ID: 1190743595

View in Genome Browser
Species Human (GRCh38)
Location X:53306840-53306862
Sequence TTAGGGGCTTGCAGCTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190743592_1190743595 -10 Left 1190743592 X:53306827-53306849 CCAGGAACACCACTTAGGGGCTT 0: 1
1: 0
2: 0
3: 2
4: 116
Right 1190743595 X:53306840-53306862 TTAGGGGCTTGCAGCTGAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190743595 Original CRISPR TTAGGGGCTTGCAGCTGAGG AGG Intronic
901870441 1:12135635-12135657 TTAGGGGCACGAAGCTGAGGTGG - Intronic
902414885 1:16232679-16232701 TGAGGGCCCTGCAGCTGATGGGG - Intronic
906125976 1:43427206-43427228 TCAGGGGTTTGTATCTGAGGGGG - Intronic
907047055 1:51305803-51305825 TCAGGGGCTCACAGCTGGGGTGG - Intronic
912451224 1:109768901-109768923 TGAAGGGCTTGCAGCTGAGAAGG + Intronic
913572224 1:120131991-120132013 TCAGGGCCTTGCAACTGATGGGG + Intergenic
913606837 1:120475049-120475071 TCAGGGGCAGGGAGCTGAGGAGG + Intergenic
914268515 1:146057461-146057483 TCAGGGGCAGGGAGCTGAGGAGG - Intergenic
914293144 1:146293635-146293657 TCAGGGCCTTGCAACTGATGGGG + Intergenic
914368577 1:147003402-147003424 TCAGGGGCAGGGAGCTGAGGAGG + Intergenic
914554188 1:148744418-148744440 TCAGGGCCTTGCAACTGATGGGG + Intergenic
915287026 1:154859582-154859604 TCAGTGGCTTTGAGCTGAGGGGG - Intronic
915313290 1:155015254-155015276 TCCGGGGCTTGCGGCTGCGGCGG - Exonic
918841933 1:189552307-189552329 TTAGGGGTTTGCTGCCAAGGGGG - Intergenic
923002197 1:230016387-230016409 TGAGAAGCTTCCAGCTGAGGTGG - Intergenic
924062604 1:240191123-240191145 TCAGAGGCTTGCAGCCGAGTTGG + Intronic
1062803328 10:396023-396045 CAAGGGGCTCTCAGCTGAGGGGG + Intronic
1063735142 10:8744899-8744921 TTAGAGGTTTGCAGCAGTGGTGG - Intergenic
1067105272 10:43362289-43362311 GCAGGGGCTTGCAGGTGAGTGGG + Intergenic
1067683058 10:48452160-48452182 GTGGGGGCCTGCAGCGGAGGTGG + Intronic
1070301164 10:75204630-75204652 TTAGGGGCAAGCAGCAGAGAAGG - Intergenic
1071834026 10:89401484-89401506 TTAGGGGAGTACAGGTGAGGAGG + Intronic
1072430303 10:95365350-95365372 TTAGGGGGATGGAGGTGAGGAGG + Intronic
1074449583 10:113548351-113548373 TTGGGGCCTTGCAGCAGAGCTGG + Intergenic
1075524555 10:123172426-123172448 TTAGGTCTTAGCAGCTGAGGAGG - Intergenic
1075827502 10:125371632-125371654 TCTGGAGCTGGCAGCTGAGGGGG - Intergenic
1076727767 10:132421423-132421445 GTAGGGGGCTGCAGCTGGGGGGG + Intergenic
1077501333 11:2910985-2911007 TTCGGGGCTGGGAGGTGAGGAGG + Intronic
1079093364 11:17495641-17495663 TTGGGGGCTTTCAGCTACGGAGG + Exonic
1080639215 11:34148990-34149012 TCAGGGGATTGCCCCTGAGGGGG + Intergenic
1081795437 11:45816043-45816065 TTTGGGGCTTGGAGCTGGAGAGG + Intergenic
1084906011 11:72348170-72348192 TTAGGTGGTTGCCTCTGAGGAGG + Intronic
1090296539 11:125593033-125593055 TTAGGGCCTTGCAGAGGAGGGGG + Intronic
1092054220 12:5495788-5495810 GAAGGGGCTGGCAGATGAGGAGG - Intronic
1092942073 12:13419370-13419392 TTAGGGGCCTGCAGGGAAGGGGG - Intergenic
1093204504 12:16231242-16231264 TTAGGGACTTCCAGTTAAGGTGG + Intronic
1094086934 12:26603990-26604012 TTAGGCGCTTGCAGTTAAAGGGG + Intronic
1095974652 12:47930984-47931006 TTAGGAGCTTGAAACTGTGGAGG - Intronic
1099873567 12:88377234-88377256 TTAGGGGCTGGCAGCTGGTGAGG + Intergenic
1100367307 12:93933598-93933620 TGAGTTTCTTGCAGCTGAGGAGG - Intergenic
1101840802 12:108326226-108326248 TCAGGTCCTTGCAGCAGAGGAGG + Intronic
1110393817 13:75007022-75007044 TTATGGGATTGCTGCTGAGCGGG - Intergenic
1110711076 13:78651658-78651680 TGAAGGGCTTGCAGAGGAGGTGG - Intronic
1116454947 14:45109066-45109088 GTAGAGGGTCGCAGCTGAGGAGG - Intronic
1118897149 14:69954552-69954574 GCAGGGGCTTGTGGCTGAGGTGG + Intronic
1119114454 14:72006346-72006368 TCAGGGGCTTGAATATGAGGAGG - Intronic
1120516983 14:85482323-85482345 TTAGAGACTTCCACCTGAGGAGG - Intergenic
1120976734 14:90255352-90255374 TTAGGAGCATGCAGCAGTGGTGG - Intergenic
1123167253 14:106337700-106337722 TTAACTGCTTCCAGCTGAGGAGG - Intergenic
1123169871 14:106362411-106362433 TTAACTGCTTCCAGCTGAGGAGG - Intergenic
1124028624 15:25989548-25989570 TTAGGGGCTGCAGGCTGAGGGGG + Intergenic
1124790169 15:32719053-32719075 CTAGGGACTGGCGGCTGAGGCGG + Intronic
1126814514 15:52441617-52441639 ATAGGAGCTTGCTGCTGAAGAGG - Intronic
1129430654 15:75499234-75499256 TCAGAGGCTTGGAGCTGATGAGG + Intronic
1131178393 15:90224270-90224292 TAAGGAGCTTGCAGCTGAGTAGG - Intronic
1135030421 16:19033725-19033747 TCAGAGGCTTGCAACTGAGATGG + Intronic
1136396478 16:29995284-29995306 GGCGGGGCTTGCTGCTGAGGAGG - Exonic
1139493050 16:67297313-67297335 TTGTGGGCTTGGAGGTGAGGAGG + Intronic
1139916050 16:70429093-70429115 TCAGGCTCCTGCAGCTGAGGGGG - Intronic
1140279190 16:73539331-73539353 TTGGGGGCTTGCAGGAGAGGCGG - Intergenic
1141128726 16:81419885-81419907 TAAGGAGCTTGCAGTTGACGTGG + Intergenic
1143783791 17:9242506-9242528 TGAGGGGCTTGCATTTGTGGTGG + Exonic
1148683400 17:49487265-49487287 TTAAGAGTTTCCAGCTGAGGTGG + Intergenic
1149207943 17:54270157-54270179 TTAGAGGATTCCAGCTGGGGAGG - Intergenic
1149571714 17:57676809-57676831 CTAGGGATTTGGAGCTGAGGAGG + Intronic
1150227539 17:63532032-63532054 TGAGGGCCTTGCAGCTCTGGGGG + Intronic
1150473844 17:65459633-65459655 TGATGGGCTTCCAGCAGAGGTGG + Intergenic
1151349555 17:73523760-73523782 TTTGGGGGGTGCAGGTGAGGGGG - Intronic
1151985726 17:77542189-77542211 TAAGGAGCTTACAGCTGAGCAGG + Intergenic
1153952823 18:10071371-10071393 TTAGGGGCTTGCAGAGGGTGGGG + Intergenic
1156900796 18:42298377-42298399 TTAGCTGCTTGATGCTGAGGTGG + Intergenic
1157328426 18:46685887-46685909 TTAGGAGCTTGCAGCTGTGTCGG - Intronic
1161436645 19:4267609-4267631 TTTGGGGCCTGCAGGTGATGGGG - Exonic
1161882220 19:6963864-6963886 TTAGGGGTGTGCAGCAGATGTGG + Intergenic
1162567774 19:11453745-11453767 TTAGGGGCTAGCAGCCCACGGGG - Exonic
1164243394 19:23409725-23409747 TTAGAGGCTGGCTGCGGAGGTGG - Intergenic
1166956796 19:46470417-46470439 ACCGGGGCTTGCAGCAGAGGTGG - Exonic
1168348192 19:55660935-55660957 GTAGGAGCTTTCTGCTGAGGAGG + Intronic
1202708725 1_KI270714v1_random:4797-4819 TCAGGGGCAGGGAGCTGAGGAGG + Intergenic
926253925 2:11173600-11173622 TCAGGGGCTTGCAGTTTAGTTGG + Intronic
926706372 2:15840599-15840621 CTAGGAGCTTGCAGCAGGGGTGG - Intergenic
928651056 2:33404284-33404306 TTATGGTCTTGTAGATGAGGGGG - Intergenic
929810387 2:45184701-45184723 TTAGTGACTTTCAGCTGAGAAGG - Intergenic
930202810 2:48560883-48560905 TTTGGGGCTTGCTGATTAGGTGG - Intronic
935547967 2:104420523-104420545 ATAAGAGCTTCCAGCTGAGGGGG - Intergenic
937096913 2:119241578-119241600 AAAGGGGCTTGGAGCTGAGCTGG + Intronic
937727650 2:125186451-125186473 TTTGGAGGATGCAGCTGAGGGGG + Intergenic
939194165 2:138951835-138951857 TTAGGGACTTACAGATGAGGAGG - Intergenic
946691401 2:222311462-222311484 TGCGGGGCTTGCAGCGGAGTAGG - Intergenic
947093146 2:226536273-226536295 TTTGGGTCTTGCAGCATAGGAGG - Intergenic
1170524814 20:17226975-17226997 CTAGGGAATTGGAGCTGAGGAGG + Exonic
1170738112 20:19028059-19028081 TCAGGGTCTTGCAGGTGAGTGGG - Intergenic
1172010248 20:31842284-31842306 TTGGGGGGTTGGGGCTGAGGGGG + Intergenic
1172444794 20:34987399-34987421 GTAAGGGTTTGGAGCTGAGGAGG - Intronic
1172792997 20:37519123-37519145 TGAGGGGCTTGGGGATGAGGAGG + Exonic
1173777929 20:45726825-45726847 TTAGGGTCTTGCAGCTGGCTGGG - Intergenic
1173787428 20:45804623-45804645 TTAGGGAGTGGCAGCTGATGGGG - Intronic
1174553295 20:51376554-51376576 TGAGCGGCTTGCAGCAGATGAGG + Intergenic
1176064928 20:63189330-63189352 TGAGGGGCTTGCACCTGCGGAGG + Intergenic
1181610231 22:24007044-24007066 GTGCGGGCTTGCAGCTCAGGTGG + Intergenic
1182800482 22:33028324-33028346 TTCGGGGCTAGGCGCTGAGGAGG - Intronic
1183685121 22:39357308-39357330 GTAGGAGCCTGCAGCAGAGGGGG + Intronic
1184033217 22:41906766-41906788 AGAGGGGCTTGCCGCTGGGGAGG - Exonic
949739475 3:7213849-7213871 TTAGGGCCTTGGTGCTGAAGGGG + Intronic
950007182 3:9698813-9698835 CTAGGGGCTGGCTGCAGAGGAGG - Intronic
950334607 3:12183348-12183370 TGAGGGGGTGGCCGCTGAGGTGG - Exonic
952585708 3:34889674-34889696 ATAGGTGCTTTCAGCTGTGGGGG + Intergenic
955050336 3:55404352-55404374 AAAGGGGCTTGCAGCTCAGTGGG - Intergenic
955611684 3:60764175-60764197 TGAGGGGCTTGGAGTTGATGGGG + Intronic
956084909 3:65598206-65598228 TTAGGGGGCTGCACCTGCGGAGG + Intronic
956814682 3:72897391-72897413 TTAGGGGCTACCAGAAGAGGAGG - Intronic
957627111 3:82667508-82667530 TTAGGCCCTTTCAGCTGAGACGG + Intergenic
957650652 3:82998155-82998177 TTTGGGGGTTGGAGCTGAGATGG + Intergenic
958523734 3:95225520-95225542 ATAGGGGCTTTCTGCTGAGAGGG + Intergenic
958862288 3:99458444-99458466 TTAGGGGCTGGCATCTGTGGAGG - Intergenic
959197977 3:103210265-103210287 TTAGGGGTTGGCAGCTGGGCTGG + Intergenic
965776673 3:172239143-172239165 TGAGGGACTTGCAGCTGGGTGGG + Intronic
966681506 3:182646151-182646173 TTAGGAGATTGCTGCTGTGGAGG + Intergenic
967894809 3:194387315-194387337 CTAGGGGCTTAGAGCTGAGGAGG + Intergenic
967917237 3:194587862-194587884 GGCGGGGCTTGCAGGTGAGGGGG - Exonic
968007905 3:195255443-195255465 CTCTGGGCCTGCAGCTGAGGAGG + Intronic
973191563 4:47391467-47391489 TTTGCCGCTTGCAGTTGAGGTGG - Intronic
978168555 4:105639954-105639976 TTAGGGGCTGGCAGGAGAAGAGG - Intronic
986407590 5:7441814-7441836 TTAAGGCCTTCCAGCTGATGGGG - Intronic
987123816 5:14792585-14792607 TTGGGGGTTTCTAGCTGAGGAGG + Intronic
988066212 5:26230595-26230617 ATGGGGGCATGCAGGTGAGGAGG - Intergenic
989329016 5:40233851-40233873 CAAGGGGCTTGCAGCTGGTGAGG + Intergenic
990518268 5:56551429-56551451 TCAGGGGCTTACAGTTGAGTTGG - Intronic
995500046 5:112794715-112794737 TTTGTGGCTGGCATCTGAGGTGG - Intronic
997633247 5:135385756-135385778 TTGGGGGCTTGGAGATGAGCTGG - Intronic
998267532 5:140677360-140677382 GAAGGGCCTTGCACCTGAGGTGG - Exonic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
1001710120 5:173771729-173771751 TGAGGGGCTTACAGCCTAGGGGG + Intergenic
1002885173 6:1286981-1287003 TGAGGGGCTGGCATCTGACGAGG - Intergenic
1003435747 6:6086472-6086494 CTGGGGGATTGCAGCTGAGGAGG - Intergenic
1010099641 6:72089076-72089098 TTAGAGGATTGTAGCTGAAGTGG + Intronic
1010175599 6:73024443-73024465 TTTGGGGTTTGCAGCAGATGAGG + Intronic
1011462575 6:87620172-87620194 TAAGGGGCTTGCTGCGGAAGAGG - Intronic
1015926402 6:138314130-138314152 TGAGGGGCTTGCCTCTGATGAGG + Intronic
1015986678 6:138891592-138891614 TTAGGGGCTTCCAGGTCATGGGG - Intronic
1018453208 6:163928220-163928242 TTAGGGCCTTTCAGTGGAGGTGG - Intergenic
1018933338 6:168256773-168256795 TTATGGGCTCACAGCTGAGCAGG + Intergenic
1019323055 7:424364-424386 TCAGGGTCTTGCAGCTGTGCTGG - Intergenic
1019926488 7:4196505-4196527 GGAGGGGCCAGCAGCTGAGGTGG - Intronic
1020677240 7:11197041-11197063 TTTGGAGGATGCAGCTGAGGGGG - Intergenic
1024001055 7:45189628-45189650 GTAGGGGCTTGCAGGGAAGGGGG - Intergenic
1024338447 7:48233241-48233263 TTAGTGGCTGGCAGGTGAAGGGG + Intronic
1030596105 7:111540655-111540677 TTAGGGGCTTACAACTTAGTTGG - Intronic
1032527379 7:132589168-132589190 TTAGGGGGTTTCAGGTGAGTAGG + Intronic
1032992166 7:137405821-137405843 TTTGGGGCTTTCAGCTGGGAGGG - Intronic
1033818921 7:145109769-145109791 TTAGGGGCTGGCATCTGGAGAGG - Intergenic
1036284947 8:7436009-7436031 CAATGGGCTGGCAGCTGAGGTGG + Intergenic
1036336528 8:7875521-7875543 CAATGGGCTGGCAGCTGAGGTGG - Intergenic
1037415462 8:18644908-18644930 TAAGGGGCCTGCATCTGATGAGG + Intronic
1039830489 8:41209823-41209845 TTGGGTGCGTGCATCTGAGGAGG - Intergenic
1042446390 8:68889970-68889992 TTGGGGGCTGGCAGCTGGGCTGG + Intergenic
1044429253 8:92089565-92089587 TGAGGGGCTAGGGGCTGAGGTGG - Intronic
1044828318 8:96220080-96220102 GCAGGGGCTTGCAGCTGCAGTGG + Intergenic
1045464345 8:102455770-102455792 TTGAGGGCTTGAAGCTGAGGCGG + Intergenic
1045493191 8:102686051-102686073 CTAGGGGCTTGCAGCCAAGGAGG + Intergenic
1047982348 8:130196406-130196428 AGAGGGGCTTGGAGCTGAGTTGG - Intronic
1049819856 8:144626955-144626977 TTCGTGGCTTGCAGCTGTCGGGG + Intergenic
1051837795 9:21360535-21360557 TTAAGGGCTAGCAGAAGAGGAGG + Intergenic
1056809985 9:89756808-89756830 TGAGGAGTTTGCAGCTGAGAGGG - Intergenic
1057193232 9:93098802-93098824 TTAGCGGCTTGCAGGGCAGGAGG + Intronic
1060107383 9:120881652-120881674 TGAGGAGATTGCAGCAGAGGAGG + Intronic
1062539275 9:137034460-137034482 TTAGGGGCTGGCACCAGAGTGGG + Intronic
1185839875 X:3379096-3379118 TTAGGAGTTTGCAGTTGAGGTGG + Intergenic
1186479182 X:9883155-9883177 CCAGGAGCTTGCAGCTGAGTGGG + Intronic
1188308094 X:28583662-28583684 TGAGTGGCTGGCAGCTGAGTAGG + Intergenic
1189290964 X:39885858-39885880 ATAATGGCGTGCAGCTGAGGTGG - Intergenic
1190743595 X:53306840-53306862 TTAGGGGCTTGCAGCTGAGGAGG + Intronic
1190918097 X:54824899-54824921 TTAGAGCCGTGCAGGTGAGGGGG + Intergenic
1195522084 X:105842777-105842799 GTAGGGGTTTGCAGGTGAGGAGG + Intronic
1195825767 X:108998894-108998916 TTGGGGGCTGGGAGGTGAGGGGG - Intergenic
1198236048 X:134736751-134736773 TTAGGAGCCTGCAGCTGTGCCGG - Intronic
1198313106 X:135438798-135438820 TTGGGGGCCTCGAGCTGAGGTGG + Intergenic