAGGTGCGG - Intergenic
1172719284 20:36986975-36986997 CAGCAAAAGTGGGCCGGGTGCGG + Intergenic
1172892513 20:38277021-38277043 CTGCAAACACAGGCCGGGTGCGG + Intronic
1173218955 20:41115638-41115660 CTGCTAAAGCACTCAGGGTGGGG + Intronic
1173414429 20:42843285-42843307 CAGCATACGAAGGCCGGGTGTGG - Intronic
1174037999 20:47679875-47679897 AAGATAAAGCAGGGAGGGTGGGG - Intronic
1174538239 20:51269346-51269368 GAGATAAAGCAGGCCAGCTGTGG - Intergenic
1175730710 20:61352005-61352027 TAACTAAAGGAGGCCGGGTGCGG - Intronic
1175883844 20:62276956-62276978 AAGATAAATCAGGCCGGGCGTGG + Intronic
1176134904 20:63518245-63518267 AAGCTATAGCAGGCCGGTTCAGG - Intergenic
1176606219 21:8834411-8834433 CAATTAATCCAGGCCGGGTGCGG + Intergenic
1177211086 21:18071433-18071455 GAGCTGTAGCTGGCCGGGTGCGG - Intronic
1177219368 21:18171495-18171517 GAACTAAAGAAGGCCGGGCGCGG - Intronic
1177380961 21:20343940-20343962 TAGTTAAAGGATGCCGGGTGTGG + Intergenic
1177974274 21:27827674-27827696 AAGGTAAATGAGGCCGGGTGTGG - Intergenic
1178557070 21:33601473-33601495 CACCTGATGCAGGCTGGGTGTGG - Intronic
1179261203 21:39759574-39759596 AAGCTGAGGCAGGCTGGGTGTGG + Intronic
1179346110 21:40559166-40559188 CAGTTAAAGTAGGCCGGGCACGG + Intronic
1179377941 21:40868140-40868162 AAGCTACAGTAGGCCAGGTGTGG - Intergenic
1179883082 21:44301511-44301533 GACTTGAAGCAGGCCGGGTGCGG + Intronic
1180160146 21:45995539-45995561 CATATAAAACAGGCAGGGTGTGG - Intronic
1180350136 22:11794105-11794127 AAGAACAAGCAGGCCGGGTGCGG + Intergenic
1180356292 22:11844106-11844128 CAATTAATCCAGGCCGGGTGCGG + Intergenic
1180381966 22:12148221-12148243 CAATTAATCCAGGCCGGGTGCGG - Intergenic
1180388074 22:12198147-12198169 AAGAACAAGCAGGCCGGGTGCGG - Intergenic
1180431971 22:15261439-15261461 TAACAAATGCAGGCCGGGTGTGG - Intergenic
1180719174 22:17894119-17894141 CAGCTACACAGGGCCGGGTGCGG + Intronic
1181613684 22:24036967-24036989 CATGGAAACCAGGCCGGGTGCGG + Intronic
1181917820 22:26294535-26294557 CAGCTAAAGTTGGCCTGGTTGGG - Intronic
1181949464 22:26543595-26543617 ATGCTGAAGCTGGCCGGGTGCGG - Intronic
1182498827 22:30730882-30730904 GAGCTAATGCTGGCCGGGCGCGG + Intronic
1182561713 22:31164872-31164894 GTGCAAATGCAGGCCGGGTGTGG - Intronic
1182657919 22:31904450-31904472 GAGAGAAAGCAGGCTGGGTGTGG + Intronic
1182731202 22:32496188-32496210 ATGCTAAATCAGGCCGGGTGTGG + Intronic
1182855187 22:33510875-33510897 AAGCTAAGCCAGGCTGGGTGTGG - Intronic
1183159838 22:36105179-36105201 CAGCAAGAGCAGGCTGGGTGTGG - Intergenic
1183160027 22:36106730-36106752 AAGCAAGAGCAGGCCGGGTGCGG - Intergenic
1183173559 22:36205403-36205425 CAACAAGAGCAGGCCTGGTGCGG - Intergenic
1183179801 22:36252429-36252451 CAACAAGAGCAGGCCTGGTGCGG + Intergenic
1183782924 22:40010122-40010144 CAGGTAAAGGACGCCGGGGGTGG + Intronic
1183799634 22:40151113-40151135 AAACTAAAACAGGCTGGGTGTGG + Intronic
1183837821 22:40471089-40471111 ATGCAAAAGGAGGCCGGGTGTGG + Intronic
1183852947 22:40607212-40607234 CAGGTACACAAGGCCGGGTGCGG + Intronic
1184268673 22:43364809-43364831 CACCTAAAACAGGCCAGGGGAGG + Intergenic
1184955385 22:47882585-47882607 TAGCTTATTCAGGCCGGGTGCGG - Intergenic
1185146619 22:49140691-49140713 CAGCAAATGCAGCCCGGCTGGGG + Intergenic
1185301235 22:50082148-50082170 CAGCTGAAGCAGGAGGGGCGTGG + Intronic
1185356115 22:50371925-50371947 CAGGAAAAGGAGGCAGGGTGCGG - Intronic
949358051 3:3202553-3202575 TAGCTTGAGCAGGCTGGGTGTGG + Intergenic
949489193 3:4571622-4571644 AAGTGAAATCAGGCCGGGTGTGG - Intronic
949875095 3:8621355-8621377 GAGGTAAACCAGGCCGGGTGGGG + Intronic
950565054 3:13764389-13764411 CTGCTAAAGCAGGCAGGGCTAGG - Intergenic
950942799 3:16910768-16910790 CAGATGGAGCAGGCTGGGTGGGG - Intronic
951897864 3:27627545-27627567 AAGAAAAAGGAGGCCGGGTGCGG + Intergenic
952429117 3:33204609-33204631 AAAATAAAACAGGCCGGGTGTGG - Intronic
952457215 3:33484579-33484601 AAGGTTAAGCAGGCTGGGTGTGG - Intergenic
952742800 3:36750370-36750392 GAACTTAAGAAGGCCGGGTGTGG - Intergenic
952801302 3:37294674-37294696 CACTTAAGACAGGCCGGGTGCGG - Intronic
952838608 3:37625782-37625804 CAGATAAAACAGGCCCAGTGTGG + Intronic
953131338 3:40142341-40142363 AATCAACAGCAGGCCGGGTGCGG - Intronic
953566112 3:44033334-44033356 CAGCAAAGGCAGGCTGAGTGGGG - Intergenic
953651691 3:44811353-44811375 AAGTTAAAAGAGGCCGGGTGCGG + Intronic
953934814 3:47032219-47032241 GAAGTAAAGCAGGCCAGGTGTGG + Intronic
954821007 3:53327497-53327519 AAGAAAAAGCTGGCCGGGTGCGG + Intronic
954942119 3:54383125-54383147 TACCTAAAACAGGCTGGGTGTGG - Intronic
955279882 3:57584251-57584273 CTTTTAAAACAGGCCGGGTGTGG - Intronic
955792603 3:62604118-62604140 AACGTATAGCAGGCCGGGTGAGG - Intronic
956125125 3:66003757-66003779 CAGTTGAAGCTGGCCAGGTGCGG - Intronic
958772512 3:98442589-98442611 CAGGTATAGCCGGCCGGGCGCGG - Intergenic
959694988 3:109239736-109239758 TGCCAAAAGCAGGCCGGGTGTGG + Intergenic
960076478 3:113491328-113491350 TATCTATAGCAGGCCGGGCGTGG + Intronic
960426937 3:117520374-117520396 CAGCTAAAGCAGTCCTGGAGTGG + Intergenic
960562558 3:119101217-119101239 AAAGTAAAGCAGGCCGGGTGCGG + Intronic
961178469 3:124856174-124856196 GAGTTAGAGAAGGCCGGGTGTGG - Intronic
961581006 3:127882325-127882347 TACCTAATGCAGGCTGGGTGCGG + Intergenic
961726545 3:128934507-128934529 AAGCAAAAACAGGCCGGATGCGG - Intronic
961757174 3:129135473-129135495 AAACAAAACCAGGCCGGGTGCGG + Intronic
961783112 3:129333098-129333120 AAAAAAAAGCAGGCCGGGTGTGG + Intergenic
961818063 3:129561448-129561470 CAGCTTGAGGAGGCCTGGTGTGG + Intronic
962172520 3:133117058-133117080 CAGGTAAATCAGGCCGGGTGCGG - Intronic
962801892 3:138897671-138897693 CAGCCAGAGCTGGCTGGGTGCGG + Intergenic
963697942 3:148585800-148585822 CAGATAATACAGGCCAGGTGTGG + Intergenic
964921392 3:161900583-161900605 AAACAAAAGCAGGCTGGGTGTGG + Intergenic
965372879 3:167886438-167886460 AGTCTAAAGTAGGCCGGGTGTGG + Intergenic
965973781 3:174595718-174595740 CAACAAAAACAGGCTGGGTGCGG + Intronic
966657781 3:182378863-182378885 CAGCAAAACCGGGCCGGGCGCGG - Intergenic
966719996 3:183053178-183053200 AAGTTAAAACAGGCCGGGTGTGG + Intronic
966932594 3:184685467-184685489 CAGATAAAGCAGGCAGTGGGTGG + Intergenic
966953616 3:184848857-184848879 CAGAAAAAAAAGGCCGGGTGCGG - Intronic
967119909 3:186373674-186373696 CAGCACAAACTGGCCGGGTGTGG - Intergenic
968016206 3:195336192-195336214 AAGCTAACGAAGGCCGGGTGTGG - Intronic
968170254 3:196504034-196504056 CAGCCAAACAAGGCCGGGTGCGG + Intergenic
968329062 3:197848971-197848993 CAGGCAAATCTGGCCGGGTGTGG + Intronic
968546292 4:1200659-1200681 CAGCCACTGCAGGCCAGGTGTGG + Intronic
968593435 4:1471024-1471046 CAGCTCTAGCTGGCCAGGTGGGG + Intergenic
968643037 4:1724260-1724282 CAGCCAAGGCCGGCCGGGCGTGG - Intronic
968838855 4:2985706-2985728 CAGATACAGAAGGCCGGGTGTGG + Intronic
968918170 4:3506660-3506682 CAGCTCGAGCCGGCCGGGTGCGG - Exonic
968950232 4:3687699-3687721 CCGCGAAGCCAGGCCGGGTGCGG + Intergenic
969210303 4:5682198-5682220 TAGCAATAGCAGGCCGGGGGCGG + Intronic
969557629 4:7923753-7923775 AAGAGAAACCAGGCCGGGTGCGG - Intronic
970218600 4:13784723-13784745 TACCAAAAGCAGGCCGGGCGCGG + Intergenic
971644606 4:29182966-29182988 AAAACAAAGCAGGCCGGGTGCGG + Intergenic
971740177 4:30509352-30509374 CAGCTCAAGCAGGTAGGCTGAGG - Intergenic
972364753 4:38364012-38364034 AAAGTAATGCAGGCCGGGTGTGG + Intergenic
972504530 4:39707808-39707830 CAGCTCAAGAAGGCTGGGTGAGG - Intronic
972541183 4:40040773-40040795 TATCTCAAGCAGGCCAGGTGTGG - Intergenic
972622192 4:40758208-40758230 TAGAAAAAGCTGGCCGGGTGTGG - Intronic
973257013 4:48123857-48123879 AAGCTAAAGTAGTCAGGGTGGGG - Intronic
975582259 4:75917754-75917776 AAGTGAAAGCAGGCCAGGTGCGG - Intronic
976273659 4:83254573-83254595 TTGCCAAACCAGGCCGGGTGCGG + Intergenic
976712095 4:88083757-88083779 AACCTAAAGAAGGCCAGGTGCGG - Intergenic
976857975 4:89627453-89627475 AAAATAAATCAGGCCGGGTGCGG - Intergenic
978504903 4:109445860-109445882 AAACTAAAACAGGCTGGGTGCGG - Intronic
978561762 4:110041368-110041390 TACCTACTGCAGGCCGGGTGTGG - Intergenic
978814119 4:112883327-112883349 CTGATCAAGCAGGCCGGGTGCGG - Intronic
979023420 4:115533536-115533558 ACTCTAAAGCTGGCCGGGTGGGG - Intergenic
979283990 4:118900050-118900072 AAAGTACAGCAGGCCGGGTGCGG - Intronic
979292307 4:118991436-118991458 AAACAAAAACAGGCCGGGTGCGG - Intronic
979474961 4:121144690-121144712 AAGCAAAAACAGGCCGGGTGCGG - Intronic
979491334 4:121331472-121331494 AAGATATATCAGGCCGGGTGTGG - Intronic
980115053 4:128671474-128671496 CAGCTAAAAGAGGCTGGGGGTGG + Intergenic
981700616 4:147603332-147603354 AAATTAAAACAGGCCGGGTGCGG + Intergenic
982071467 4:151699097-151699119 GTGCTGAACCAGGCCGGGTGTGG + Intronic
982254803 4:153441463-153441485 TTACTAGAGCAGGCCGGGTGCGG + Intergenic
983069072 4:163247790-163247812 AGGCTAAAGCAGGCTGGGTGTGG - Intergenic
983113472 4:163782378-163782400 AAGGTCCAGCAGGCCGGGTGTGG + Intronic
983682691 4:170371869-170371891 AAGCTAAGGCTGGCAGGGTGGGG - Intergenic
984053131 4:174892111-174892133 GAGATAAGGGAGGCCGGGTGTGG + Intronic
984672407 4:182505744-182505766 AAAGAAAAGCAGGCCGGGTGTGG - Intronic
984682209 4:182623618-182623640 AAAATAAAACAGGCCGGGTGCGG - Intronic
985425701 4:189828393-189828415 CTGCTAAGGCATGCCTGGTGAGG + Intergenic
985504420 5:271000-271022 AAGCAAAAGCAGGCCGGGCGCGG - Intergenic
985743680 5:1634535-1634557 AAAAAAAAGCAGGCCGGGTGCGG + Intergenic
986249062 5:6039425-6039447 CAGGTAAAGAAGGCTGGGGGTGG - Intergenic
986644076 5:9899344-9899366 TAGCTAAAGGTGGCCGAGTGTGG + Intergenic
987133588 5:14881308-14881330 AAGGTAAAGCAGGCCGGGCACGG + Intergenic
987160402 5:15135502-15135524 TAGTTTGAGCAGGCCGGGTGCGG - Intergenic
987343668 5:16959941-16959963 TAGGTAAATTAGGCCGGGTGCGG + Intergenic
987946746 5:24619481-24619503 CATCTAAATCAGGCCGGGCACGG - Intronic
988960446 5:36365523-36365545 AACCTAAAGCAGGCCAGGTGTGG - Intergenic
988969452 5:36451484-36451506 AAGCTAAAAGAGGCTGGGTGCGG - Intergenic
989444364 5:41510356-41510378 CAGATAAAGCAGGGCGGGGCAGG + Intronic
990259537 5:54006798-54006820 TAGGTAAAACAGGCGGGGTGCGG + Intronic
990517633 5:56545045-56545067 CAGCTAAAACAAGCAGGGCGTGG + Intronic
992164039 5:74031090-74031112 CAACAAAAGCAGCCCCGGTGGGG - Intergenic
992669160 5:79041702-79041724 AAGCTCCAGGAGGCCGGGTGCGG + Intronic
992940106 5:81752051-81752073 CTGTTAAACCAGGCCGGGTGGGG - Intergenic
993269448 5:85775333-85775355 GAGCAATAACAGGCCGGGTGTGG + Intergenic
993902814 5:93595988-93596010 CACCTAAAGCAGGAGGGGTTGGG + Intergenic
995339535 5:111042272-111042294 CAGCAAATACAGGCTGGGTGCGG - Intergenic
995833546 5:116378598-116378620 CAGCTAATGGAGGCAGGTTGGGG - Intronic
996113340 5:119591395-119591417 AAGCCAAATGAGGCCGGGTGTGG + Intronic
996271697 5:121612659-121612681 GAGATGAAACAGGCCGGGTGCGG - Intergenic
996555737 5:124777339-124777361 TATCTAGAGAAGGCCGGGTGTGG + Intergenic
997287722 5:132694098-132694120 CTGCTATAGTAGGCGGGGTGTGG + Exonic
997365685 5:133323741-133323763 CTGCCAAAGCAGGCCTGGTCTGG - Intronic
997455733 5:134016114-134016136 CTTTTAAAGGAGGCCGGGTGTGG + Intergenic
998018242 5:138750089-138750111 AAGAAAAAACAGGCCGGGTGCGG + Intronic
998075280 5:139231471-139231493 AAGCAAAAGAAGGCCGGGCGCGG + Intronic
998101895 5:139441344-139441366 CCGCTAATTGAGGCCGGGTGCGG - Intronic
999094468 5:148965656-148965678 GAAGTAAAGCAGGCTGGGTGGGG + Intronic
1000020013 5:157310662-157310684 CAGCTGAAGCTGGCTGGGAGCGG + Intronic
1000665731 5:163993840-163993862 AGGTTAAAGCAGGCCAGGTGGGG + Intergenic
1000770875 5:165352071-165352093 CAGCTAAAACTGGCCTGCTGGGG - Intergenic
1000897348 5:166871883-166871905 GAGGTAAAGCTGGCCAGGTGCGG + Intergenic
1001779231 5:174353579-174353601 AAACTAGAGCAGGCCGGGCGCGG - Intergenic
1002129890 5:177074281-177074303 CAGCTTATGTAGTCCGGGTGGGG + Intronic
1002270163 5:178066517-178066539 AAGGTGAAACAGGCCGGGTGCGG + Intergenic
1002273374 5:178087431-178087453 CAAATGAATCAGGCCGGGTGCGG + Intergenic
1002386426 5:178870568-178870590 AAAACAAAGCAGGCCGGGTGTGG - Intronic
1002551770 5:179999309-179999331 CAGATAAAACAGGCCAGGCGTGG - Intronic
1003517286 6:6827599-6827621 AAGAAAAAGGAGGCCGGGTGTGG + Intergenic
1003550453 6:7098325-7098347 CAGGGAAAGCAGGAGGGGTGAGG - Intergenic
1004190138 6:13456463-13456485 AAGCTAAAGGAGGCCAAGTGTGG - Intronic
1004997415 6:21207201-21207223 AATTTAAAGTAGGCCGGGTGTGG - Intronic
1005047679 6:21657861-21657883 AAGCTGAAGTAGGCCAGGTGAGG + Intergenic
1005229397 6:23683218-23683240 CACCTGAACCAGGCTGGGTGCGG + Intergenic
1005698669 6:28377419-28377441 TTGCAAAAGCAGGCCGGGTGTGG + Intergenic
1005749232 6:28867831-28867853 AGGGAAAAGCAGGCCGGGTGGGG - Intergenic
1006066874 6:31468386-31468408 CAGCCAAGGCAGGCCTGTTGTGG - Intergenic
1006195158 6:32235799-32235821 AAATGAAAGCAGGCCGGGTGTGG + Intergenic
1006745822 6:36341299-36341321 AAGATAAAATAGGCCGGGTGCGG + Intergenic
1007000147 6:38304255-38304277 CATCAAAAGAAGGCTGGGTGTGG + Intronic
1007450478 6:41938024-41938046 CAGCTAAAGGGGGTGGGGTGGGG - Intronic
1007511390 6:42376829-42376851 TAGCTAGAGGAGGCCAGGTGCGG - Intronic
1007613557 6:43166520-43166542 AAGCAAAAATAGGCCGGGTGCGG - Intergenic
1009958411 6:70486636-70486658 AAACTAAACCAGGCCGGGTGCGG + Intronic
1010467732 6:76188869-76188891 AAGGTAAAGTAGGCCAGGTGTGG + Intergenic
1010591045 6:77712679-77712701 CAACAAAAGGAGGCCGGGTGCGG + Intronic
1011084272 6:83521790-83521812 AATATTAAGCAGGCCGGGTGTGG - Intronic
1011145443 6:84209663-84209685 TAGCTATAATAGGCCGGGTGTGG - Intronic
1011448726 6:87471110-87471132 AAGCTAGTGCAGGCCAGGTGTGG + Intronic
1011893948 6:92200938-92200960 AAGTTAGAGCAGGCCGGGCGCGG + Intergenic
1012362502 6:98400607-98400629 AAGTTAAACCAGGCCAGGTGCGG + Intergenic
1013128331 6:107207280-107207302 TAGCAAACTCAGGCCGGGTGTGG - Intronic
1013138781 6:107309993-107310015 CAGCAAATTCAGGCTGGGTGTGG + Intronic
1013594899 6:111651638-111651660 CAGCTAGCGCAGCTCGGGTGTGG - Intergenic
1014820089 6:125979461-125979483 TAGGTAAAGTAGGCCGGGTGTGG + Exonic
1015091666 6:129365651-129365673 AGTCTAAAGAAGGCCGGGTGTGG - Intronic
1015528570 6:134197533-134197555 AAGCAAAAGTAGGCCGGGCGTGG + Intronic
1015754659 6:136595394-136595416 AAAATCAAGCAGGCCGGGTGCGG - Intronic
1016924212 6:149326030-149326052 CTGTTAAAACAGGCTGGGTGTGG - Intronic
1017166185 6:151410343-151410365 CAGATGGAACAGGCCGGGTGCGG - Intronic
1017814259 6:158005503-158005525 CAGCAAGAGAAGGGCGGGTGGGG - Intronic
1018195004 6:161347904-161347926 AAGTTAGAGCAGGCCGGGCGCGG - Exonic
1018619024 6:165712928-165712950 AAGTTAAAACGGGCCGGGTGCGG - Intronic
1019709960 7:2513665-2513687 CAGCCACAGCAGGCAGGGGGTGG - Intronic
1020669105 7:11083748-11083770 TAGGGAAAGCAGGCCAGGTGTGG - Intronic
1021073712 7:16274335-16274357 CAGCCACAACAGGCCGGGTGTGG - Intronic
1021854133 7:24837123-24837145 CAACTAAAACAGGCTGGGCGTGG - Intronic
1022699991 7:32750782-32750804 AAACTAAACCAGGCCGGGCGCGG + Intergenic
1023404642 7:39820007-39820029 AAGATAAAGCAGGCCGGGTGTGG + Intergenic
1024076937 7:45825943-45825965 CACCAAATTCAGGCCGGGTGTGG - Intergenic
1024240308 7:47429663-47429685 CAGCCAGATTAGGCCGGGTGCGG - Intronic
1025016457 7:55442824-55442846 AATAAAAAGCAGGCCGGGTGCGG + Intronic
1025127484 7:56355474-56355496 CACCAAATTCAGGCCGGGTGTGG + Intergenic
1025814449 7:64898015-64898037 CAGCAAAATGAGGCCGGGTGCGG - Intronic
1026054920 7:66975611-66975633 AAGTTGAAGCAGGCCGGGCGCGG + Intergenic
1026664718 7:72332452-72332474 CAGCTAAAACAGGGCTGGGGTGG - Intronic
1026745682 7:73009969-73009991 AAAATAAAGCAGGCCGGGTGTGG + Intergenic
1026749336 7:73037911-73037933 AAAATAAAGCAGGCCGGGTGTGG + Intergenic
1026752984 7:73066056-73066078 AAAATAAAGCAGGCCGGGTGTGG + Intergenic
1026756634 7:73094182-73094204 AAAATAAAGCAGGCCGGGTGTGG + Intergenic
1026812919 7:73483975-73483997 AAGAAAAATCAGGCCGGGTGTGG + Intronic
1026994994 7:74609890-74609912 GAGTTAAGGCAGGCCGGGCGTGG - Intergenic
1027031788 7:74894643-74894665 AAAATAAAGCAGGCCGGGTGTGG + Intergenic
1027090771 7:75299246-75299268 AAAATAAAGCAGGCCGGGTGTGG - Intergenic
1027094416 7:75327216-75327238 AAAATAAAGCAGGCCGGGTGTGG - Intergenic
1027098059 7:75355141-75355163 AAAATAAAGCAGGCCGGGTGTGG - Intergenic
1027120374 7:75514237-75514259 AAAATAAAGCAGGCCGGGTGTGG - Intergenic
1027142528 7:75669073-75669095 CAAAAAAAACAGGCCGGGTGTGG + Intronic
1027271523 7:76522463-76522485 AAAATAAAGCAGGCCGGGTGTGG + Intergenic
1027321289 7:77012405-77012427 AAAATAAAGCAGGCCGGGTGTGG + Intergenic
1027324922 7:77040470-77040492 AAAATAAAGCAGGCCGGGTGTGG + Intergenic
1027499582 7:78932058-78932080 CAGCCAAAGGAGGCCAGGAGGGG - Intronic
1027877042 7:83784186-83784208 TATCTAATACAGGCCGGGTGCGG + Intergenic
1027924518 7:84444174-84444196 AAGCACAATCAGGCCGGGTGTGG - Intronic
1028133931 7:87207303-87207325 AAGCAAAAGCCGGCCGGGCGCGG + Intronic
1028959333 7:96731712-96731734 CATGAAAAGCAGGCCGGGCGCGG + Intergenic
1029112895 7:98222653-98222675 CACCGAGATCAGGCCGGGTGGGG - Intronic
1029399167 7:100332034-100332056 AAAATAAAGTAGGCCGGGTGTGG - Intergenic
1029534615 7:101149365-101149387 TAAATAAAGCAGGCTGGGTGTGG - Intergenic
1029734854 7:102459861-102459883 AAGTTAAAACAGGCCAGGTGCGG + Intronic
1029804309 7:102980485-102980507 GAGCTAAAACCAGCCGGGTGCGG + Intronic
1030019700 7:105261229-105261251 CAGAAAAATCTGGCCGGGTGTGG + Intronic
1030760054 7:113339080-113339102 AAGTTAATGCAGGCCGGGAGCGG - Intergenic
1031358779 7:120821963-120821985 AAACTAAAGCAGGATGGGTGTGG + Intronic
1032019484 7:128399077-128399099 AAGCGAAAGTTGGCCGGGTGTGG + Intronic
1032300271 7:130680214-130680236 AAGGAAAAGCAGGCCAGGTGCGG + Intronic
1033113368 7:138603391-138603413 CAGCTAAAGCAGGCCGGGTGCGG + Intronic
1033316188 7:140299661-140299683 CAGTAAAAGCAAGCTGGGTGTGG - Intronic
1033354683 7:140590097-140590119 CATGTAATGCAGGCCGGGCGCGG + Intronic
1033987419 7:147243284-147243306 AAAGCAAAGCAGGCCGGGTGCGG - Intronic
1034438992 7:151077081-151077103 GAGGTAAAGGAGGCAGGGTGGGG - Exonic
1035842104 8:2824413-2824435 GAGCTAATGTGGGCCGGGTGTGG - Intergenic
1036452736 8:8882860-8882882 AAGCTGAACCAGGCTGGGTGCGG + Intronic
1036668054 8:10760807-10760829 CAGGTAAAGAAGGGTGGGTGGGG - Intronic
1037893937 8:22639520-22639542 CACCTAAAGTTGGCTGGGTGAGG - Intronic
1038600836 8:28940296-28940318 AATCTAAAACAGGCCAGGTGCGG - Intronic
1038637090 8:29296209-29296231 CTGCTAAATGAGGCCAGGTGTGG - Intergenic
1039238092 8:35525095-35525117 CAGCGGAGGCAGGCCGGGGGAGG - Intronic
1039825883 8:41173804-41173826 AAGCAGAAGCAGGCTGGGTGCGG + Intergenic
1041059849 8:54024729-54024751 TAGCTAAAACAGGCCAGGTGAGG - Intergenic
1041279802 8:56198338-56198360 CAGCTGAGGCAGGCAGGCTGTGG + Intronic
1043332432 8:79133940-79133962 TAGAGAAAGCAGGCCAGGTGTGG + Intergenic
1044706976 8:95018325-95018347 ATTCTAAAGCAGGCCAGGTGTGG - Intronic
1045001754 8:97884492-97884514 CAGCAACAACAGGCCGAGTGTGG + Intronic
1045044250 8:98259363-98259385 TATTTAAAGGAGGCCGGGTGCGG - Intronic
1045324863 8:101110387-101110409 GAGCTAAATGAGGCCAGGTGCGG + Intergenic
1045504616 8:102769640-102769662 GAGGTCAAGTAGGCCGGGTGCGG + Intergenic
1045996102 8:108363988-108364010 CAACTATATCAGGCTGGGTGTGG - Intronic
1046267534 8:111849462-111849484 AAGTTAAAGAAGGCCGGGCGCGG - Intergenic
1046986908 8:120398078-120398100 CAGTTGAAGCAGTCCGGATGGGG + Intronic
1047737768 8:127781443-127781465 AAGCTAAATCAGGCTGGGTGCGG - Intergenic
1047749855 8:127872122-127872144 AAACTAAAAGAGGCCGGGTGTGG + Intergenic
1047964279 8:130034177-130034199 AAGGAAAAACAGGCCGGGTGTGG + Intergenic
1048001814 8:130385173-130385195 GAGCCAAGGCAGGCCGGGTGTGG + Intronic
1050415358 9:5410591-5410613 CAGTTTAAGCAGGCAGGGTTGGG + Intronic
1051465994 9:17378467-17378489 GAACAAAAGAAGGCCGGGTGCGG - Intronic
1053018971 9:34681518-34681540 AAGTTAAATGAGGCCGGGTGTGG + Intergenic
1053720614 9:40943278-40943300 GAGCAAAAGCAGGCCGGGTGTGG + Intergenic
1054345373 9:63908878-63908900 GAGCAAAAGCAGGCCGTGTGTGG - Intergenic
1054678525 9:67884598-67884620 CATCTGATGGAGGCCGGGTGCGG + Intronic
1055295859 9:74832758-74832780 AAGTTAAAACAGGCTGGGTGTGG + Intronic
1056137025 9:83640549-83640571 TAGCTGAAGCCAGCCGGGTGCGG + Intronic
1056462066 9:86818106-86818128 CAGCTACAGCAGCCCAGCTGTGG + Intergenic
1056954382 9:91070828-91070850 AAGAGAATGCAGGCCGGGTGCGG - Intergenic
1057103742 9:92390972-92390994 CAGCAAAATCAGGCCAGGTGTGG + Intronic
1057150784 9:92794191-92794213 AAGCAAATTCAGGCCGGGTGCGG - Intergenic
1061070594 9:128307904-128307926 AAACAAAAACAGGCCGGGTGTGG + Intergenic
1061070648 9:128308241-128308263 AAACCAAAACAGGCCGGGTGTGG + Intergenic
1061184649 9:129045466-129045488 AAGCAAAAGTAGACCGGGTGTGG + Intronic
1061224514 9:129272950-129272972 TAGCTAAAGCAAGCCTGGGGTGG + Intergenic
1061405864 9:130392705-130392727 GAGTTTAAGCAGGCCGGGTGCGG + Intronic
1061470849 9:130824311-130824333 CAGCTCAAGCAGGCAGAGGGAGG + Intronic
1062095412 9:134700697-134700719 CAGCCAGAGAAGACCGGGTGTGG - Intronic
1062372665 9:136248025-136248047 CATCTAAGGCAGGGCGGGGGAGG + Intergenic
1062557108 9:137118276-137118298 TGGCTAAAACAGGCCGGGTGTGG - Intergenic
1062575235 9:137203642-137203664 AAGCAAAAGCAGGCCAGGCGTGG - Intronic
1062588264 9:137260768-137260790 AAGCTAAATTAGGCCGGGTGCGG + Intronic
1185585325 X:1238601-1238623 AAAATAAAACAGGCCGGGTGCGG + Intergenic
1185710783 X:2301924-2301946 GAGCTAGATGAGGCCGGGTGAGG - Intronic
1186179729 X:6961107-6961129 CACCAAAAGTAGGCCAGGTGTGG + Intergenic
1186283503 X:8019406-8019428 CAACTAAAGCAGCCTGGGCGAGG + Intergenic
1188875156 X:35420305-35420327 AAAGTAAAGCAGGCCGGGTGTGG - Intergenic
1189282452 X:39828349-39828371 CAGGCACGGCAGGCCGGGTGCGG + Intergenic
1189347470 X:40252893-40252915 CAGTGAAAGGAGGCCGGGTGCGG + Intergenic
1190229089 X:48567893-48567915 TAGTGAATGCAGGCCGGGTGTGG + Intergenic
1190738870 X:53274749-53274771 CAGCTAAAGCAGGCCGGGTGCGG - Intronic
1190866401 X:54388480-54388502 TACCTAAAGCAGGCCAGGAGTGG + Intergenic
1191160258 X:57322278-57322300 CAAAAAATGCAGGCCGGGTGCGG - Intronic
1192177746 X:68896338-68896360 GTGCTAAACAAGGCCGGGTGCGG + Intergenic
1192425304 X:71069648-71069670 CAGCATATGCAGGCCGGGCGCGG + Intronic
1193106198 X:77676829-77676851 AATCTAAAGAGGGCCGGGTGAGG + Intronic
1194604212 X:95960646-95960668 CAGCTAAAGCAGTGCGGCGGTGG - Intergenic
1194918077 X:99729287-99729309 AAGTTTATGCAGGCCGGGTGAGG + Intergenic
1195457332 X:105083778-105083800 CTTCTAAGGCAGGCCTGGTGGGG - Intronic
1195495019 X:105521232-105521254 TAGCTATAGCAGGCCGGGCGCGG - Intronic
1195640614 X:107170700-107170722 AAGTTAAAATAGGCCGGGTGTGG - Intronic
1195925089 X:110016945-110016967 TAGATAAAACAGGCCAGGTGTGG - Intronic
1197025238 X:121740042-121740064 AAGATAAAACAGGCCAGGTGCGG - Intergenic
1197606329 X:128589911-128589933 CAGACAAGGCAGGCCGGGTGCGG + Intergenic
1197806909 X:130406143-130406165 AAGGCAAAGCAGGCCGGGCGCGG - Intronic
1198171901 X:134115133-134115155 AAGCCAGAGAAGGCCGGGTGTGG - Intergenic
1198259212 X:134951159-134951181 GAGCTCCTGCAGGCCGGGTGCGG - Intergenic
1198458048 X:136836753-136836775 GAGCTAAAGAGGGCCGGGTGTGG - Intergenic
1200389341 X:155928211-155928233 CAGCCAAAGGGGGCCAGGTGTGG - Intronic
1200406865 Y:2820871-2820893 CAGACAAAACAGGCTGGGTGTGG - Intergenic
1200756027 Y:6990845-6990867 AAAATAAAGCAGGCCGGGCGCGG - Intronic
1201154884 Y:11122075-11122097 CAATTAATCCAGGCCGGGTGCGG + Intergenic