ID: 1190748560

View in Genome Browser
Species Human (GRCh38)
Location X:53341514-53341536
Sequence CTCTGACACCCCAGGCTATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190748554_1190748560 26 Left 1190748554 X:53341465-53341487 CCTGACATTGGGCTGGGACACAT 0: 1
1: 0
2: 0
3: 13
4: 147
Right 1190748560 X:53341514-53341536 CTCTGACACCCCAGGCTATATGG 0: 1
1: 0
2: 1
3: 16
4: 160
1190748555_1190748560 -3 Left 1190748555 X:53341494-53341516 CCTACCTGAAGTACCAGTTCCTC 0: 1
1: 0
2: 2
3: 30
4: 552
Right 1190748560 X:53341514-53341536 CTCTGACACCCCAGGCTATATGG 0: 1
1: 0
2: 1
3: 16
4: 160
1190748556_1190748560 -7 Left 1190748556 X:53341498-53341520 CCTGAAGTACCAGTTCCTCTGAC 0: 1
1: 0
2: 2
3: 5
4: 176
Right 1190748560 X:53341514-53341536 CTCTGACACCCCAGGCTATATGG 0: 1
1: 0
2: 1
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190748560 Original CRISPR CTCTGACACCCCAGGCTATA TGG Intergenic
915596724 1:156900476-156900498 CTCTGACACTCCTGGCTGTGCGG + Intronic
917690967 1:177468626-177468648 CTCTGACTCCCCAGTGTATTTGG - Intergenic
918199716 1:182255733-182255755 TTCTAACACCCATGGCTATATGG - Intergenic
919911067 1:202111011-202111033 CCCTGAAACCCCAGGCTAGAGGG - Intergenic
921360669 1:214328807-214328829 CTCAGACACCCCAGCCGAAAGGG - Intronic
922212268 1:223495428-223495450 CCCTGCCACCCCAGGATTTATGG + Intergenic
922225032 1:223638659-223638681 TGCTGACACCCCAGGCTCTGTGG + Intronic
922316122 1:224443845-224443867 CACTGAATCCCTAGGCTATAGGG - Intronic
923389208 1:233497280-233497302 CTACTACACACCAGGCTATATGG + Intergenic
923649773 1:235863566-235863588 CTCTGAAATTCCAGACTATATGG + Intronic
923937257 1:238776945-238776967 TTCTGACACCCGATGTTATAAGG - Intergenic
923942020 1:238838343-238838365 CTCTGCCATGTCAGGCTATAAGG - Intergenic
1062890943 10:1059340-1059362 CTCTGTCTCCCCAGGCTGGAGGG - Intronic
1064569912 10:16682180-16682202 CTCTGACTCCACACTCTATAGGG + Intronic
1064796373 10:19016285-19016307 CTCTGACACCAAAGCCTATGTGG - Intergenic
1067712283 10:48658752-48658774 CCCTGACACCCCAGGAGAGAGGG + Intergenic
1070189791 10:74101450-74101472 CTCTGTCACCCCAGGCTGGAGGG - Intronic
1070643218 10:78183818-78183840 CTCTGACACCCCTGACAATGGGG - Intergenic
1070834168 10:79437582-79437604 CTCTGACTCCCCTTCCTATAGGG - Intronic
1072537996 10:96377861-96377883 CTCTGACACCCCCTGCTGTTGGG + Intronic
1073054106 10:100688236-100688258 CTCTGACACACCAGCCGGTAAGG - Intergenic
1073106833 10:101036968-101036990 CTCACACACCCCAGGCTCAAAGG - Intronic
1073184506 10:101607611-101607633 CTCTGAGTCCCCAGGGCATAGGG + Intronic
1074189709 10:111125094-111125116 CTCTGACTCCCCTTGCTATGAGG + Intergenic
1075346186 10:121683451-121683473 CTCACACACTCCAGGCTATTTGG - Intergenic
1076094663 10:127721215-127721237 CTCTGCCACCCCAGTCCATGAGG - Intergenic
1076311809 10:129513452-129513474 CTCTGACACACCTGGTTATTTGG + Intronic
1079625960 11:22618060-22618082 CACTGCCACCCCAGGCCATGAGG + Intergenic
1082274833 11:50209927-50209949 CTCTGACAACCCAGGATGCATGG + Intergenic
1086943093 11:92818231-92818253 CTCTAAAACTCCAGTCTATAAGG + Intronic
1088813411 11:113406358-113406380 CTCTGACACCCCTGGCCCTGGGG + Intergenic
1096100706 12:48969239-48969261 CTCTGCTACCCCAGGATCTAGGG + Intronic
1096489189 12:52004515-52004537 CTCTGAAATCCCAGGATTTAAGG + Intergenic
1096742893 12:53707171-53707193 CTCTGTCACCCAAAGCTGTAGGG + Intergenic
1100360751 12:93877625-93877647 CACTGCCACTCCAGGCCATAAGG + Intronic
1105413183 13:20188629-20188651 CACTGAGACCCCAGGCTGTTAGG - Exonic
1105542586 13:21327809-21327831 CACTGACACCCCAGGCTCCTGGG - Intergenic
1107488834 13:40859994-40860016 CTCTGCCACCACAGGCTGGAGGG - Intergenic
1110739944 13:78983085-78983107 CTACTACACCCCAAGCTATAGGG - Intergenic
1115821039 14:37212445-37212467 CACTGCCACCCCAGGCCATGAGG - Intronic
1116161091 14:41267736-41267758 CTCTGAGACCCTTGGCCATAGGG + Intergenic
1116233306 14:42246289-42246311 CTCTGTCACCCCAGGCTGGAGGG + Intergenic
1116572953 14:46541177-46541199 CTACTACACCCTAGGCTATATGG - Intergenic
1121716630 14:96080785-96080807 CTCAGCCACCCCATGCTACATGG + Intronic
1121803319 14:96793644-96793666 CTCTGCCACCCCAGGCTGATGGG - Intergenic
1122488126 14:102095241-102095263 CTCTGAGATCCCAGGCTTTCTGG - Intronic
1124799808 15:32821484-32821506 CTCTGTCACCCCAGGCTGGAGGG + Intronic
1125394195 15:39229058-39229080 TTCTGCCATCCCAGGATATATGG + Intergenic
1126503851 15:49380155-49380177 CACTGACACCCCAGGCCATGGGG + Intronic
1127009466 15:54606759-54606781 GTTTGACACCACAGGCTGTAGGG - Intronic
1127600419 15:60530235-60530257 CTGTGCCATCCCAGGTTATAAGG - Intronic
1129869814 15:78933057-78933079 CCCTGACACCCCAGACTCTGGGG + Intronic
1129926376 15:79368008-79368030 CACTGAGACCCCAGGCAATGGGG - Intronic
1129972109 15:79788008-79788030 CTCTGACCCGCCAGGCTGTAAGG - Intergenic
1130444963 15:83992133-83992155 CTCTGTCACCCTAGGCAATCAGG - Intronic
1130581126 15:85137492-85137514 TTCTGACACCCCAGGCCCAAAGG + Intronic
1132371276 15:101301103-101301125 TCCTGACACCCCAGGCTTTGTGG - Intronic
1132833457 16:1941096-1941118 AGCTGCCACCCCAGGCTATCGGG - Intronic
1135110698 16:19688650-19688672 ATCTGAACCCCCAGGCTAAAGGG - Intronic
1136511012 16:30738367-30738389 CTCAGAGACCCCAGGCACTAGGG - Exonic
1137558353 16:49487595-49487617 GTCAGACACCCCAGGCTGGAAGG + Exonic
1137704366 16:50524018-50524040 CTCTTACACCCCAGGATAGGAGG - Intergenic
1138543056 16:57700000-57700022 CTCTGCCACCCCAGGTCATGTGG + Intronic
1140515136 16:75535785-75535807 CTTTGACATCCCCGGCTAAAAGG - Intronic
1140541055 16:75756728-75756750 CTCTGCCACACCAGCCCATATGG + Intronic
1141483250 16:84321110-84321132 CTGTGGCAGCCCAGGCTATCTGG - Intronic
1143096639 17:4481761-4481783 CATTGACACCCCAGGCTATAAGG + Intronic
1143583081 17:7837548-7837570 ATCTGACAGCCCAAGCTCTAAGG - Intergenic
1145810154 17:27759613-27759635 TTCTGACACCCCAGGCTCAGGGG + Intronic
1147456176 17:40539576-40539598 CTCTGGCACCCCTTGCTTTAGGG + Intergenic
1150247826 17:63689450-63689472 CTGAGACACCCCGGGCTACAAGG - Intronic
1154332492 18:13441242-13441264 CACTAACACCCGAGGCTCTAAGG - Intronic
1161570534 19:5028314-5028336 GTGTTACACCCCAGGCTACAGGG - Intronic
1162763118 19:12900280-12900302 CTCAGACACACCATGTTATAGGG + Intronic
1163737908 19:18992733-18992755 CTCTGACACCCCAGGATTAGGGG - Exonic
1164203478 19:23038698-23038720 CTCTAACATCCCAGGAGATAAGG - Intergenic
1165061289 19:33206492-33206514 CCCAGACACCCCAAGATATAGGG - Intronic
1165143944 19:33719658-33719680 CCCAGACACCCCAGGCTGTCTGG + Intronic
1165354290 19:35294038-35294060 CTCTGACACCCCAGCTTGGAGGG + Intronic
927583561 2:24278220-24278242 CTCTGACACTGCAGGGAATAGGG - Intronic
931797315 2:65723544-65723566 TTCTTACACCCCAGGCTAGAGGG + Intergenic
932528025 2:72493975-72493997 CTCTGTCACTCCAAGTTATAAGG + Intronic
932883617 2:75527427-75527449 CTCTGACACCCCAGTGGAGAGGG - Intronic
937552143 2:123107577-123107599 CACTGCCACCCCAGGTTATGAGG + Intergenic
937790972 2:125961294-125961316 CTCTTACACACCATGCTATGAGG - Intergenic
939164781 2:138628676-138628698 CTCTGGCACCACAGGGAATAAGG + Intergenic
941225840 2:162847557-162847579 CTATGACAACATAGGCTATATGG - Intergenic
942460318 2:176163798-176163820 CTCTGACCCACCTGGCTAGAGGG + Intronic
942783343 2:179671943-179671965 CTCTACCACCCCAGGGTATCAGG - Intronic
943118910 2:183710007-183710029 CACTGCCACCCCTGGCCATAGGG + Intergenic
943151049 2:184113529-184113551 CCCTGACACACCATGCTACAAGG - Intergenic
943226740 2:185187803-185187825 CTCTGCCACCACAGGCTGTGAGG + Intergenic
944510067 2:200455899-200455921 CCCAGACACCCCAGGCTTTGTGG + Intronic
944537187 2:200722808-200722830 CTCTGCCACTGCAGGCTATGTGG - Intergenic
948873062 2:240813270-240813292 CTCTGAGACCCCATGGGATAGGG + Intronic
1169091330 20:2862961-2862983 CCCTGCCACCCCTGGCTGTAGGG - Intronic
1172651722 20:36507792-36507814 ATCTGAAGCCCCAGGCTGTATGG - Intronic
1173924572 20:46771260-46771282 TGCTGACACCCCAGGCTGGAGGG + Intergenic
1183514321 22:38255056-38255078 CTCTGTCGCCCCAGGCTGGAGGG + Intronic
1183755721 22:39762327-39762349 TTTTGACACTCCAGGCTATGAGG + Intronic
1185129017 22:49027063-49027085 GTCTGAGCCCCCAGGCTCTATGG + Intergenic
1185141613 22:49105667-49105689 CTCTCCCACCCCAGGCTGCAAGG - Intergenic
1185153860 22:49181765-49181787 CTCTGGCACCCCAGGCTTTCTGG + Intergenic
949235292 3:1801877-1801899 CGCTGTCACCCCAGGCTGCAGGG + Intergenic
950213499 3:11141017-11141039 CTCTGTCATCCCAAGCTATGAGG + Intronic
951251597 3:20400399-20400421 CTCTGACACCCTAGGCCCTCAGG + Intergenic
951352875 3:21628218-21628240 CTCTGACACCATGGGCTTTAAGG + Intronic
962688416 3:137869155-137869177 CACTGCCACCTCAGGCCATAAGG - Intergenic
964318170 3:155465851-155465873 CACTGCCACCCCAGGCCATGAGG - Intronic
965016713 3:163167804-163167826 CACTGCCACCCCAGGCCAAAAGG + Intergenic
967072938 3:185977515-185977537 CTCTGGCACCACAGACTGTAGGG + Intergenic
970363141 4:15330364-15330386 CTTTGACACACCAGAATATATGG - Intergenic
975216294 4:71760075-71760097 CTCTGTCGCCCCAGGCTGGAGGG + Intronic
978467007 4:109018681-109018703 ATCTCAGACCCCAAGCTATAAGG + Intronic
978781502 4:112559834-112559856 CTCTTACCCACTAGGCTATATGG + Intronic
979413512 4:120407147-120407169 CACTGCCACCCCAGGCCACAAGG - Intergenic
981489851 4:145327829-145327851 CTCTGACTCCCCATGTGATATGG - Intergenic
985675594 5:1229879-1229901 CTCTCACAGCGCAGGCTAAAGGG + Intronic
985713365 5:1442502-1442524 CTCTGCCACTCCAGGCTCCAGGG + Intronic
985808497 5:2066055-2066077 CTCTGACACTCCAGGGTCTGAGG + Intergenic
986266817 5:6197798-6197820 CTCTGATACCCCAGGAGAAATGG - Intergenic
986989516 5:13535310-13535332 CTCTGACACCACAGGGAACATGG - Intergenic
988050837 5:26029447-26029469 CTCTGTCTCCCCAGGCTGGAGGG + Intergenic
988919264 5:35925593-35925615 CCCTGGCACCCCAGGCTCTTTGG - Intronic
989780054 5:45254009-45254031 CTAAGTCACCCCAGGCTATCTGG - Intergenic
989996863 5:50845261-50845283 TTCTGAAACCCCATGCTCTAAGG - Exonic
992185392 5:74239461-74239483 CTCTGTCACCACAGGCCATGTGG + Intergenic
994159963 5:96546405-96546427 TTCTGACACACCTAGCTATAAGG - Intronic
994396996 5:99233384-99233406 CTCTGCCACCCCTGGATATTAGG - Intergenic
994428695 5:99628034-99628056 CACTGCCACCCCAGGCCACAAGG + Intergenic
996317176 5:122173251-122173273 CTCTGATAGCACAGGCTAAAAGG - Intronic
997516243 5:134491886-134491908 TTCTGACCCCCCAATCTATAGGG + Intergenic
998037684 5:138930726-138930748 CTCAGACAGCCCAGGCCATGGGG + Intronic
1003409424 6:5850007-5850029 CACTGACACCCCAGGCTCCTGGG + Intergenic
1006914538 6:37585836-37585858 CTCTGAGACCCCAGGCTCCAGGG - Intergenic
1007422532 6:41728377-41728399 CTCTGACACCCCCAGCTCTACGG + Intronic
1009728596 6:67567483-67567505 CTCTGACACCTCAAGTTAGAAGG - Intergenic
1010625362 6:78131716-78131738 CTCTGCCACCCCAGGCCACAAGG - Intergenic
1012620511 6:101339165-101339187 CCCTGCCACCCCAGGCCATGAGG + Intergenic
1013331657 6:109108188-109108210 CTCTGACACCAAAGCTTATAAGG + Intronic
1013807101 6:114008139-114008161 CTCTAAAACCCCAGACTTTATGG - Intronic
1016643769 6:146380418-146380440 CACTGCCACCCCAGGCCATAAGG + Intronic
1018180495 6:161218750-161218772 CTCTGCCACCTCAGAGTATATGG - Intronic
1019300636 7:301796-301818 CTCTGCGAGCCCAGGCTTTACGG - Intergenic
1019973187 7:4558585-4558607 CTGTGGCACCCCAGGCTCCAAGG + Intergenic
1021188983 7:17598537-17598559 CTCTGAGAACCCACGCTACATGG + Intergenic
1025215915 7:57056083-57056105 CTCTGACAACCCAGGATGCATGG + Intergenic
1025655465 7:63514619-63514641 CTCTGACAACCCAGGATGCATGG - Intergenic
1028242847 7:88442469-88442491 GTGTGATACCCCAGGCTTTAAGG + Intergenic
1028339083 7:89695400-89695422 CACTGCCACCCCAGGCCATGAGG - Intergenic
1032466349 7:132148038-132148060 CTCTGCCACTCCAGGAAATAAGG + Intronic
1033262937 7:139859234-139859256 CTCTGTCACCCCAGGCTGGCTGG + Intronic
1034996147 7:155578327-155578349 CTCTCACACTCCAGGCTCTCTGG + Intergenic
1038871845 8:31503787-31503809 CACTGCCACCCCAGGCCATAAGG + Intergenic
1039535240 8:38304898-38304920 CTCTGTCATCCTATGCTATATGG + Intronic
1040442273 8:47456158-47456180 CCATTACACCTCAGGCTATATGG + Intronic
1042356209 8:67830800-67830822 CACTGACACTCCAGGCTTCAAGG + Intergenic
1047546451 8:125822084-125822106 CTCTCTCTCCCCAGCCTATATGG + Intergenic
1047952367 8:129945600-129945622 CTCTGTCGCCCCAGGCTGGAGGG + Intronic
1049317618 8:141977611-141977633 CCCAGCCACCCCAGGCTCTAAGG + Intergenic
1052943038 9:34145512-34145534 CTCTGTCACCCCAGGCCCTCTGG - Intergenic
1053442246 9:38126086-38126108 CGCACACACCCTAGGCTATAAGG - Intergenic
1055360869 9:75488892-75488914 CTCTGACACACCAGGCAAGCTGG + Intergenic
1055814450 9:80187936-80187958 CTCTGTCACCCCAGGCTGGAAGG + Intergenic
1060670451 9:125464644-125464666 CTCTGAGACCCCAGCCTAAGAGG + Intronic
1060956133 9:127641548-127641570 CTTTGCCTCCCCAGGCTACAAGG + Intronic
1061040753 9:128139364-128139386 CTCTTACCCCCCTGGCTCTAAGG - Intergenic
1061246414 9:129403104-129403126 CTCTGAGAACCCAGGTTGTAGGG - Intergenic
1061578474 9:131522516-131522538 TTCTGACACCCCAGGCTCCTGGG - Intronic
1187092686 X:16113872-16113894 ACCAGACCCCCCAGGCTATAAGG - Intergenic
1190054667 X:47174698-47174720 CTCTGTCACCCCAGGCTGGCTGG + Intronic
1190748560 X:53341514-53341536 CTCTGACACCCCAGGCTATATGG + Intergenic
1194274765 X:91865775-91865797 CACTGCCACCCCAGGCCACAAGG + Intronic
1194495541 X:94613068-94613090 CACTGTCACCCCAGGCCATAAGG + Intergenic
1196877691 X:120169944-120169966 CACTGACACCCCTGGCCACAAGG + Intergenic
1198138703 X:133781198-133781220 CTCTGGCAACACAGGCTAGAAGG + Intronic
1199439602 X:147853882-147853904 CACTGCCACCCCAGGCCATGAGG + Intergenic
1199546045 X:149008162-149008184 CTCTGACACCACTGGCTACATGG - Intergenic