ID: 1190745763

View in Genome Browser
Species Human (GRCh38)
Location X:53321083-53321105
Sequence TCGGATCCCGGGCCGCCCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190745754_1190745763 -3 Left 1190745754 X:53321063-53321085 CCACGGCCCGATTTGGGCTCTCG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1190745763 X:53321083-53321105 TCGGATCCCGGGCCGCCCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 64
1190745756_1190745763 -9 Left 1190745756 X:53321069-53321091 CCCGATTTGGGCTCTCGGATCCC 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1190745763 X:53321083-53321105 TCGGATCCCGGGCCGCCCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 64
1190745757_1190745763 -10 Left 1190745757 X:53321070-53321092 CCGATTTGGGCTCTCGGATCCCG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1190745763 X:53321083-53321105 TCGGATCCCGGGCCGCCCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 64
1190745751_1190745763 9 Left 1190745751 X:53321051-53321073 CCAGCAGGTACTCCACGGCCCGA 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1190745763 X:53321083-53321105 TCGGATCCCGGGCCGCCCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190745763 Original CRISPR TCGGATCCCGGGCCGCCCGG GGG Exonic
900562170 1:3312549-3312571 CCGGATCCGGGGCCGGCAGGTGG + Intronic
903420974 1:23217578-23217600 TCGGCCCCCCGCCCGCCCGGAGG + Intergenic
904641467 1:31933968-31933990 ATGGATCCTGGGCCGCGCGGTGG + Intronic
905734339 1:40315600-40315622 TCGGATCCAGGCACTCCCGGCGG + Exonic
906294070 1:44638227-44638249 TTGCAGCCCGGCCCGCCCGGCGG - Intronic
915355971 1:155255344-155255366 TAGGATCCGGGGCCGCCTGGTGG + Exonic
915549849 1:156625532-156625554 TCGGACCCCGGCTGGCCCGGCGG + Exonic
916656885 1:166884509-166884531 TGGGATCCCGGGCATCCTGGAGG - Intergenic
924560553 1:245154357-245154379 ACCGACCCCGGGCCGGCCGGGGG - Intergenic
1075375433 10:121974840-121974862 TCCGGGCCCGCGCCGCCCGGAGG + Intronic
1079115013 11:17635138-17635160 CCTGATCACGGGCCGCCTGGGGG + Exonic
1083891868 11:65599591-65599613 TCGCGTCCTGGGCCTCCCGGCGG + Exonic
1103563528 12:121804441-121804463 GCGGGGCCCGGGGCGCCCGGAGG - Intronic
1104854381 12:131895119-131895141 GGGGATCCCGGGCCGGACGGGGG - Intronic
1104977737 12:132559855-132559877 TCGGACCCCGGGCCGGCGGCGGG + Intronic
1113890310 13:113731980-113732002 TAGGATCCGGGGCAGCCCAGGGG - Intronic
1121320543 14:92989269-92989291 TGGGATCCCAGGCCTCCCTGGGG - Intronic
1123035232 14:105469279-105469301 CCGGGTCCTGGGCCGCCTGGTGG - Intronic
1129421416 15:75430300-75430322 TCGGATCCCTGGCAGCACAGAGG - Exonic
1132662112 16:1066202-1066224 AGGGAGCCCGGGCCGCCCTGGGG + Intergenic
1144693030 17:17281192-17281214 TCGCCGCTCGGGCCGCCCGGGGG - Exonic
1146492312 17:33291997-33292019 GCGGCTGCCGGGCAGCCCGGGGG - Exonic
1152175070 17:78782063-78782085 GCGGAGCCCGGGGCGACCGGCGG - Intronic
1154377958 18:13824214-13824236 TCGGATCCCGGGGACGCCGGGGG + Intronic
1156275612 18:35581132-35581154 TCGGCTCCCGGGCCGAGCGCGGG - Intronic
1157278987 18:46333815-46333837 GCGGGTCCCTGGCCGCCCGCGGG - Intronic
1160754848 19:751729-751751 TGGGATCCCGGGCAGCCAGCAGG + Intronic
1162381275 19:10333303-10333325 ACTGATCCGGGGCCTCCCGGGGG - Exonic
1162416878 19:10543809-10543831 CCCGATCCCGGGTCGCCAGGCGG - Intergenic
1162914272 19:13865715-13865737 CCGGAGCCGGGGCCGCCAGGGGG + Intronic
1163282078 19:16324495-16324517 CGGGAGCCCGGGGCGCCCGGGGG + Intergenic
1166762598 19:45234418-45234440 GCGGCTCCCGGGGCGCCCGGGGG - Intronic
1166873930 19:45886003-45886025 TCGGAGCCCGGACCGGGCGGGGG - Exonic
1167924123 19:52809865-52809887 CTGGATCCCGGACCGCCCGCAGG - Intronic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
926107899 2:10163684-10163706 TCGGTTCCCCGGCTGCCCAGTGG + Intronic
927652218 2:24919825-24919847 TCGGATCCCGGGCCTGACGGCGG - Exonic
929856765 2:45643880-45643902 TCTGATGCCGGGCCGCACCGGGG - Intergenic
933652072 2:84857732-84857754 TGGGATCCCGGGCCGTCAGAAGG - Intronic
935710378 2:105893196-105893218 TCGCCTCCCGGGCCCCACGGTGG + Exonic
942314053 2:174682444-174682466 GCGGACCCGGGGCCGCCCCGTGG - Intronic
946286990 2:218711187-218711209 GCGGCTCCCTGGCCTCCCGGGGG - Intronic
948823179 2:240560569-240560591 TAGGACCCGGGGGCGCCCGGCGG + Exonic
1175753002 20:61512159-61512181 TGGGTTCCTGGGCTGCCCGGTGG + Intronic
1177166670 21:17612265-17612287 TCGAACCCAGGGCCGCCCGCCGG - Intronic
1178486500 21:33023035-33023057 GCTCCTCCCGGGCCGCCCGGCGG + Intergenic
1178916405 21:36707867-36707889 TCGTATCCCGCGCTGCCCGGGGG + Intronic
1184477576 22:44729863-44729885 TCAGTTCCCGGGCTGGCCGGGGG - Intronic
962222398 3:133574308-133574330 TCGGGGCCCGGGCCGCGCGCCGG + Intronic
968196718 3:196712688-196712710 CCGGCTCCCGGGCCTCTCGGCGG + Intronic
986728633 5:10618512-10618534 CGGGAGCCCGGGCTGCCCGGCGG - Intronic
993901131 5:93584882-93584904 TGCGACCCCGGGGCGCCCGGCGG + Exonic
997652851 5:135535218-135535240 GCGGATCAAGGGCTGCCCGGAGG - Exonic
997990935 5:138543784-138543806 GAGGGTCCCGGACCGCCCGGAGG - Intergenic
1002638373 5:180619140-180619162 TCGGAACCCGGGGCGCGCTGCGG + Intronic
1002929573 6:1624138-1624160 TCGGAGCCCGGCCCGCCCTCCGG - Exonic
1007777098 6:44229922-44229944 ACGGATCCTGGGCAGCCTGGTGG + Exonic
1014724890 6:124962373-124962395 TCGGAGCACGGGCTCCCCGGAGG + Intergenic
1016461603 6:144285138-144285160 GCGGACCCCTGGCTGCCCGGAGG + Intergenic
1018960198 6:168441994-168442016 GCGGATCCCGGGCCTCTCGCCGG + Intronic
1021206450 7:17786788-17786810 TCTGATCCCGGGGCTCCTGGGGG - Intergenic
1026471119 7:70694631-70694653 GCGCGTCCCGGGCCGGCCGGCGG - Intronic
1031447521 7:121873024-121873046 TCGGACCCGGGGTCGCGCGGGGG - Intergenic
1034963090 7:155374359-155374381 CCGGGTCCCGGCCCGCCCGCCGG - Intergenic
1035022037 7:155805816-155805838 TAGGATCCACGGGCGCCCGGCGG + Intronic
1059271270 9:113071646-113071668 CAGGAACCCGGGCCCCCCGGTGG - Intergenic
1060405314 9:123370143-123370165 TCGGATCCCTGCCTGCACGGCGG + Exonic
1062208503 9:135350205-135350227 TCGGTTCCCAGGAGGCCCGGAGG + Intergenic
1190745763 X:53321083-53321105 TCGGATCCCGGGCCGCCCGGGGG + Exonic