ID: 1190748289

View in Genome Browser
Species Human (GRCh38)
Location X:53339857-53339879
Sequence CTGAACGTACAAATTGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190748287_1190748289 0 Left 1190748287 X:53339834-53339856 CCAAGACTGCACAGAATGAGAGC 0: 1
1: 0
2: 0
3: 16
4: 169
Right 1190748289 X:53339857-53339879 CTGAACGTACAAATTGACAATGG 0: 1
1: 0
2: 4
3: 34
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190748289 Original CRISPR CTGAACGTACAAATTGACAA TGG Intergenic
901351826 1:8604183-8604205 CTGATCGTACAACTAGTCAATGG + Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
906001671 1:42431719-42431741 CTGAACTTTCAAATTTACATTGG - Intronic
908578313 1:65485725-65485747 CTGACTGTACAAATTGGTAATGG - Intronic
911992433 1:104718191-104718213 CTGAACATACAAATTTCCCAGGG - Intergenic
914325413 1:146610410-146610432 CAGAAAGTGCAAAATGACAAAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1062887053 10:1024581-1024603 CTGAACGAAAACATTGAGAAAGG - Exonic
1063882234 10:10542942-10542964 CTGAAAATACAGACTGACAATGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067071230 10:43133729-43133751 CTGAACATGCAAACAGACAATGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1074866769 10:117548577-117548599 CTGAACGTGCACTCTGACAAGGG + Exonic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1076421923 10:130337995-130338017 CTGATCTCACAAATTGAGAAGGG + Intergenic
1080856854 11:36119660-36119682 CTCAACTTACAAATGGGCAAAGG - Intronic
1081897654 11:46600502-46600524 CTGTACTTCCAAATTGCCAAGGG - Intergenic
1083837370 11:65280156-65280178 TTGAATGTAAACATTGACAAAGG - Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087034455 11:93741940-93741962 CTGAAGGCAGAAATAGACAAAGG - Exonic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1088340785 11:108763925-108763947 CAGAAAATACAGATTGACAAAGG + Intronic
1088563638 11:111143926-111143948 CTGAAAGCACAATTTGCCAAGGG - Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1098820458 12:75221379-75221401 CAGAACGTAGAAAGTGACACTGG - Intergenic
1099249164 12:80231452-80231474 CTGAGCATACTAATTAACAAAGG - Intronic
1100048092 12:90410481-90410503 GTGAACCTATAAATTTACAAAGG - Intergenic
1101566568 12:105911395-105911417 CTAAACTAACAAAGTGACAATGG + Intergenic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108161281 13:47642482-47642504 CTGAACCAACTAATTGACAATGG - Intergenic
1108178371 13:47817700-47817722 CTGCACGCACAAAATGACCAGGG + Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1112111003 13:96298924-96298946 CTGAACTTACAAATTTAAAAAGG - Intronic
1112267485 13:97938355-97938377 ATGATAGTACAAATTGACATTGG - Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115211632 14:30972423-30972445 GTGAACGTACACTTGGACAAGGG - Intronic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116163215 14:41297060-41297082 CAAAAAGTACAAATTCACAATGG - Intergenic
1116648259 14:47557847-47557869 TTGAATGTACAAATTAATAAAGG - Intronic
1117769466 14:59118462-59118484 CTGAATTTACAAATTTAGAAAGG - Intergenic
1120474329 14:84968553-84968575 CTAAACTTACAAAATGAAAAGGG + Intergenic
1121786923 14:96668929-96668951 CTGTAGGTAGAAATTCACAAAGG - Intergenic
1126084476 15:44998962-44998984 CTGAACACACAATTTGAAAAAGG - Intergenic
1130004541 15:80082398-80082420 CAGATAGGACAAATTGACAAAGG + Intronic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1137505358 16:49049577-49049599 TTAAACATACAAACTGACAAAGG - Intergenic
1140008148 16:71100537-71100559 CAGAAAGTGCAAAATGACAAAGG + Intronic
1140223583 16:73061467-73061489 CTGAAGGTAAAAATATACAATGG - Intergenic
1141789860 16:86227105-86227127 CTCAAGGTACAAAATGACAATGG - Intergenic
1141891399 16:86929025-86929047 CTGAAAGGACAAAGTGACAGAGG + Intergenic
1144221375 17:13102826-13102848 CTGAATGTACCCATGGACAATGG - Intergenic
1151266025 17:72955727-72955749 CTGAACGAACTAAATGACAGAGG + Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155713121 18:28906944-28906966 CACAACATACAATTTGACAACGG + Intergenic
1157001936 18:43537194-43537216 ATGTACAAACAAATTGACAAAGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158152753 18:54390870-54390892 CAGAAAATACAAATTGCCAAAGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158975876 18:62711386-62711408 TTGAAAGAACAAATTGATAAAGG - Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1168218277 19:54942388-54942410 CTGATAGTACAAAATCACAAGGG + Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
937039771 2:118812293-118812315 CCGAACAGAAAAATTGACAAAGG - Intergenic
937735695 2:125285690-125285712 CTGAACAGACAAATTACCAAAGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
941832771 2:169980528-169980550 ATGAACGAACAAATAAACAAGGG - Intronic
943299844 2:186184541-186184563 CTGAAATTACAAATTTACTATGG + Intergenic
944939458 2:204607932-204607954 CTAAATGTCCAAATTGTCAAAGG - Intronic
944955949 2:204809342-204809364 CTGAACATAGAAACTGGCAAAGG - Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
947104122 2:226650403-226650425 CTGAGCGAACTTATTGACAAAGG - Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169280448 20:4262680-4262702 CTTAACATACAAATCCACAATGG - Intergenic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177135583 21:17302833-17302855 CAAAACTTACAAAGTGACAATGG + Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178215723 21:30595586-30595608 CTGGATTTAGAAATTGACAAAGG - Intergenic
1178333742 21:31725459-31725481 CTTAATGTACGAATTGACATTGG - Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1182917908 22:34052294-34052316 CAGAACCTACAAATTAACACTGG + Intergenic
1183089831 22:35514288-35514310 CTGATCATATAAACTGACAAAGG - Intergenic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
952462673 3:33545571-33545593 CTCAATGTAGAAATTGAGAAAGG + Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
960324343 3:116276869-116276891 CTGAATGGACCAATTAACAAGGG + Intronic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
963359993 3:144259546-144259568 CTGAAGGTAAACATTGACATTGG + Intergenic
963396946 3:144747110-144747132 CTTATTGTACAAATGGACAATGG + Intergenic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
967475815 3:189916592-189916614 CTGATAGTATAAAATGACAATGG + Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
971162929 4:24152234-24152256 CTGTACTTACAAATTTAAAAAGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
972282259 4:37613812-37613834 GTAAACGTAGACATTGACAAGGG - Intronic
974408408 4:61507080-61507102 CTCTCCATACAAATTGACAATGG + Intronic
975442827 4:74432490-74432512 CTGAACTTATAAATTCATAAAGG + Intergenic
981025842 4:140076324-140076346 TTGAACGTACAAAATTAAAATGG - Intronic
981071701 4:140547346-140547368 TTGGACGTACAAGATGACAATGG - Intronic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
984435047 4:179699146-179699168 ATGAACATGCAAATTGACTAGGG - Intergenic
984494138 4:180473148-180473170 CTGAACATAAAAATCAACAAAGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986863327 5:11953346-11953368 CTCCACATACAAATGGACAAAGG - Intergenic
987927170 5:24357106-24357128 CTCAATGAAAAAATTGACAAAGG - Intergenic
988050199 5:26017978-26018000 CAGAAGGTATAAATTGAAAAGGG + Intergenic
988168550 5:27625793-27625815 CTTAACTCACAAATTGAAAAAGG - Intergenic
992151438 5:73908466-73908488 CAGAAGGGACAAATTGAAAATGG - Intronic
992623818 5:78618814-78618836 TTGAACATACACATTGAAAAAGG + Intronic
995860384 5:116634696-116634718 CTGAACGTATAAGTGGGCAAGGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
1000787633 5:165565637-165565659 CTGAGAGTTCTAATTGACAAGGG + Intergenic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1007158636 6:39770880-39770902 CTGAACATAGAAATTGAGAGTGG - Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011893580 6:92196734-92196756 CTGAAAGTGCAGATTGAAAAGGG + Intergenic
1012023813 6:93962516-93962538 CAGAAAGGACAAATTGAGAAGGG + Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014605495 6:123469010-123469032 CTGAAAGAACAAATTGACACAGG - Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1028050782 7:86182884-86182906 CTAAATCTACAAATTGAAAAGGG + Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1031846885 7:126815973-126815995 CTAAACATACAAATACACAAAGG + Intronic
1032607544 7:133372056-133372078 CTGAACTTAAAAATGGACAAAGG - Intronic
1033633928 7:143190626-143190648 CTGAAGTTAAAAATTGGCAAAGG + Intergenic
1033923954 7:146433460-146433482 TTGAAAATACACATTGACAAAGG + Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040849615 8:51885648-51885670 CTAAAAATACAAATTCACAAAGG + Intronic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1042610294 8:70591450-70591472 CTGGACGTACACATTTACATGGG + Intronic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045124656 8:99075697-99075719 CTGATACTACAAAATGACAAAGG - Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1050851069 9:10287181-10287203 CCAAAGGTAAAAATTGACAAGGG + Intronic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1052024041 9:23555641-23555663 CTCAAAGTACAAAATGACTAAGG + Intergenic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1058264353 9:102879323-102879345 CTTAATTTAAAAATTGACAAAGG - Intergenic
1058686440 9:107485478-107485500 CTGGACTTACAAAATGCCAAGGG - Exonic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1189361178 X:40353221-40353243 CTGATAGTACAAACAGACAAAGG + Intergenic
1190748289 X:53339857-53339879 CTGAACGTACAAATTGACAATGG + Intergenic
1191739345 X:64420172-64420194 CTGAACATAGAAACTGGCAAAGG - Intergenic
1192710430 X:73577670-73577692 CTGAACGGACAAATAAATAATGG - Intronic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1197450320 X:126605361-126605383 CTGAACTTAAAAATGGGCAAAGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1202084336 Y:21120047-21120069 CTGTACATACAAAATGAGAATGG + Intergenic