ID: 1190746863

View in Genome Browser
Species Human (GRCh38)
Location X:53329057-53329079
Sequence AGTGAACTCCACCACGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190746863_1190746871 24 Left 1190746863 X:53329057-53329079 CCAGGGCCGTGGTGGAGTTCACT 0: 1
1: 0
2: 1
3: 8
4: 101
Right 1190746871 X:53329104-53329126 GCTGGACAACCTCATCAGGAGGG 0: 1
1: 1
2: 0
3: 6
4: 122
1190746863_1190746867 2 Left 1190746863 X:53329057-53329079 CCAGGGCCGTGGTGGAGTTCACT 0: 1
1: 0
2: 1
3: 8
4: 101
Right 1190746867 X:53329082-53329104 CATTGGAGGTCTTCAAATAGTGG 0: 1
1: 1
2: 0
3: 28
4: 162
1190746863_1190746869 20 Left 1190746863 X:53329057-53329079 CCAGGGCCGTGGTGGAGTTCACT 0: 1
1: 0
2: 1
3: 8
4: 101
Right 1190746869 X:53329100-53329122 AGTGGCTGGACAACCTCATCAGG 0: 1
1: 1
2: 0
3: 9
4: 121
1190746863_1190746868 6 Left 1190746863 X:53329057-53329079 CCAGGGCCGTGGTGGAGTTCACT 0: 1
1: 0
2: 1
3: 8
4: 101
Right 1190746868 X:53329086-53329108 GGAGGTCTTCAAATAGTGGCTGG 0: 1
1: 1
2: 2
3: 16
4: 153
1190746863_1190746870 23 Left 1190746863 X:53329057-53329079 CCAGGGCCGTGGTGGAGTTCACT 0: 1
1: 0
2: 1
3: 8
4: 101
Right 1190746870 X:53329103-53329125 GGCTGGACAACCTCATCAGGAGG 0: 1
1: 1
2: 0
3: 4
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190746863 Original CRISPR AGTGAACTCCACCACGGCCC TGG (reversed) Intergenic
900736174 1:4300786-4300808 AGTGACCCTCACCAAGGCCCTGG + Intergenic
904336297 1:29800468-29800490 GGTGAACTCCTCCACAGCCCCGG - Intergenic
905171855 1:36114420-36114442 AGTGGAGCCCACCACAGCCCTGG + Intronic
907756120 1:57312579-57312601 AGGGAACATCACCAGGGCCCAGG + Intronic
910859112 1:91726165-91726187 AGTGAACTCCAGGACTGCCATGG + Intronic
912333942 1:108845367-108845389 AGTCAACTCCATGACGGCACAGG - Intronic
912458771 1:109817577-109817599 AGTGGCCTCCCCCAGGGCCCTGG + Intergenic
912703279 1:111894313-111894335 AGTTAGCTCCACAAAGGCCCAGG - Intronic
917648483 1:177051868-177051890 AGGGAATTCCATCACTGCCCAGG - Intronic
917737146 1:177931896-177931918 AGTGAACTCCACCTCCTCCTGGG + Intronic
919368057 1:196690691-196690713 AGTGCACTCCACCAGGGGCAGGG - Intronic
920186533 1:204162736-204162758 GGTCCACTCCACCACAGCCCTGG - Intronic
921063608 1:211607376-211607398 AGTGACCTCCACAACAGCCGTGG + Intergenic
924894096 1:248317091-248317113 AGCCTACTCCACCAGGGCCCTGG - Intergenic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1067216921 10:44310980-44311002 AGTGCACTCCGGCGCGGCCCCGG + Intergenic
1070832194 10:79424916-79424938 AGTAAACCTCACCACAGCCCTGG + Intronic
1073084090 10:100877304-100877326 TGTGCACTCAATCACGGCCCAGG + Intergenic
1073460227 10:103661693-103661715 AGAGAGCTTCTCCACGGCCCAGG + Intronic
1076990599 11:271410-271432 AGTGAAGACCACCAGGGCCTGGG + Intergenic
1084596581 11:70120302-70120324 TGTGAACTCACCCACGGTCCTGG - Intronic
1089967572 11:122666000-122666022 AGTGAACTCCACCAGGACCAAGG + Intronic
1090227835 11:125082239-125082261 AGAGAACTCGACCACGCCCTGGG - Exonic
1091371747 11:135066166-135066188 CGTGAGCTTCACCAGGGCCCTGG + Intergenic
1095917781 12:47497596-47497618 TGTGTACACCACCAGGGCCCTGG + Intergenic
1096048725 12:48587055-48587077 AGGGAACTCCCCCACGGCCCAGG + Intergenic
1098193655 12:67977041-67977063 AGCCAACACCACCAGGGCCCTGG - Intergenic
1106337287 13:28795807-28795829 ATTGATCTCCACCACGTTCCTGG - Intergenic
1108402339 13:50058773-50058795 ACTGAACTCCACTCCAGCCCAGG + Intergenic
1115553124 14:34522313-34522335 AGTGATCTCCAAGACAGCCCAGG - Intronic
1116087020 14:40253697-40253719 AGTGAACTCCCCTTTGGCCCAGG + Intergenic
1120931008 14:89848497-89848519 AGTCAGCTCCAGCACGGCACTGG + Intronic
1122205939 14:100147970-100147992 CTTGAACTTCACCACAGCCCAGG - Intronic
1122939781 14:104976107-104976129 AGGGAACCCCTCCCCGGCCCCGG - Intronic
1127818666 15:62635940-62635962 TGTGAACTCGACCAAGGCCACGG - Intronic
1128381650 15:67117533-67117555 GCTGAACTCCACCAGGGACCTGG - Intronic
1129165577 15:73775365-73775387 ACTGAATCCCACCAGGGCCCAGG - Intergenic
1132917039 16:2355130-2355152 AGTGAGTTCCACCACTTCCCTGG + Intergenic
1135480160 16:22814990-22815012 GATAAACTCCAGCACGGCCCGGG - Exonic
1137500779 16:49010383-49010405 AATGAACCCCACCAAGGGCCAGG - Intergenic
1138081626 16:54096047-54096069 AGAGAACTACACCAAGTCCCAGG - Intronic
1139429431 16:66903330-66903352 TGTCATCTCCACCACAGCCCAGG + Intergenic
1142715712 17:1745790-1745812 AGTGAAGGCCATCATGGCCCGGG - Exonic
1150541407 17:66103988-66104010 AGCGAACTCCACCACCACCATGG + Intronic
1152554922 17:81048401-81048423 GGTGGACCCCAGCACGGCCCAGG + Intronic
1154224748 18:12493160-12493182 AACCAACTCCACCACGGCCACGG - Exonic
1160736065 19:662966-662988 AGCGACCCCCACCCCGGCCCCGG + Intronic
1163308253 19:16496120-16496142 AGTGCACACCCCCATGGCCCGGG - Exonic
1163499582 19:17668260-17668282 ACTGAGCTCCACCCGGGCCCTGG + Intronic
926890884 2:17637913-17637935 ACATAACTCCCCCACGGCCCTGG + Intronic
928274123 2:29883376-29883398 AGTGAATTCCTTCAAGGCCCAGG + Intronic
928898994 2:36297681-36297703 AGTGCACTCCAGCACACCCCTGG + Intergenic
930773160 2:55147962-55147984 GTTGATCTCCACAACGGCCCTGG + Intergenic
931719536 2:65056886-65056908 AGTGACCTCCCCCGGGGCCCAGG - Intronic
935449253 2:103190250-103190272 AGTGAACTCCACTACCACCTCGG - Intergenic
936434076 2:112488058-112488080 ACTGAACCCCACCAAGGCTCTGG - Intronic
936451974 2:112640584-112640606 AGTCCACTCCACCACTGCCGAGG - Intergenic
939470377 2:142613292-142613314 AGTGGAGCCCACCACAGCCCAGG - Intergenic
941003271 2:160222759-160222781 AGTGAACTGCCTCAGGGCCCAGG + Intronic
947311620 2:228809447-228809469 AGCCAACACCACCAGGGCCCTGG - Intergenic
1178451507 21:32705688-32705710 AGTGAACACCAACAGGGGCCTGG + Intronic
1179499857 21:41801392-41801414 GGTCAACTCCATCACGCCCCTGG - Exonic
1181519499 22:23437035-23437057 AGTGACCACCACCTCGACCCCGG + Intergenic
1183355865 22:37359051-37359073 AGTGCACTCCCCCAAGCCCCAGG - Intergenic
1184837394 22:47032049-47032071 AGACAACTCTACCACGGGCCTGG - Intronic
950673078 3:14538864-14538886 TGTGACCTCCACCTCGGCCCAGG - Intronic
957009403 3:74986462-74986484 TGTGTACACCACCAGGGCCCTGG - Intergenic
968967469 4:3776406-3776428 AGAGAGCTCCACCAGGACCCGGG + Intergenic
973993256 4:56432745-56432767 ACTGAACTCCACCCCAGCCTGGG + Intronic
974199095 4:58615505-58615527 AGTGCACACCACCACTCCCCTGG + Intergenic
975136416 4:70878923-70878945 AGTGAACTGCACTCCAGCCCGGG + Intergenic
980863130 4:138522465-138522487 AGGGAGATCCACCAAGGCCCAGG + Intergenic
982549497 4:156779914-156779936 AGTCAACTCCACCACAGAGCAGG + Intronic
984832394 4:183987685-183987707 GGTGAGCTCCACCGCTGCCCGGG + Intronic
988309887 5:29543425-29543447 AGGGAACACCACCCAGGCCCAGG - Intergenic
997674244 5:135700941-135700963 AGTGAGCTCCCCCAGGTCCCAGG - Intergenic
998938169 5:147252841-147252863 AGTGAACTCCATGAGGGCCAGGG + Intronic
1001956191 5:175849740-175849762 CGTGAGCTCCAACAGGGCCCTGG + Intronic
1002335684 5:178476667-178476689 TGTGAACTCCACAAGGGCCCTGG + Intronic
1007241773 6:40431802-40431824 AGTGACCACCACCTCGGCCCTGG - Exonic
1010299428 6:74243172-74243194 AGTGATGTCCCCCACGCCCCAGG + Intergenic
1016136035 6:140544609-140544631 AGTGACCTCCTCCCCGGGCCTGG + Intergenic
1016334206 6:142986924-142986946 AGTGCACTCCAGCCCAGCCCTGG + Intergenic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1021194391 7:17659187-17659209 AGTGAAGTCCACTAGGGCCTAGG - Intergenic
1022806086 7:33824053-33824075 TGTGGGCTCCAGCACGGCCCTGG - Intergenic
1027573186 7:79897807-79897829 AGCTAACTCCAGCACGGCACTGG - Intergenic
1029700151 7:102241311-102241333 AGGGATCTCCATCAGGGCCCTGG - Intronic
1030881232 7:114882522-114882544 AGTGGGCTCCACCCTGGCCCAGG + Intergenic
1032481849 7:132253662-132253684 AGAAAACTCCCCCATGGCCCAGG - Intronic
1038871863 8:31503912-31503934 AGTGGACTCCACTCTGGCCCAGG + Intergenic
1040456660 8:47605052-47605074 AGTGACCTCCTCCACAGCCCTGG - Intronic
1041552897 8:59119945-59119967 AGTCACCTCCACTACGGGCCGGG - Intergenic
1051905365 9:22088849-22088871 TGTGAACTCCACCCAGGCCTGGG - Intergenic
1053397658 9:37788777-37788799 AGTGAACTCCCCCAAGGGCAGGG - Intronic
1053643078 9:40106582-40106604 AGTGACCGCCACCATTGCCCGGG - Intergenic
1054323928 9:63703809-63703831 AGTGACCGCCACCATTGCCCGGG - Intergenic
1054452251 9:65409564-65409586 ACTGAACTTCACCGGGGCCCTGG + Intergenic
1061398561 9:130356228-130356250 AGACACCTCCACCTCGGCCCCGG - Intronic
1186834031 X:13419815-13419837 AGTCATCTCCTCCACCGCCCAGG - Intergenic
1190588072 X:51967382-51967404 AGTGAATTCCCCCAGGCCCCAGG + Intergenic
1190746863 X:53329057-53329079 AGTGAACTCCACCACGGCCCTGG - Intergenic
1191848899 X:65571048-65571070 GTAGAACTCCACCATGGCCCTGG - Intergenic
1192890944 X:75389960-75389982 AGTGAGCTCCACTCTGGCCCTGG - Intronic
1193337361 X:80306654-80306676 AGTGACCTCCTCTATGGCCCAGG + Intergenic
1195090092 X:101450465-101450487 AGTGAACTCCCCTCTGGCCCAGG + Intronic
1196587157 X:117443473-117443495 TGCCAACCCCACCACGGCCCTGG + Intergenic
1197263997 X:124346927-124346949 AGTGTGTTCCACCACGGCCCTGG - Intronic
1198775695 X:140176732-140176754 AGTGATCCCCAGCAGGGCCCTGG - Intergenic
1199645834 X:149909782-149909804 AGTGAGCTCCCCCAGGCCCCAGG - Intergenic
1199723286 X:150558558-150558580 AGTGCACTCCCCCACTCCCCAGG - Intergenic