ID: 1190746704

View in Genome Browser
Species Human (GRCh38)
Location X:53327798-53327820
Sequence AAGCACGAATAGATGTTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190746704_1190746706 -5 Left 1190746704 X:53327798-53327820 CCTGGCAACATCTATTCGTGCTT 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1190746706 X:53327816-53327838 TGCTTCCTTTACATGGTATCTGG 0: 1
1: 0
2: 0
3: 14
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190746704 Original CRISPR AAGCACGAATAGATGTTGCC AGG (reversed) Intergenic
903764661 1:25726380-25726402 AGGCACTAATAGAAGCTGCCAGG + Intronic
905255203 1:36677061-36677083 AAGCAGGAATAGACTATGCCTGG - Intergenic
906396809 1:45473248-45473270 AAGCACAAAAAGAAGGTGCCTGG - Intronic
912102647 1:106231226-106231248 AAGGAAGAAGAGATGTTGTCTGG - Intergenic
913490951 1:119379441-119379463 AAGAACTAATATATGATGCCTGG - Intronic
916617302 1:166455314-166455336 AAGAAGGTATAGATGTTACCAGG - Intergenic
921046618 1:211482329-211482351 AAACACGAAAGGATGATGCCAGG + Intronic
923087909 1:230715133-230715155 GAGCAGGAAGAGATGGTGCCTGG + Intergenic
1065471734 10:26089239-26089261 AGTCATGAATAGAAGTTGCCTGG + Intronic
1068072129 10:52207941-52207963 AAGGACTACTAGATGCTGCCAGG - Intronic
1068780787 10:60917276-60917298 AAGAATGAATAGAATTTGCCAGG - Intronic
1070693120 10:78542437-78542459 AAGCAGGAATAGATGTTATTTGG - Intergenic
1078680449 11:13470643-13470665 TAACACGAATATATCTTGCCAGG - Intergenic
1084313826 11:68332230-68332252 AATCCAGAATAGATGTGGCCAGG - Intronic
1087026044 11:93650769-93650791 AAGCAAGAAAAGATGATGCAAGG + Intergenic
1088898636 11:114097271-114097293 GAACTAGAATAGATGTTGCCAGG + Intronic
1089159522 11:116426807-116426829 AAGGATGAATAGGAGTTGCCTGG - Intergenic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1091438831 12:496758-496780 AAGGCAGAATAGAGGTTGCCAGG - Intronic
1091693829 12:2614802-2614824 AAGCAAGAATACAAGTTGACCGG - Intronic
1095428722 12:42109268-42109290 AACAAGGAATAGAGGTTGCCAGG - Intronic
1095851406 12:46811381-46811403 AAGAACAAATAGAAGTTGGCAGG + Intronic
1097309964 12:58108293-58108315 AGGCACAAATAGAAGTTGCTTGG + Intergenic
1099944857 12:89233078-89233100 AAGAACGAATAGGAGTTACCTGG - Intergenic
1102790285 12:115639031-115639053 AAGCTCCAATAAAAGTTGCCAGG - Intergenic
1103782175 12:123406258-123406280 AATCACTAATTGATCTTGCCTGG + Intronic
1108441024 13:50452932-50452954 CAGCACTAACAGATGTTGCAAGG - Intronic
1108601383 13:51998071-51998093 AAGAAGGATTAGATGGTGCCGGG - Intronic
1113115571 13:106871366-106871388 AAGCAAGAATAAATGTTGAATGG - Intergenic
1116835725 14:49767934-49767956 AAGCGCGACTAGAAGTCGCCGGG + Exonic
1120867197 14:89305613-89305635 TACCACGATTAGCTGTTGCCAGG + Intronic
1121184125 14:91951800-91951822 AACCACAAATAAATGTTACCGGG + Intergenic
1121817606 14:96940535-96940557 AAGGATGAATTGATGTGGCCTGG - Intergenic
1124191797 15:27585250-27585272 CAGAAAGAATAGAAGTTGCCAGG + Intergenic
1134876354 16:17702502-17702524 AAGGTAGAATAGAGGTTGCCAGG + Intergenic
1136042988 16:27595045-27595067 AAGCCTGAATAGATGATGGCAGG + Intronic
1137774228 16:51042105-51042127 AAGGACTATTAGATGTTGTCTGG + Intergenic
1138931160 16:61658044-61658066 AAAAAGGAATTGATGTTGCCTGG - Intronic
1145891933 17:28423141-28423163 AAGCCTGAATAGATCTTCCCAGG - Intergenic
1147427338 17:40352156-40352178 AAGGACGCAGAGATCTTGCCTGG - Intronic
1148468241 17:47877649-47877671 AAGCAGGAATAGAGGTTGAGAGG + Intergenic
1149373211 17:56017356-56017378 ATGCAGGAGTAGATGATGCCAGG - Intergenic
1152306361 17:79523099-79523121 AAGGAAGAATGGAGGTTGCCAGG + Intergenic
1155394567 18:25373473-25373495 AAGCATTAATAGATGGTCCCAGG - Intergenic
1157427820 18:47599265-47599287 AAGCAAGAAAAGATGTGACCTGG - Intergenic
1159573457 18:70146508-70146530 AAGCAATAATACAAGTTGCCAGG + Intronic
1161868932 19:6855602-6855624 ATGGATGAATAGATGTTGGCTGG - Intronic
1162233562 19:9286653-9286675 AAGGAGCAATAGAGGTTGCCAGG - Intergenic
1164237603 19:23350728-23350750 AAGCAGGAAGAGATATGGCCAGG + Intronic
932254624 2:70273964-70273986 AAGGAAGAATAGATGTTCCATGG + Intronic
933539804 2:83625220-83625242 ATGCATGAAAAGATGTAGCCAGG + Intergenic
935145748 2:100394158-100394180 AGTCAGGAATAGATGGTGCCAGG + Intronic
935891967 2:107688579-107688601 AGGCATGAATGGATGTTACCTGG + Intergenic
936616156 2:114049701-114049723 CAACAGGAATAGATGTTCCCAGG + Intergenic
936894756 2:117414431-117414453 AAAAACTAATAGATGTTGGCGGG - Intergenic
1182924428 22:34109124-34109146 AAGCACTAAGTGATGGTGCCAGG + Intergenic
1184354634 22:43970869-43970891 AAGAAAGAAAAGATGGTGCCAGG + Intronic
953997832 3:47534404-47534426 AAGCATGAAAATATGTTGCAAGG - Intergenic
959782231 3:110248054-110248076 ATGCAAGAATAGATGTCGCCAGG - Intergenic
961413129 3:126737694-126737716 AAGAATGAATAGAATTTGCCAGG + Intronic
978479494 4:109173017-109173039 AAGTACCATTAGAAGTTGCCAGG + Intronic
982114619 4:152087654-152087676 AAACTAGAATTGATGTTGCCAGG + Intergenic
982334210 4:154215398-154215420 AAGTCAGAAAAGATGTTGCCTGG + Intergenic
984570343 4:181384387-181384409 AAACCCAAATAGCTGTTGCCAGG + Intergenic
994837487 5:104874296-104874318 AAGGAAGAAGAGATGTTTCCTGG + Intergenic
995954100 5:117753756-117753778 AAAAACCAATAGATGTTGGCAGG + Intergenic
996388494 5:122934256-122934278 AAGCAAGAAAAGATATTTCCAGG + Intronic
997720955 5:136078120-136078142 ACGGACAAATAGATGTTGTCAGG + Intergenic
997854065 5:137357568-137357590 AAGAACGAGTAGGAGTTGCCAGG + Intronic
1004876826 6:19964035-19964057 AAGAAGGGATAGATGTTTCCTGG - Intergenic
1008505475 6:52225690-52225712 AAGGACGAATAGAAGTTTACTGG - Intergenic
1014169419 6:118262266-118262288 AAGCTCGAGTAGATTTTGGCAGG + Intronic
1016630003 6:146217872-146217894 AAGGAAGAATAGATGTTGTAAGG + Intronic
1018127490 6:160695779-160695801 AAGCATGAAAATATGTTGCAAGG + Intergenic
1020709705 7:11591753-11591775 AAACACGAATAATTGATGCCTGG + Intronic
1024581868 7:50807206-50807228 AACTACGAATAGCTGTTGGCTGG - Intergenic
1025009584 7:55385321-55385343 AAGAAGGAAAAGATGTTGCAAGG + Intronic
1032521150 7:132546245-132546267 ATGCAGGAATAGATGCTTCCAGG + Intronic
1037506490 8:19534983-19535005 CACCACCAAAAGATGTTGCCAGG + Intronic
1041874117 8:62667925-62667947 AGGCAGGAATAGCTGTTTCCTGG - Intronic
1042670387 8:71256510-71256532 CAGAAAGAATAGATGTTGCCAGG + Intronic
1045199557 8:99966873-99966895 CAGAAAGAATAGAGGTTGCCAGG - Intronic
1046017222 8:108619533-108619555 AAGCACAAAGAGCTGTGGCCAGG - Intronic
1046695664 8:117336517-117336539 TAGCATTAATAGATGTTGCTTGG - Intergenic
1048027535 8:130600518-130600540 AATCACTAGTAGATGTGGCCTGG + Intergenic
1048370379 8:133771668-133771690 AAGCACCAAGAGAAGTTCCCTGG + Intergenic
1050662053 9:7893339-7893361 AAGGATGAATAGAAGTTGCAGGG + Intergenic
1186762684 X:12739864-12739886 AATCATGAATACATGTAGCCTGG - Intergenic
1190087902 X:47411661-47411683 AAGAAAGAATAAATGTTGCCAGG - Intronic
1190746704 X:53327798-53327820 AAGCACGAATAGATGTTGCCAGG - Intergenic
1194414504 X:93593787-93593809 AAGCATGAAGAGATTTGGCCTGG + Intergenic
1194721536 X:97346245-97346267 AAACACAAATAGCTGTTTCCTGG - Intronic
1196303228 X:114070229-114070251 AAGCACAAAGAGGTGTTGTCAGG + Intergenic