ID: 1190745293

View in Genome Browser
Species Human (GRCh38)
Location X:53318927-53318949
Sequence GGCTGCTGCGAGCTCAGTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190745293_1190745304 24 Left 1190745293 X:53318927-53318949 CCCGGACTGAGCTCGCAGCAGCC 0: 1
1: 0
2: 0
3: 21
4: 214
Right 1190745304 X:53318974-53318996 CCTTTGCCCCCAGACTCCTCAGG 0: 1
1: 0
2: 1
3: 23
4: 275
1190745293_1190745297 -10 Left 1190745293 X:53318927-53318949 CCCGGACTGAGCTCGCAGCAGCC 0: 1
1: 0
2: 0
3: 21
4: 214
Right 1190745297 X:53318940-53318962 CGCAGCAGCCCTGCCTGGGCAGG 0: 1
1: 0
2: 2
3: 64
4: 436
1190745293_1190745305 25 Left 1190745293 X:53318927-53318949 CCCGGACTGAGCTCGCAGCAGCC 0: 1
1: 0
2: 0
3: 21
4: 214
Right 1190745305 X:53318975-53318997 CTTTGCCCCCAGACTCCTCAGGG 0: 1
1: 0
2: 1
3: 26
4: 277
1190745293_1190745306 26 Left 1190745293 X:53318927-53318949 CCCGGACTGAGCTCGCAGCAGCC 0: 1
1: 0
2: 0
3: 21
4: 214
Right 1190745306 X:53318976-53318998 TTTGCCCCCAGACTCCTCAGGGG 0: 1
1: 0
2: 1
3: 29
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190745293 Original CRISPR GGCTGCTGCGAGCTCAGTCC GGG (reversed) Intronic
900284296 1:1891623-1891645 GACTGCGGCGAGCTCAGACGCGG + Intergenic
900315339 1:2053502-2053524 GGCTGCTGGGTGCTGAGTCCTGG + Intronic
900954543 1:5878376-5878398 GGCTGCAGGTAGCTCAGACCAGG - Intronic
901763068 1:11483079-11483101 GGATGCTGCGGGACCAGTCCAGG + Intronic
903041592 1:20534787-20534809 TGCTGCTGAGAGCTCAGTAGGGG + Intergenic
903576664 1:24343590-24343612 GGCTGCCAGGCGCTCAGTCCCGG - Intronic
904562098 1:31405736-31405758 GGCTGCTGCAAGGCCAGGCCTGG - Intergenic
905223938 1:36467262-36467284 GGCTGCTGTGAGCTGGGTCTGGG + Exonic
905790170 1:40785262-40785284 GGCAGCTCAGAGCTCAGTCTTGG + Intronic
905852233 1:41282893-41282915 AGCTGCTGGGAGCTCAGCCTGGG - Intergenic
907101555 1:51842108-51842130 GGCTGCAGCGAGCCCAGATCGGG + Intronic
909152001 1:72018745-72018767 GGCTGCAGTGAGCTCAGGGCAGG + Intronic
912301861 1:108526094-108526116 GGCACCTGCCAGCTCAGCCCTGG - Intergenic
912658673 1:111509394-111509416 GGCTTCTGGGTGCTCAGGCCGGG + Intronic
912953480 1:114136428-114136450 GGCAGCTGAGAGCTCAGTGGGGG - Intronic
916051549 1:161039962-161039984 TGCTGCTTCGAGCTCAGTTGCGG - Exonic
921347614 1:214203203-214203225 GGCTGCTGCTAGGTCATTCTGGG - Intergenic
1066656214 10:37701591-37701613 GGCTTCAGCGGGCTCAGGCCGGG + Intergenic
1067183866 10:44010908-44010930 TGCTGCCAAGAGCTCAGTCCTGG - Intergenic
1069947855 10:71999853-71999875 GGGGGCTGCGAGCTGAGGCCAGG - Intronic
1070794271 10:79207815-79207837 AGCTGGTGGGAGCCCAGTCCTGG + Intronic
1071490380 10:86132161-86132183 AGCTGCTGTGAGCTCTGTCCCGG - Intronic
1071495129 10:86162848-86162870 GGCTCCTGCGAACAGAGTCCTGG + Intronic
1072674922 10:97458678-97458700 GGCAGCTGAGCCCTCAGTCCTGG - Exonic
1072757546 10:98030797-98030819 GGCTGCTGCCACCGCAATCCCGG - Exonic
1073139676 10:101238889-101238911 GGCAGCGGCGCCCTCAGTCCAGG - Intergenic
1073472067 10:103728953-103728975 GGCTGCAGTGAGCTCAGATCGGG - Intronic
1074404606 10:113169984-113170006 GGCTGCTGAGAACACAGGCCTGG - Intergenic
1074962717 10:118462777-118462799 GGCTGCTGTGAGCATTGTCCAGG - Intergenic
1075455455 10:122582097-122582119 TGCTGCTGGGACCTCATTCCTGG + Intronic
1075457578 10:122594800-122594822 TGCTGCTGGGACCTCATTCCTGG + Intronic
1076717315 10:132372862-132372884 GGCTGCTGGCTGCTCAGTGCAGG - Intronic
1076753826 10:132557733-132557755 GGCTGCAGGGAGGTGAGTCCTGG + Intronic
1076767437 10:132644267-132644289 GGCGGCTGCGAACTCAGGCACGG + Intronic
1077309453 11:1881927-1881949 GGCAGCTGCGAGGCCAGGCCGGG + Intronic
1078157271 11:8809783-8809805 TGCTGCTGAGAGCTCACTCTGGG + Intronic
1078446348 11:11407868-11407890 GGCAGCTGGGAGCTCTGCCCTGG - Intronic
1079141902 11:17816648-17816670 TGCTCCTGCTAGCTCAGTCCTGG + Intronic
1079460121 11:20671041-20671063 AGCCGCTGCCTGCTCAGTCCTGG - Intronic
1083550203 11:63582648-63582670 GGCTGCTGAGAAATCAGTTCTGG + Intronic
1084946654 11:72642367-72642389 GGCGGCTGCGAGCATGGTCCTGG - Intronic
1086292064 11:85322845-85322867 TGCTGCTGCTAGCTAAATCCAGG + Intronic
1087169652 11:95037871-95037893 GGCTGCTGCGAGGCAGGTCCCGG - Intergenic
1087534512 11:99425774-99425796 GGCTCCTGCCAGCTCAGTAGGGG + Intronic
1088446011 11:109929496-109929518 GGCAGCTGGGAGCTCAGATCTGG + Intergenic
1090087813 11:123666264-123666286 GGCTGCAGCGAGCTGAGATCAGG + Intergenic
1090428831 11:126629260-126629282 GGCTGCAGGCAGCACAGTCCTGG - Intronic
1091188524 11:133669497-133669519 GACTGCTGCGGTCTGAGTCCTGG - Intergenic
1092225612 12:6746362-6746384 GGCTGCCCTGACCTCAGTCCAGG - Intergenic
1096534108 12:52259800-52259822 GGCTGCTGAGTGCACACTCCTGG - Intronic
1100870992 12:98909936-98909958 GGCTGCTGGCAGCTGATTCCCGG - Intronic
1103201974 12:119095197-119095219 GGCTCCTGGGACCTCAGTCTGGG - Intronic
1103962985 12:124621167-124621189 GCCTGCTGCGGGCTCTGTCTGGG + Intergenic
1104182085 12:126391455-126391477 AACTGCTGCAAACTCAGTCCTGG + Intergenic
1104820242 12:131672884-131672906 GGATGCTGACAGCTCAGACCGGG - Intergenic
1106411312 13:29513493-29513515 GGCTGGTGGCAGCTCAGTCTGGG - Exonic
1112250457 13:97774523-97774545 GGCTGCAGCGAGCTGAGATCAGG - Intergenic
1117903187 14:60556996-60557018 GGCTGCTGTGAGCTATGTTCAGG + Intergenic
1120252821 14:82080120-82080142 GGCTTCTAAGGGCTCAGTCCAGG + Intergenic
1122540900 14:102497178-102497200 GGCTGCTGGGCGCTCCCTCCAGG + Intronic
1123041531 14:105492206-105492228 AGCTGCTGCTGGCTCTGTCCTGG + Exonic
1123721638 15:23066209-23066231 GGCCGCTGGGAGCTGAGACCGGG - Intergenic
1124019745 15:25909530-25909552 GGCTGCGGCGAGGTGGGTCCCGG - Intergenic
1124655334 15:31502712-31502734 TGGTGCTGGGAGCTCAGTCCTGG + Intronic
1127325975 15:57895906-57895928 GCCTTCTGCCAGCTCAGGCCTGG + Intergenic
1128510782 15:68312883-68312905 GGCTGTCGTGAGCTCAGTCAGGG + Intronic
1128911953 15:71523636-71523658 GGCTGCTGTGGCCTTAGTCCAGG + Intronic
1129592791 15:76932031-76932053 GGCTGCCGCGGGCTTTGTCCCGG + Intronic
1130654878 15:85785706-85785728 GGCTGCTGCGGGCTGAGGCAGGG - Intronic
1132314818 15:100881822-100881844 TGCTGCTGCCTGCTCTGTCCTGG + Intronic
1132551449 16:555464-555486 GGCTTCTGCCACCCCAGTCCTGG + Intergenic
1132643406 16:988143-988165 GGCTGCTGTGAGTTAACTCCTGG + Intergenic
1132858035 16:2056168-2056190 GGGAGCACCGAGCTCAGTCCCGG - Intronic
1132981679 16:2741413-2741435 GGCTTCTCAGAGCTCAGGCCAGG + Intergenic
1133031422 16:3013018-3013040 GGCCTGTGCGAGCTCAGCCCAGG + Exonic
1134111262 16:11516706-11516728 GGCTGCAGTGAGCTCAGCCTGGG - Intronic
1134684735 16:16150542-16150564 GGCTGCTGTGAGGTCAGGCCGGG + Intronic
1137669524 16:50271302-50271324 GGCTGCTGTGAGCTATGACCAGG - Intronic
1137796524 16:51224709-51224731 GGATGCTGCAACCTCATTCCTGG - Intergenic
1138442682 16:57044547-57044569 AACTGCTGCGAGCTCAGAGCAGG + Intronic
1140034436 16:71361559-71361581 GGCTCCAGCGAGCCCACTCCAGG - Intronic
1140112590 16:72016573-72016595 TGCAGCTGCGAGCTCTGTGCAGG + Intronic
1141153544 16:81581328-81581350 GGCTTCTGTGAGCACACTCCAGG - Intronic
1141640700 16:85339341-85339363 GGCTGGAGCGAGCACAGCCCTGG - Intergenic
1142015638 16:87745336-87745358 GGGTGCTGCGAGAGCAGTGCTGG - Intronic
1144172129 17:12668110-12668132 GCATGCTGCGACCTCAGTGCTGG - Intronic
1145823313 17:27857331-27857353 GGCTGCTGTGAGCTGTGCCCTGG + Intronic
1147352710 17:39864194-39864216 GCCAGCTGCGCGCTGAGTCCAGG - Intergenic
1147624901 17:41893719-41893741 GGCTGCTGTGTCCTCAGCCCCGG - Intronic
1147661827 17:42121048-42121070 CGCTGCTGCTGGCTCAGGCCAGG + Exonic
1148454714 17:47804867-47804889 CGCTGATGGGAGCTCAGGCCAGG - Intergenic
1152069424 17:78127641-78127663 GGTGGCTGGGAGCTGAGTCCTGG - Intronic
1152394917 17:80026624-80026646 GGCAGCTGGGTTCTCAGTCCAGG - Intronic
1153618066 18:6952261-6952283 GGCTGCTGAGAGCCCAGTGCAGG + Intronic
1153935322 18:9914898-9914920 GGCTGCAGCGAGCTCTCCCCGGG - Intronic
1153987983 18:10369636-10369658 GGCTTCGGTGAGCTCATTCCAGG + Intergenic
1155910415 18:31498449-31498471 GGCTGCGGCGAGATCCGACCTGG + Intronic
1156409840 18:36817225-36817247 AGCTGCTGCTGGCTCAGCCCAGG + Intronic
1158216988 18:55110750-55110772 GGCTGGTATGAGCTCAGCCCGGG - Intergenic
1159001404 18:62978565-62978587 TGCTGCTGCGAGCTCAGCGCCGG + Exonic
1160750345 19:731161-731183 GGCGGCCCCGAGCCCAGTCCGGG + Exonic
1161687880 19:5712362-5712384 AGCTGCTATGAGCTGAGTCCAGG - Intronic
1161901540 19:7123095-7123117 GGATGCAGCGTGCTCAGCCCTGG + Intronic
1163398367 19:17076899-17076921 GGTTGCTCTGAGCTCAGCCCTGG + Intronic
1163843603 19:19626778-19626800 GGCTGCTGCCTGCCCACTCCTGG - Exonic
1164534652 19:29076163-29076185 GCCTGCTGTGAGCTCAGGCGAGG - Intergenic
1164630716 19:29759969-29759991 GGCTGCAGCGAGCTGAGATCAGG + Intergenic
1166844644 19:45719184-45719206 GGCTGCAGTGAGCTCAGATCAGG + Intronic
1167096145 19:47375965-47375987 GGCCGCTGCCAGCTCAGCCCAGG + Exonic
1168069679 19:53942606-53942628 GGCTGCTCCCAGCTCAGAGCAGG - Exonic
1168428469 19:56258163-56258185 GGCGGGTGGGAGCTGAGTCCTGG - Intronic
925057589 2:867014-867036 GCCTGCTGGGAGCTCCCTCCCGG - Intergenic
925364226 2:3300477-3300499 GACTGCTGGGAGCCCAGTCCAGG - Intronic
925396459 2:3536879-3536901 GGCTGGTGCGTGGTCTGTCCCGG + Intronic
925971966 2:9112315-9112337 GGCGGCTGGGAGCTGAGCCCGGG - Intergenic
926207188 2:10842176-10842198 TGCTCCTGAGAGCTCAGTGCTGG + Intergenic
927948579 2:27152387-27152409 GGCTGTTGCCAGCTCTGCCCAGG + Intronic
928025605 2:27736246-27736268 GGCAGAGGCCAGCTCAGTCCTGG - Intergenic
928134885 2:28680735-28680757 GGCTGGAGCCAGCTCAGCCCTGG + Intergenic
931868303 2:66434296-66434318 GGCTGCTGCGAGCCCGCGCCGGG + Intronic
932493281 2:72134519-72134541 GCCTGCAGGGAGCTCAGGCCTGG - Intronic
934577967 2:95414837-95414859 GGCTGCTGCAGGTTCAGTTCTGG - Exonic
934601469 2:95661865-95661887 GGCTGCTGCAGGTTCAGTTCTGG + Intergenic
936521109 2:113212671-113212693 GGCTGCTCCCGGCTCACTCCAGG + Intergenic
936534834 2:113304030-113304052 GGCTGCTGCAGGTTCAGTTCTGG + Intergenic
938902671 2:135811141-135811163 GGCTGCAGTGAGCTCAGATCAGG + Intronic
941056136 2:160790972-160790994 AGCTGCTGAGAGCTCAGTGTGGG - Intergenic
942355105 2:175102704-175102726 GGCTGCAGTGAGCTCTGGCCTGG + Intronic
944543672 2:200778445-200778467 GTCTTCTGCGACCTCAGTCCAGG - Intergenic
946427749 2:219608445-219608467 GGCTGGGGCGAGCTGAGGCCAGG + Intronic
947019513 2:225659395-225659417 GCATGCTCCGAGCCCAGTCCTGG - Intergenic
947793124 2:232878966-232878988 GGCAGCTGGGCTCTCAGTCCTGG + Exonic
948379470 2:237542467-237542489 AGCTGCCCCCAGCTCAGTCCTGG - Intronic
948803142 2:240441831-240441853 GGCTGCTGCGTGCTCCCGCCTGG - Intronic
1169282623 20:4280246-4280268 GGCTGCTGTGAGGTCAGCACTGG + Intergenic
1171005156 20:21457405-21457427 TGCTGGTGCAAGCTCAGTCATGG + Intergenic
1173167938 20:40699241-40699263 GGCTGATGCCAGCTCATTCCAGG + Intergenic
1173824321 20:46037603-46037625 GGATGCTGAGAGCTCAGTGGGGG - Intronic
1175783192 20:61696555-61696577 GCCTGCTGGGATCTCAGCCCCGG - Intronic
1176238257 20:64064125-64064147 AGTTGCTGCGGGCTAAGTCCTGG - Intronic
1176411203 21:6450477-6450499 CCCTGCTCAGAGCTCAGTCCTGG - Intergenic
1178914634 21:36699549-36699571 GGTTGCTCGGAGCTCAGGCCCGG + Exonic
1179029841 21:37711215-37711237 GTCTGCTGGGAGCTCAGGCCCGG - Intronic
1179225811 21:39451982-39452004 GGCTGCTGCCAGCCCCGACCTGG + Exonic
1179686696 21:43058799-43058821 CCCTGCTCAGAGCTCAGTCCTGG - Intronic
1179931267 21:44572484-44572506 GGCTGCTGAGTGCCCAGTGCTGG + Intronic
1179992834 21:44957555-44957577 GGCTCCTGCGATCTGGGTCCTGG - Intronic
1180977845 22:19860232-19860254 GGCTGCAGCGAGCTGTGTCCAGG - Intergenic
1185287778 22:50010291-50010313 GGCTGCTGAGGGCTCCGCCCAGG + Intronic
950614545 3:14148457-14148479 GGCTGCTGGGAGTTGAGGCCTGG - Intronic
950796160 3:15512087-15512109 TGCTGCTGGGAGTTCTGTCCTGG - Intronic
954163816 3:48740217-48740239 GTCTGCTGTGAGCTGAGTCTTGG - Intronic
954384811 3:50238440-50238462 GGCTGCTGCCAGCCCAGTGTGGG - Intronic
954459769 3:50619660-50619682 GGCTGGTCAGAGCTCAGTCTTGG - Intronic
954899272 3:54005302-54005324 GGCAGATGTGAACTCAGTCCTGG - Intergenic
955068913 3:55555972-55555994 GGGTGCTGTGAGCTCAGTCGTGG - Intronic
955753576 3:62206108-62206130 GGCTGCTGAGAGCTTAGGCTGGG + Intronic
961269137 3:125675157-125675179 GTCTGCTCCAAGCTCAGTACTGG + Intergenic
961438231 3:126934068-126934090 GACTTCTGTGAGCTCAATCCAGG - Intronic
961541980 3:127606361-127606383 GGCAGGTCCGAGCTCAGTGCTGG + Intronic
969337504 4:6520278-6520300 GACTGCTGTGAGCCCAGCCCGGG - Intronic
973840265 4:54854078-54854100 GCCTGCTGGGAGGTCAGTGCAGG + Intergenic
980358090 4:131741389-131741411 GATGGCTGCGCGCTCAGTCCAGG + Intergenic
980359705 4:131748824-131748846 GATGGCTGCGCGCTCAGTCCAGG + Intergenic
980360785 4:131753791-131753813 GATGGCTGCGCGCTCAGTCCAGG + Intergenic
980361868 4:131758746-131758768 GATGGCTGCGCGCTCAGTCCAGG + Intergenic
985068471 4:186145074-186145096 GGGGGCTGCGAGCACAGGCCCGG + Exonic
991925698 5:71703153-71703175 GGCTGCAGACAGCGCAGTCCTGG + Intergenic
993150472 5:84155037-84155059 GTCTGCTGCAAGCTCCATCCTGG + Intronic
996493910 5:124131048-124131070 GGCTGCTGCTTGCTGAGCCCTGG - Intergenic
997539323 5:134648714-134648736 GGCTGCTGCGAGCCCGGAGCCGG + Intronic
997853487 5:137353638-137353660 AGCTGCTGCCAGCTCCCTCCAGG + Intronic
998377040 5:141698142-141698164 GGCCCCTGCGAGCTCAGCCAAGG + Intergenic
999193133 5:149763423-149763445 GGCCTCTGTGAGCTCTGTCCTGG + Intronic
1002131910 5:177087099-177087121 GGCGGCTGGGAGCGCAGCCCGGG - Intronic
1003324370 6:5081560-5081582 GGCTGCTCAAAGCTCAGTCCTGG + Intergenic
1004206065 6:13592607-13592629 GGGAGCTGCCAGCTCAGTGCTGG + Intronic
1004206904 6:13599595-13599617 GGCTGCTGTTTGCTCACTCCTGG - Intronic
1006054255 6:31369420-31369442 GGCAGCTGCCAGCTCAGCCTTGG - Intergenic
1007425629 6:41744285-41744307 GACTGAGGGGAGCTCAGTCCTGG - Intronic
1007477321 6:42127574-42127596 GGCCCCTGAGAGCTCAGACCAGG + Intronic
1007924427 6:45640175-45640197 GGCTGCTGTGTCCACAGTCCTGG + Intronic
1008447635 6:51611310-51611332 GGCTGCAGCGAGCTGAGATCAGG + Intergenic
1008481751 6:51993262-51993284 GGCTCCTGGGAGCTCTGGCCAGG - Intronic
1014246726 6:119078268-119078290 TGCTGCTGCCAGCTCATGCCCGG + Exonic
1014360894 6:120472003-120472025 GGCTGCTGTGACCTCTGCCCGGG - Intergenic
1015844800 6:137509026-137509048 GGCTGCTGAGAGCTCAGAGAAGG + Intergenic
1016845694 6:148566103-148566125 GTTTCCTGGGAGCTCAGTCCAGG - Intergenic
1017003671 6:150014616-150014638 GGCTTCTGCGGGCTCCGCCCAGG + Intergenic
1018629383 6:165809239-165809261 GGCTGCACCCAGCTTAGTCCAGG - Intronic
1018984249 6:168623856-168623878 GGCTGATGCGTGCTGAGGCCTGG + Intronic
1019563862 7:1670312-1670334 GGCGGCTGCGGGCGCAGCCCCGG + Intergenic
1021181081 7:17506806-17506828 GGCATCTGGGAGGTCAGTCCAGG + Intergenic
1021609170 7:22441247-22441269 GGCTGCTGTGAGCTGTGGCCAGG - Intronic
1022336335 7:29425325-29425347 GGGTGCTGCCAGCTGAGTCCCGG + Intronic
1024195303 7:47053074-47053096 GGCTGCTGCGAGGCAGGTCCCGG - Intergenic
1024236523 7:47402975-47402997 GGCAGCTGTGGGCTCAGTCCTGG + Intronic
1025976767 7:66376674-66376696 GGCTGCTGCGAGGTGAGGCAAGG + Intronic
1026304780 7:69131358-69131380 GTCAGCTGGGAGCTCAGCCCTGG + Intergenic
1026347892 7:69490784-69490806 GGCTGCAGTGAGCTCAGACTGGG - Intergenic
1026867336 7:73831873-73831895 GCCTGCGCTGAGCTCAGTCCAGG - Exonic
1027231330 7:76274342-76274364 GGAAGCTGGAAGCTCAGTCCTGG - Intronic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1029200959 7:98838953-98838975 GGCTGCTGCAGGCTTGGTCCTGG - Intergenic
1029477555 7:100794015-100794037 TCCTGCTGCCAGCTCAGACCTGG - Exonic
1029607087 7:101605708-101605730 GCCTGCTGTGAGCTGAGGCCCGG - Intergenic
1030123796 7:106135679-106135701 GGCTGCTGTGAGGACAGCCCTGG + Intergenic
1034620539 7:152453413-152453435 GGCTCATGCAAGCTCCGTCCCGG + Intergenic
1035425770 7:158771756-158771778 GGCTGCAGCTAGCTCAGAGCAGG + Intronic
1038629768 8:29230671-29230693 GGCTGTTGCCAGCTCAGTCTGGG - Intronic
1038777504 8:30544250-30544272 GCCTGCTGAGATCTCAGGCCTGG - Intronic
1038789806 8:30658219-30658241 GGGTGCTAGGAGCTCAGTCCCGG + Exonic
1042926818 8:73975614-73975636 CTCTGCTCCTAGCTCAGTCCTGG + Intronic
1043578915 8:81689536-81689558 GGCTGCAGAGACCTCAGTACAGG + Intergenic
1044546070 8:93460825-93460847 GGCTGCTGTGTGGTCAGTCATGG - Intergenic
1045320382 8:101077640-101077662 GGATGCTACGTGCTCAGTCCTGG + Intergenic
1047255345 8:123209671-123209693 GCCTGTGTCGAGCTCAGTCCTGG + Exonic
1048398078 8:134034086-134034108 GGCAGCTGAGAGCTGAGTCAGGG - Intergenic
1049615165 8:143572765-143572787 GGCGGCTTCTAGGTCAGTCCTGG - Exonic
1051774766 9:20621831-20621853 GGGAGCTGCGGGCACAGTCCGGG - Intronic
1056826191 9:89877960-89877982 AGCTGCTGCCTGCTCAGGCCTGG - Intergenic
1057568234 9:96183864-96183886 GGCTTCAGCGAGCTACGTCCTGG - Intergenic
1060837772 9:126769887-126769909 GGCTGCAGCGAGCTGTGTTCGGG + Intergenic
1061666283 9:132162406-132162428 GGCTGCTACGAGCTGAGAACTGG + Intronic
1061919944 9:133777250-133777272 GGCTGCTGTGAGCTGCTTCCTGG - Intronic
1062127309 9:134870570-134870592 GGCTGCTTGGGGCTCAGTACAGG - Intergenic
1062525312 9:136975875-136975897 GCCCGCTGCCAGCTGAGTCCTGG - Intergenic
1185475671 X:413923-413945 GGCAGCTCCGAGCTCAGCCGTGG - Intergenic
1185948140 X:4401176-4401198 GGGTGCTGTAACCTCAGTCCTGG + Intergenic
1189247664 X:39576172-39576194 TGCTGCTGGGAGCCAAGTCCCGG - Intergenic
1190745293 X:53318927-53318949 GGCTGCTGCGAGCTCAGTCCGGG - Intronic
1195223260 X:102766747-102766769 GTCTGCTGGGAGCTCAGTTAAGG - Intergenic
1195327459 X:103769320-103769342 GGCTGCTGCTAGCTCAGCACAGG - Intergenic
1197932567 X:131710913-131710935 GGAAGCAGCTAGCTCAGTCCTGG + Intergenic
1198548651 X:137720829-137720851 CTCTGCTGTGTGCTCAGTCCAGG - Intergenic
1201735507 Y:17256554-17256576 GGGTGCTGTAACCTCAGTCCTGG + Intergenic