ID: 1190752599

View in Genome Browser
Species Human (GRCh38)
Location X:53375253-53375275
Sequence CAGGACAGGCAGAGGTGGTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 403}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190752599_1190752606 28 Left 1190752599 X:53375253-53375275 CCTGACCACCTCTGCCTGTCCTG 0: 1
1: 0
2: 3
3: 50
4: 403
Right 1190752606 X:53375304-53375326 ACTCCAGAGATGACATAGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190752599 Original CRISPR CAGGACAGGCAGAGGTGGTC AGG (reversed) Exonic
900089466 1:913554-913576 ATGAACAGGCAGAGGGGGTCAGG - Intergenic
900600424 1:3500408-3500430 CAGGAAAGGCAGAGGAAGCCAGG + Intronic
900830299 1:4960638-4960660 CTGGACAGTCAGAGGTTGTCTGG + Intergenic
901063900 1:6485801-6485823 CGGGCCAGGCAGAGGTGGGAAGG - Intronic
901324825 1:8360066-8360088 CGGGTCAGGCACAGGTGGGCTGG - Intronic
901644708 1:10710211-10710233 CAAGACAGGCAAAGGTGGGCTGG - Intronic
901666445 1:10828821-10828843 CAGGAGAGGCAGGGGCGGCCTGG - Intergenic
901750033 1:11400402-11400424 CTGGACAGGGAGAGGTGGGACGG + Intergenic
902041635 1:13496843-13496865 AAGGAGAGCCAGAGGTGGTGGGG + Intronic
902172172 1:14620952-14620974 CAGGACAAGCAGAGATGATGAGG - Intronic
902268752 1:15288126-15288148 CAGCACAGGCAGTGGTGGACAGG - Intronic
902578891 1:17396041-17396063 GTGGACAAGCAGAGGTGGTGTGG + Intronic
902607116 1:17574904-17574926 CAGGACAGGCAGAGGACACCAGG + Intronic
902754045 1:18537533-18537555 CAGGAAAGGCAGCGGTGGATGGG - Intergenic
903358948 1:22765017-22765039 GAGGACAGGCAGGGGTGCTGAGG + Intronic
903542134 1:24102377-24102399 CAGGAAAAGCAGAGCTGGCCAGG - Intronic
904364517 1:30001869-30001891 CAGACCAGGCAGAGATGCTCTGG - Intergenic
904371206 1:30048556-30048578 CAGCTCAGGGAGAGGTGGACAGG - Intergenic
904495861 1:30886204-30886226 CTGGCCAGGCAGAGATGGTGGGG - Intronic
904501271 1:30914122-30914144 CAGCAAAGTCAGAGGTGGACTGG + Intergenic
904826391 1:33276313-33276335 GAGGACGGGCTGAGGAGGTCTGG - Intronic
905238998 1:36570623-36570645 GCGGTCAGGCAGAAGTGGTCCGG - Intergenic
905272462 1:36795947-36795969 CGGCCCAGGCAGAGGTGGGCTGG + Exonic
905924402 1:41739578-41739600 CAAGAGAGGCAGAGGGGGTGGGG - Intronic
906228963 1:44144185-44144207 CAGGCCAGGCACAGTGGGTCAGG + Intergenic
906611781 1:47208802-47208824 CAGGACAGGCGGTGGTTGCCTGG - Intergenic
906798302 1:48714765-48714787 GAGGACCTGCACAGGTGGTCGGG - Intronic
907115256 1:51962483-51962505 CAGGACAGACAGTGGTTGTGTGG - Intronic
907243428 1:53092979-53093001 AAGGAGTGGCAGAGGTTGTCTGG - Intronic
907413780 1:54300291-54300313 CAGCACAGGAAGAGCTGGCCTGG + Intronic
907467257 1:54646808-54646830 CAGGACAGAGAGAGGTTGCCAGG - Intronic
908310951 1:62882688-62882710 CAGGACAGGACGAGGGGATCAGG + Intergenic
910451969 1:87356348-87356370 CTGGACAGGCTGACTTGGTCAGG - Intergenic
912794949 1:112687618-112687640 CAGGAGGAGCAGAGGTGGGCAGG - Intronic
913054069 1:115141309-115141331 GAGGCCAGGGAGGGGTGGTCTGG + Intergenic
913074575 1:115331015-115331037 CAGGAAAAGCACAGGAGGTCTGG - Intronic
913274532 1:117123924-117123946 AAGGAAAGGTAGAGGTGGCCAGG - Intergenic
914754550 1:150555287-150555309 CAGCACAAGCTGAGGTGGTCAGG - Intronic
917641519 1:176987560-176987582 CAGGAGAGGCAGAGAGGGTGAGG - Intronic
918356551 1:183710382-183710404 CAGGAAAGGCACTGGTGGTAAGG + Intronic
919530250 1:198708887-198708909 CATGACAGACAGATGTGCTCAGG + Intronic
920098761 1:203503449-203503471 CAGAGCAGGCAGAGCTGGTAGGG + Intronic
921030407 1:211331104-211331126 CAGGACTGGCTGAGGGGGACAGG - Intronic
922455937 1:225773553-225773575 CAGGGGAGGCAGAGGAGGTCAGG + Intergenic
922665314 1:227464151-227464173 CAGGACAGGCACAGAAGGTCGGG + Intergenic
922702415 1:227769637-227769659 CAGGACAGGCAGGGGTGACACGG + Intronic
924080754 1:240395117-240395139 CAGCACAGGCAGAGGAGATTTGG - Intronic
924740159 1:246790206-246790228 CAGGACAGGCAGATGGGGATTGG - Intergenic
1062901492 10:1150170-1150192 CAGAAGAGGCAGAGGTTGTTGGG - Intergenic
1064436416 10:15314853-15314875 CAGGCCAGGCCGAGGTGGCAGGG - Intronic
1066212605 10:33254687-33254709 GAAGTCAGGAAGAGGTGGTCTGG - Intronic
1066253490 10:33656245-33656267 CAGGACTGGCTGGGGTTGTCTGG - Intergenic
1066654510 10:37685851-37685873 CAGGCCAGGGAGAGGTGGACAGG + Intergenic
1067224068 10:44363968-44363990 TGGGACAGGCACAGCTGGTCTGG - Intergenic
1067228075 10:44388180-44388202 CAGGCCAGGCAGAGGGGGGTAGG - Intergenic
1068129255 10:52876995-52877017 CAGGTAAGAAAGAGGTGGTCAGG - Intergenic
1068595197 10:58895674-58895696 CTGGAGAGACAGAGGTGGCCAGG + Intergenic
1069071952 10:63998438-63998460 CAGGACAGACTGAGGTGCTCTGG + Intergenic
1069843707 10:71356046-71356068 GAGGACACGCAGAGATGGTGAGG - Intronic
1069954861 10:72043727-72043749 TATGAAAGGCAAAGGTGGTCAGG + Intergenic
1070442704 10:76462622-76462644 CAGCACAGGCAAAGATGGTGCGG - Intronic
1070598586 10:77849722-77849744 CAGGAAAGGGAGAGGGGGACAGG + Intronic
1070626395 10:78054147-78054169 CTGGGCAGGCAGAGGAGGGCTGG + Intronic
1072419494 10:95277834-95277856 CAGGACTGGCAGCAGTGGACAGG - Intronic
1072610217 10:97012864-97012886 CAGGCCAGCAAGGGGTGGTCAGG - Intronic
1073123999 10:101138845-101138867 CAGGTCTGGCAAGGGTGGTCTGG - Intergenic
1073240708 10:102056025-102056047 CAGGACCCGCAGGGTTGGTCAGG + Intronic
1073301490 10:102473704-102473726 CACAGCAGGCTGAGGTGGTCCGG - Exonic
1075121145 10:119665965-119665987 CAGGACAGGCAAGGGCGGCCTGG - Intronic
1075159295 10:120009403-120009425 AAGGAGAGCCAGAGGTGGCCAGG - Intergenic
1075558359 10:123449459-123449481 CAGGCCAGGCCGAGGTGGGCTGG + Intergenic
1075647651 10:124107249-124107271 CAGGACAGGCAGGGGTGGGCCGG - Intergenic
1075723299 10:124599474-124599496 CGGGACTGGCAGAGGGGGCCTGG - Intronic
1075810693 10:125222641-125222663 CAGGTGAGGCAGAGGTTGTCAGG + Intergenic
1076451987 10:130562331-130562353 CAGTACAGGCAGACCTGGGCAGG + Intergenic
1076674818 10:132142360-132142382 CAAGAGTGGAAGAGGTGGTCTGG - Intronic
1076816755 10:132918855-132918877 CAGAACGGGCACAGGGGGTCTGG - Intronic
1076934658 10:133559389-133559411 CAGGGCAGGCAGAGTTGGGGCGG + Intronic
1076946643 10:133656280-133656302 CAGCACAGGCAGCGGGGGACAGG + Intergenic
1077099855 11:817692-817714 CAGGACAGGCGAAGATTGTCGGG - Intergenic
1077161022 11:1112932-1112954 CTGGTAAGGAAGAGGTGGTCAGG + Intergenic
1077232775 11:1465529-1465551 CTTGAGAGGCAGAGATGGTCTGG - Intergenic
1079645549 11:22860444-22860466 CAGGACAGGCAGTAGGCGTCAGG - Intergenic
1081645937 11:44790864-44790886 CAGGACAGGGTGACGTGGTGAGG + Intronic
1082944004 11:58739268-58739290 GAGGACAGGCAGAGATGAACAGG + Intergenic
1083684452 11:64368223-64368245 CAGGTCGGGCAGCGGTGGCCAGG + Exonic
1083802237 11:65053367-65053389 GAGGAGAGGGAGAGGTGGGCAGG + Intronic
1083996357 11:66274948-66274970 CACCTCAAGCAGAGGTGGTCTGG + Intronic
1084438159 11:69156038-69156060 CTGGACTGGCAGAGGCTGTCTGG - Intergenic
1084593950 11:70106152-70106174 CAGGGCAGGCAGGTGTGGGCAGG + Intronic
1085841473 11:80016185-80016207 CAGGTCTGCCAGAGGTGGACAGG + Intergenic
1087120062 11:94564272-94564294 CAGGCCAGTCAGAGGTTCTCCGG + Intronic
1088096433 11:106106093-106106115 CAGGTGAGGCAGTGGTGGCCTGG - Intergenic
1088625425 11:111727143-111727165 CAGTGCAGGCAGAGGTGGCGAGG - Exonic
1088810534 11:113388572-113388594 CAGTGCAGGCTGAGGAGGTCAGG + Intronic
1089364498 11:117912993-117913015 CTGGACAGGCTGAGGTGGGGTGG + Intronic
1089498709 11:118920677-118920699 CAGGACAAGAAGAGGTGGACAGG + Intronic
1089631423 11:119787026-119787048 CAGGACAGGAAGGGGTGCTCCGG - Intergenic
1092050152 12:5463516-5463538 GTGGACAGGCAGAGATGGTTGGG + Intronic
1092236977 12:6816413-6816435 CAGGCCAGGGAGGGGTGGGCAGG + Intronic
1092563055 12:9636870-9636892 CAGGACGGTCAGAGGTTCTCAGG + Intergenic
1092672826 12:10882780-10882802 CAGGTCAGGCAGAGAGGGGCCGG - Intronic
1092701142 12:11232180-11232202 CAGGTAAGGTAGAGGTGGACAGG + Intergenic
1093000595 12:13991711-13991733 CAGGACAGGAAGAGCAGGTTTGG + Intergenic
1093512175 12:19942388-19942410 TGGGACAGGCAGAAGTGGTACGG + Intergenic
1093655392 12:21688252-21688274 CAGGACGGGCTGAAGTGCTCTGG - Intronic
1093745941 12:22741394-22741416 CCGGAGAGGCAGAGGTTGCCAGG - Intergenic
1096379893 12:51147514-51147536 CAGGATAGGAAGAGGTGGGGGGG + Intronic
1097183753 12:57185353-57185375 GAGGAAAGGCTGAGGTGCTCTGG + Intronic
1097439981 12:59596772-59596794 CAGGACAGGAAGAGGCTGTGAGG + Intronic
1099337815 12:81386512-81386534 CTAGAGAGGCAGAGGTGGGCGGG + Intronic
1100162480 12:91876361-91876383 CAGGAGAGGAAGAGTTGATCTGG - Intergenic
1101433516 12:104645898-104645920 CATGACAGGCAGAGCTGGTGAGG - Intronic
1102011052 12:109618541-109618563 CAGGGCAGGAGGAGGAGGTCAGG + Intergenic
1104092761 12:125529522-125529544 CAGGACACACAGAGGTGGGAAGG - Intronic
1106455293 13:29921465-29921487 CAGGAGAGGCAGAATTAGTCAGG - Intergenic
1107447191 13:40479860-40479882 TAGGACAGGCAGGAGTGGCCAGG + Intergenic
1109269728 13:60241415-60241437 AAGGTCAGGCAGGGGTGGGCTGG + Intergenic
1111020067 13:82437724-82437746 AAGTCCAGGCTGAGGTGGTCTGG + Intergenic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1115961083 14:38836740-38836762 CTAGAGAGGCCGAGGTGGTCCGG - Intergenic
1116672412 14:47860509-47860531 CAGGACAAGGAGTAGTGGTCAGG + Intergenic
1118029597 14:61807532-61807554 GAGGACAGGCTCAGGTGGTCTGG - Intergenic
1120781573 14:88490458-88490480 CAGGGCAGGAAGAGGTGGGAGGG - Intronic
1121113873 14:91330437-91330459 CAGGACAGACAGAGGCAGACTGG + Intronic
1121259506 14:92555909-92555931 TGGGCCAGGCAGAGGTGGCCAGG + Exonic
1121285104 14:92729183-92729205 CAGGATGGGCAGAGGTGCGCAGG - Intronic
1121314753 14:92954243-92954265 CAGGGCAGTGAGAGATGGTCTGG + Intronic
1122266824 14:100550536-100550558 CAGAACAGGCCGGGGTGGGCAGG + Intronic
1122889280 14:104724985-104725007 AAGGAGAGGCAGAGGTGGAAGGG + Intronic
1122977715 14:105177768-105177790 CAGGATGGGCGGAGGTGCTCGGG + Intronic
1123049647 14:105534789-105534811 CAAGACAGGGGGAGGTGGGCAGG + Intergenic
1202920732 14_KI270723v1_random:28834-28856 CAGCACAGGCAGCGGGGGACAGG + Intergenic
1202924186 14_KI270724v1_random:8747-8769 CAGCACAGGCAGCGGGGGACAGG - Intergenic
1124962359 15:34408614-34408636 CAGGACAGCCAGGGGTGCACAGG - Intronic
1124978983 15:34554836-34554858 CAGGACAGCCAGGGGTGCGCAGG - Intronic
1125761878 15:42102417-42102439 GAGGAGAGGCAGAGGGGTTCTGG - Intergenic
1126415732 15:48415883-48415905 TAAGACAGGCAGAGGTGGCTGGG + Intronic
1127604739 15:60574980-60575002 CAGGAGAAGAAGAGGAGGTCTGG + Intronic
1128228160 15:66017214-66017236 CAGGCCTGGCAGAGATGGTCAGG + Intronic
1128256231 15:66199044-66199066 CAGGCCAGGAAGAGGTTGTAGGG - Intronic
1128559892 15:68657932-68657954 CAGGACAGGCAGAACTGCTGTGG + Intronic
1128727775 15:70000511-70000533 CAGGGCAGGCAGAGCTGAACAGG - Intergenic
1129242228 15:74258476-74258498 CAGGACAGGCAGGGCAGGTGGGG + Intronic
1129325842 15:74799957-74799979 CAGGGCTGGCAGAGCTGGCCTGG - Intronic
1129464345 15:75715608-75715630 CAAGACAGTGGGAGGTGGTCAGG - Intergenic
1129719267 15:77869211-77869233 TGGCCCAGGCAGAGGTGGTCTGG + Intergenic
1129720903 15:77877404-77877426 CAAGACAGTGGGAGGTGGTCAGG + Intergenic
1130101790 15:80900039-80900061 CATGCCAGGGAGAGGTGCTCGGG + Intronic
1132926028 16:2429531-2429553 CAGGGCAGGCAGAAGGGGTGTGG - Intronic
1133173938 16:3999538-3999560 GAGGACAGGCATAGCTGCTCAGG - Intronic
1134266350 16:12696229-12696251 CAGGACAGGCGGACCTGGTTTGG - Intronic
1135159699 16:20082830-20082852 CAGGGCAGTCAGAGGTGGATGGG + Intergenic
1135556865 16:23444471-23444493 CAGCACAGGCAGAGAAGGTTGGG - Intronic
1135739102 16:24958007-24958029 AAGGACAGGCAGAGGTGGGAGGG + Intronic
1137541708 16:49367399-49367421 AAGGAGAGGCAGAGTGGGTCTGG - Intergenic
1137566765 16:49538132-49538154 AGGGACAGGCAGAGGGGGACTGG + Intronic
1138115603 16:54358239-54358261 CAGCACAGCCAGACGTAGTCAGG + Intergenic
1138441838 16:57040026-57040048 CATGAGAGGCGGAGGTGGTCTGG - Intronic
1138590774 16:57998629-57998651 CGGGGAAGGCAGAGGTGCTCAGG + Intronic
1140370276 16:74409645-74409667 CAGGCCAGGGTGTGGTGGTCAGG + Intronic
1141203644 16:81915781-81915803 CAGGGCAGGCAGGGGGGCTCTGG - Intronic
1141604681 16:85145994-85146016 CTGGACAGGCAGCTCTGGTCAGG - Intergenic
1142151273 16:88513523-88513545 CAGGAGAGGTAGAGGTGGCCCGG + Intronic
1142309026 16:89301459-89301481 CAGGGCAGGCAGAGCAGGGCAGG + Intronic
1142683141 17:1562089-1562111 CAGGGCAGGGAGAGCTGGCCCGG - Intronic
1143802266 17:9393796-9393818 CAGGTCAGTCAGTGGTTGTCAGG + Intronic
1144703575 17:17353489-17353511 CAGGACAGGCAGAAAGGGTCAGG + Intergenic
1144729535 17:17518545-17518567 CAGTGCATCCAGAGGTGGTCAGG - Intronic
1144950007 17:18988983-18989005 AAGGACAGGATGAGGTGGTATGG + Intronic
1145365840 17:22266271-22266293 TGGTACAGGCAGAGCTGGTCTGG - Intergenic
1145879014 17:28340498-28340520 CAGGGCGGGCAGATGAGGTCAGG + Intronic
1146501916 17:33372069-33372091 CAGGAGAGGCAGAGAGGGTCTGG - Intronic
1147440590 17:40444693-40444715 CAGGGCAGGCAGAGGTGTCCAGG - Intronic
1147477026 17:40721827-40721849 CAGTAGAGGCAGATGTGGTCTGG - Intergenic
1148859426 17:50596357-50596379 CTGGAGAGGCAGAGGTGGTGGGG + Intronic
1151372339 17:73656160-73656182 GAGGAGAGGCAGAGGAGGCCGGG + Intergenic
1151728377 17:75897147-75897169 CGGGCCAGGCCGAGGTGGGCAGG - Intergenic
1152042120 17:77910135-77910157 GAGGACAGGGAGAGGGGGCCTGG - Intergenic
1152104834 17:78322933-78322955 AAGGCCTGGCAGAGATGGTCTGG - Intergenic
1152168471 17:78726624-78726646 CAGTCCAGGCAGAGGTGGAAAGG + Intronic
1152376043 17:79919538-79919560 AGGGACAGGCAGAGCTGGACTGG - Intergenic
1152400697 17:80064773-80064795 CTGGACAGCCAGGGGTGGGCAGG - Intronic
1152691618 17:81720703-81720725 CAGGGCAGGCAGCGGTGCGCGGG - Exonic
1152863577 17:82709559-82709581 CTGGACAGGTAGGGGAGGTCTGG + Intergenic
1152938146 17:83152491-83152513 CAAGACAGGCAGATGGGGCCCGG + Intergenic
1153908797 18:9688166-9688188 GAGGCAAGGCAGAGGTGATCTGG + Intergenic
1155493485 18:26421681-26421703 CAGAAAAGCCTGAGGTGGTCAGG + Intergenic
1156399834 18:36730085-36730107 CAGGAAAGGTGGAGGTGCTCTGG + Intronic
1156570090 18:38243109-38243131 TGGGACAGGTAGAGATGGTCTGG - Intergenic
1156913068 18:42434184-42434206 GAGGACAGGCAAAGGTGGGCAGG + Intergenic
1157545252 18:48541610-48541632 CAGGACACGCTCAGGTTGTCTGG + Intronic
1157813781 18:50716773-50716795 CAGGGCAGGCTGAGGAGGTGGGG - Intronic
1160242039 18:77131790-77131812 CAGGACAGGCAGTGGGGCCCAGG + Intronic
1160682255 19:417202-417224 AAGGAGAGGCAGCGGTGGTTCGG + Exonic
1160979934 19:1812191-1812213 CAGGAGAGGCAGGGGGGGGCAGG + Exonic
1161118361 19:2511901-2511923 CAGGGGAGGCGGAGCTGGTCCGG + Exonic
1162063599 19:8111356-8111378 CAGGGAGGGGAGAGGTGGTCTGG + Intronic
1162493256 19:11007776-11007798 CAGGATAGGTAGAGGGGGTGAGG + Intronic
1163021485 19:14483010-14483032 CAGGACAGGAAGTGGGGCTCAGG + Intronic
1163699116 19:18778252-18778274 AGGTACAGGCAGAGGTGGCCAGG + Exonic
1164279800 19:23759366-23759388 CAGGCCTGGGAGAGGTGGTGGGG + Intergenic
1164838189 19:31372250-31372272 CAGGACAGTCAGAGCTGCTCTGG + Intergenic
1165314455 19:35046137-35046159 CAGGACAGGCAGGGGTCAGCCGG + Intronic
1165326020 19:35115190-35115212 CAGGACAGGAAAAGGGGGTTTGG - Intergenic
1165490443 19:36120305-36120327 CAGAACAGGAAGAGATGCTCTGG + Intronic
1167490618 19:49790872-49790894 CTGGACAGGCCGAAGGGGTCCGG + Intronic
1167520403 19:49951344-49951366 ATGGACAGGAAGAGGTGCTCAGG - Intronic
1167621443 19:50563201-50563223 CATGGCAGGCAGAGGTGGAGGGG - Intronic
1167649533 19:50721810-50721832 CAGGGTAGGTAGAGGTGGTGAGG - Intergenic
1168148365 19:54431711-54431733 CTGGACAGGCAGGGGTGGGCAGG + Intronic
925294439 2:2768066-2768088 CAGGACAGGCACAGGTGAGGAGG - Intergenic
925326557 2:3026557-3026579 AAAGACAGGCAGAGGTGTGCAGG + Intergenic
925411612 2:3642994-3643016 CAGGAATGGAAGAGGTGGTGGGG - Intronic
926107402 2:10160850-10160872 CAGGGCAGACAGAGGTGGCCAGG - Intronic
926704426 2:15826615-15826637 CAGCCCAGGGAGAGGTGGACAGG + Intergenic
927707153 2:25303494-25303516 CAGGACCTGGAGAGGTGGCCTGG - Intronic
928133201 2:28668403-28668425 TGGGACAGGCAGACCTGGTCAGG - Intergenic
928550682 2:32367586-32367608 CAGGACAGGCAGATCAGTTCAGG + Intronic
928792987 2:34981077-34981099 CAGGACATGCACAGGTGGAGAGG + Intergenic
930917846 2:56715692-56715714 CAGGATTGTCAGAGGTTGTCAGG - Intergenic
932403870 2:71500643-71500665 CAAGGGAGGCAGAGGAGGTCTGG + Intronic
933151460 2:78919983-78920005 CAGTACAGACAGACGTGGTCAGG - Intergenic
933239638 2:79905695-79905717 GAGGACAGGCAGAGCTGGTATGG + Intronic
934736991 2:96694495-96694517 CAGGACAGGCGGGGGTGGTCTGG + Intergenic
937963776 2:127485056-127485078 GGGGACATGGAGAGGTGGTCAGG + Intronic
938467391 2:131532647-131532669 CAGGGCAGGCAGATGGGGGCGGG + Exonic
940015890 2:149103647-149103669 CAGGGCAGGCAGAGATGGGTGGG - Intronic
940533441 2:154908287-154908309 AATGATAGGGAGAGGTGGTCAGG + Intergenic
940932154 2:159445708-159445730 CAGGAGATCCAGTGGTGGTCAGG - Intronic
944159073 2:196639860-196639882 CAGGACAGGGAGAGGGCGCCAGG - Intronic
946498422 2:220219473-220219495 CAGCACAGGCAGATGTGCCCTGG - Intergenic
948460995 2:238129950-238129972 CAAGACGGGCAGAGCAGGTCAGG + Intronic
948550258 2:238766142-238766164 CTGGGCAGGGGGAGGTGGTCAGG - Intergenic
948614014 2:239186748-239186770 GAGGAGAGGCAGAGGGGTTCTGG + Intronic
949003695 2:241633244-241633266 CAGGAGGGGCAGAGGGGCTCTGG + Exonic
1169768222 20:9172431-9172453 CAGGAAAGGGAGAGATGGACAGG - Intronic
1169947005 20:10999777-10999799 CAGAACTGGCAGAAGTGGACAGG - Intergenic
1171191682 20:23163494-23163516 GAGGACCTGCAGGGGTGGTCAGG + Intergenic
1171500610 20:25589929-25589951 CAGGAGAGGCCGAGGTGGGTGGG + Intergenic
1171967564 20:31542105-31542127 CAGCACAGGCTGAGGTTCTCAGG + Intronic
1172241013 20:33412481-33412503 CAGGGCAGGGTGAGGTGGCCAGG + Intronic
1172663205 20:36581517-36581539 CAGGACAGGGTGAGGTGCACTGG - Intronic
1172785593 20:37466314-37466336 CAGGAAAGGGAGAGGAGGTCCGG - Intergenic
1173746354 20:45440266-45440288 CATGACAGGAAGTGGGGGTCGGG + Intergenic
1174446116 20:50592497-50592519 CGGGACAGGCCAAGGTGGTCCGG - Exonic
1174449348 20:50609976-50609998 CAGGTGAGGCAGGGGTGGTAGGG - Intronic
1174669834 20:52296785-52296807 CAGGGCAGGAAAAGATGGTCAGG + Intergenic
1175893733 20:62326974-62326996 CAGGACAGACAGAGGTGACCTGG + Intronic
1175998023 20:62820031-62820053 CAGAGCAGCCAGAGGTGGCCAGG - Intronic
1176032071 20:63017488-63017510 CAGGACTTGCAGAGGGGGCCTGG + Intergenic
1176074005 20:63240293-63240315 CAGAACAGGCAGAGAGGGGCAGG - Exonic
1176130082 20:63493084-63493106 TAGGGCAGGCAGAGCTGGCCAGG + Intronic
1176294034 21:5061088-5061110 CAAGACAGACAGAGGAGGTGAGG + Intergenic
1178317753 21:31580999-31581021 CTGGACAGACGGAGATGGTCTGG + Intergenic
1178422494 21:32453337-32453359 CATCACAGGCATAGGTGGTGTGG - Exonic
1178582133 21:33846236-33846258 CAGGAAAGGCAGGGGAGGTGGGG - Intronic
1179863225 21:44202560-44202582 CAAGACAGACAGAGGAGGTGAGG - Intergenic
1180090478 21:45531323-45531345 CGGGGCAGGCGGAGGTGGACGGG + Intronic
1180672488 22:17564231-17564253 CAGGGCAGGCTGAGGTGGTGGGG - Intronic
1180901244 22:19374888-19374910 GAGGAGAGGCAGATGTGGGCTGG - Intronic
1180955119 22:19738029-19738051 CAGGACCGAGAGAGGTGGCCCGG + Intergenic
1181584347 22:23844945-23844967 CAGGCCAGGCAGAGGTGTGTCGG + Intergenic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1182172305 22:28244172-28244194 GAGGACAGGCAGAGTTGGGCGGG + Intronic
1183623881 22:38990095-38990117 CAGGAAAGGCTGAGGGGGCCAGG + Intronic
1183675465 22:39296878-39296900 CAGAACAGGCTGGGGTGGGCTGG - Intergenic
1183773611 22:39947927-39947949 GAGGTCAGGCAGAGGGGGTCTGG - Intronic
1184117052 22:42428289-42428311 AGGCACAGGCAGAGGTGGGCGGG - Intronic
1184687993 22:46105016-46105038 CAGGAGAGGCCGAGGGGCTCTGG - Intronic
1185333710 22:50262416-50262438 CAGGACAGGCAGGGGTGGGATGG - Intergenic
949563555 3:5224785-5224807 CAGGAGTGGCAGAGGTGGAAGGG + Intergenic
950161851 3:10766151-10766173 CAGGGCAGGCAGTGGTAGTCAGG + Intergenic
950603083 3:14052714-14052736 CAGAAAAGGCAGAAGTGTTCAGG - Intronic
950722259 3:14891701-14891723 CAGGACAGGATGAGTTGTTCAGG + Intronic
951194083 3:19804408-19804430 CAAGACAGGCAGGGCTGGACTGG - Intergenic
951950118 3:28190822-28190844 CTGGACATTCAGAGGTGGACAGG + Intergenic
952576674 3:34782565-34782587 CAGGACAGATGGAGGTGCTCTGG + Intergenic
953782811 3:45886482-45886504 CAACACAGGCAGGGGTGGCCTGG + Exonic
954389515 3:50261267-50261289 CAGGACATGCAGAGCTGGGCAGG + Intergenic
959472837 3:106773730-106773752 CAGGGCAAGCAGAGGAGGTGGGG + Intergenic
960938131 3:122915772-122915794 CAGGACAGGCGGTGATGTTCTGG + Exonic
961010254 3:123430723-123430745 CAGGACAGGGAGATGTCCTCAGG - Intronic
961121255 3:124373096-124373118 CAGGACAGGGGGAGGAGGTTAGG - Intronic
961647365 3:128399838-128399860 GAGGACAGGCAGAGGCGATGAGG - Intronic
961823519 3:129587160-129587182 CAGGCCAGGCTGATGGGGTCAGG + Intronic
962222872 3:133578666-133578688 CAGGCCAGGCATAGCTGATCAGG + Intronic
962733679 3:138305187-138305209 CACAGCAGGCAGAGGTGGCCAGG - Intronic
963045115 3:141096458-141096480 CAGGACAGGGAGAGCTGTCCTGG - Intronic
966248226 3:177832250-177832272 CAGGAGAGGTGGAGGAGGTCAGG + Intergenic
966529759 3:180963044-180963066 CGGAAGAGGCAGAGGTCGTCGGG + Exonic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967253285 3:187564795-187564817 CAGGACAGTCAGAGAAGTTCTGG - Intergenic
968089116 3:195889115-195889137 TAGGAGAGGCTGGGGTGGTCAGG - Intronic
968359698 3:198138421-198138443 CAGGACAGACACAGGCGGACAGG + Intergenic
968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG + Intergenic
968992480 4:3924220-3924242 CATCACAGGCATAGGTGGTGTGG + Intergenic
969508923 4:7606029-7606051 CACGTCAGGGAGAGGTGCTCTGG + Intronic
969822870 4:9733402-9733424 CATCACAGGCATAGGTGGTGTGG - Intergenic
969895271 4:10298182-10298204 CAAGGCAGGCAGAGGTGTTGTGG - Intergenic
971232002 4:24807622-24807644 CAGGACTCCCAGTGGTGGTCTGG - Exonic
972715265 4:41639874-41639896 AAGGATAGGCAGAGGAGGACTGG - Intronic
972761252 4:42106589-42106611 CAGCACAGTCACAGGTGGTACGG - Intergenic
973840051 4:54852220-54852242 CAGGCAAGGCAGAGGAGGGCGGG - Intergenic
978033897 4:103971671-103971693 CAAACCAGGCAGTGGTGGTCAGG - Intergenic
980322520 4:131297426-131297448 CAGCACAGGCCGAGGCGGGCAGG - Intergenic
983376676 4:166938005-166938027 GTGGATAGGCCGAGGTGGTCAGG - Intronic
984860327 4:184231949-184231971 TTGGTCAGGCACAGGTGGTCTGG - Intergenic
985450097 4:190057079-190057101 CAGCACAGGCAGCGGGGGACAGG + Intergenic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985522978 5:387623-387645 CAGAAGAGGCTGAGGAGGTCAGG - Intronic
985719720 5:1482614-1482636 CAGGGCAGGCTGGGGTGGGCTGG + Intronic
985861624 5:2476030-2476052 CAGCAGAAGCAGAGGGGGTCTGG + Intergenic
986352255 5:6891539-6891561 CAGTCCAGGCAGAGGTTCTCTGG - Intergenic
989301043 5:39894104-39894126 CAAGGCAGGCAGATGAGGTCAGG + Intergenic
989421177 5:41241050-41241072 CAGGACAGGCACACCTGGCCTGG - Intronic
991377607 5:65982883-65982905 CAGGACAGGCTGTCTTGGTCAGG + Intronic
991973283 5:72161562-72161584 AAAGACAGGCAGAGGAAGTCAGG - Intronic
992067214 5:73119818-73119840 CGGGAGGGGCAGAGCTGGTCCGG + Intergenic
993466507 5:88253474-88253496 CAGGAAAGGAAGAGAAGGTCAGG + Intronic
993962456 5:94316613-94316635 CAGGACAGCCAGATGGGGTGAGG - Intronic
994913156 5:105939218-105939240 CAGGCCAGTCAGAGGTTCTCTGG + Intergenic
995747549 5:115419329-115419351 GAGGAAAGGGAGAGGTGGACAGG + Intergenic
995826310 5:116303577-116303599 CAGGACAGGCAGAGACCATCAGG + Intronic
995837183 5:116410571-116410593 CAGGACAGGCAGAGAAAGGCAGG - Intronic
997193894 5:131964919-131964941 CGGGAGAGGCAGAGGAGGACAGG - Intronic
998861052 5:146444851-146444873 CTTGACAGGCAGAGGTGGGAGGG - Intergenic
999264095 5:150255335-150255357 CAGGACAGTCAGAGAGGGGCAGG + Intronic
1000731511 5:164839733-164839755 CAGCCCAGGAAGAAGTGGTCAGG - Intergenic
1001089672 5:168727944-168727966 CAGGACAGGCAGAGAAGCGCTGG + Intronic
1001299857 5:170525697-170525719 GAGGACAGGCAGGAGTGTTCTGG + Intronic
1001592525 5:172875377-172875399 CAGGACAGGAAGATGGGGTTGGG + Intronic
1001710955 5:173777608-173777630 CAGCACAGGCAGAGCTGAGCAGG - Intergenic
1001960854 5:175879753-175879775 CAGCACTGGCTGAGGTGGCCAGG - Intronic
1002661030 5:180791271-180791293 CAGGTCAGGGAGAAGGGGTCTGG + Exonic
1003149616 6:3537670-3537692 CTGGACAAGCACAGGTGGCCTGG + Intergenic
1003266045 6:4565714-4565736 GAGGACAGGCACAGGTGGCCGGG + Intergenic
1003883819 6:10502706-10502728 CAGGGCAGGCAGAGGAGTCCAGG - Intronic
1004278225 6:14256888-14256910 CAGCACAGGGAGAGGTGTGCGGG + Intergenic
1004938154 6:20528361-20528383 CTTGACAGGCTGAGGTGGGCAGG + Intergenic
1005681815 6:28216139-28216161 AAGGCCAGGCAGACGTGGACAGG - Intergenic
1006163306 6:32050198-32050220 CAGGACAGGCTGAGGGAGTCGGG + Intronic
1006163384 6:32050535-32050557 AGGGACAGGGAGAGGTGGCCTGG - Intronic
1006163930 6:32053588-32053610 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1006164004 6:32053925-32053947 AGGGACAGGGAGAGGTGGCCTGG - Intronic
1006164557 6:32056786-32056808 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1006164632 6:32057123-32057145 AGGGACAGGGAGAGGTGGCCTGG - Intronic
1006165556 6:32062357-32062379 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1006166507 6:32068590-32068612 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1006385504 6:33728654-33728676 CAGGTCAGGCAGAGCTGGGTTGG - Intronic
1006430885 6:33995060-33995082 CAGGACTGGCATAGGAGCTCTGG - Intergenic
1006798294 6:36744401-36744423 TAGGACAGGAAGGGGTGGGCAGG + Intronic
1007095032 6:39207809-39207831 CAGGGCAGGCAGATGTGTCCAGG - Intronic
1007171267 6:39865176-39865198 CAGGTGAGGCAGAGTTGGCCAGG - Intronic
1007309570 6:40934731-40934753 CAGCACAGACACAGGTGGGCGGG + Intergenic
1007402870 6:41614378-41614400 CAGGAGAGGCAGGGGCAGTCAGG + Intergenic
1007727997 6:43928405-43928427 AAGGAGAGGCAGAGGCGATCGGG + Intergenic
1007728915 6:43933843-43933865 CAGGACAGCCAGAGGGGGCTGGG - Intergenic
1008048841 6:46879472-46879494 CAGGAGAGGGAGAGAGGGTCTGG - Intronic
1012394319 6:98778366-98778388 CAGAAGAAGCAGAGGTGGTGGGG + Intergenic
1014751606 6:125263004-125263026 AAGCACAGGCAGAGATGGGCTGG - Exonic
1015091260 6:129362181-129362203 CAGGAAAGGGAGAGATGGACGGG - Intronic
1015170673 6:130249045-130249067 CAGGAAAGAGAGAGGTGTTCTGG - Intronic
1015501482 6:133937821-133937843 CAGGACAGGCACAGTGGCTCAGG - Intergenic
1017748375 6:157467327-157467349 TAGGCCAGGCAGGGGTGGTGGGG - Intronic
1018216598 6:161534117-161534139 CAGGACAGGGAAAGGGAGTCTGG - Intronic
1018423414 6:163659951-163659973 CAGGCCAGGCATGAGTGGTCAGG + Intergenic
1018465244 6:164038120-164038142 CAGGCCTGGGAGAGGTGGGCAGG + Intergenic
1019260290 7:78229-78251 CAGGACAGACACAGGCGGACGGG - Intergenic
1019409515 7:900484-900506 CAGGGCAGACAGGGGTGGTGGGG - Intronic
1019641789 7:2107215-2107237 CGGGACAGTCAGAGTTGGTGAGG + Intronic
1019946484 7:4333571-4333593 CTGGATAGGCAGAGGTAATCTGG - Intergenic
1020076797 7:5263665-5263687 CAGGCCAGAGAGAGGTGGGCTGG + Intergenic
1021382533 7:19984667-19984689 CATGGCTGGCAGTGGTGGTCTGG - Intergenic
1022035945 7:26534789-26534811 CAGGAGAGGAAGAGGAGGCCTGG - Exonic
1022348846 7:29546814-29546836 CAGGCCAGAGAGAGGTGTTCGGG + Intergenic
1022527381 7:31047084-31047106 GGGGACAGGCAGAGGGGGTACGG + Intergenic
1023056722 7:36296500-36296522 CAGCACAGGGAAAGGTGGTCAGG - Intronic
1023381501 7:39612807-39612829 CAGGACAGTCAGAGTTGGAAAGG + Intergenic
1024628709 7:51230287-51230309 CAGGAGAGGCAGTGGTGCCCCGG - Intronic
1025202298 7:56969929-56969951 CAGGCCAGAGAGAGGTGGGCCGG - Intergenic
1025669649 7:63606998-63607020 CAGGCCAGAGAGAGGTGGGCCGG + Intergenic
1026459889 7:70604663-70604685 CAGCAGAGGCAGAGGTGAGCAGG - Intronic
1028333194 7:89622242-89622264 CAGGAAAGGCAGGGTGGGTCAGG - Intergenic
1029184745 7:98730482-98730504 CAGGACAGGCTCATGGGGTCAGG + Intergenic
1029634370 7:101774096-101774118 CATGACAGCCAGAGGAAGTCAGG + Intergenic
1030194512 7:106840545-106840567 CAGCACAGGCAGGGGAGGTTTGG - Intergenic
1030887860 7:114961079-114961101 CAGAGCAGGCAGGGGTGGTGCGG - Intronic
1031976764 7:128098837-128098859 CAGGACAGGGAGAGCTGACCAGG + Intergenic
1032400454 7:131620669-131620691 CAGGAAAGGAAGAGGAGGCCTGG - Intergenic
1032657637 7:133948823-133948845 GAGAACAGACAGATGTGGTCTGG - Intronic
1033216297 7:139495923-139495945 GAGGACAGGCAGAGGTGGCCAGG - Intergenic
1033354077 7:140585479-140585501 CAGGGCAGGTGGAGGTGGCCTGG + Intronic
1035170404 7:157014268-157014290 CAAGACAGGCAGAGAGGGCCTGG + Intergenic
1035294784 7:157860938-157860960 CAGAACAGGCACAGATGGGCTGG + Intronic
1035476501 7:159147885-159147907 CATGACAGGGAGAGGGGGTTGGG + Intergenic
1035548809 8:504110-504132 CAGGGCAGGCTCAGGTGGACTGG - Intronic
1035665729 8:1378342-1378364 CAGGACAGACAGGTGAGGTCAGG - Intergenic
1036812882 8:11879844-11879866 AAGGACAGGCAGAGTGGGGCAGG - Intergenic
1037451982 8:19024698-19024720 CAGGAAGGGGAGAGGGGGTCTGG + Intronic
1037982234 8:23262444-23262466 CAGGTAAGGCAGAGGTGAACTGG + Intergenic
1039414976 8:37386022-37386044 AGGGACAGGCAGGTGTGGTCTGG - Intergenic
1039897703 8:41727950-41727972 CCGGGCAGGATGAGGTGGTCCGG - Exonic
1043683760 8:83064041-83064063 CAGGCAGGGCAGTGGTGGTCAGG - Intergenic
1044806429 8:96012933-96012955 CATTCCAGGCAGAGGTGCTCGGG - Intergenic
1047762446 8:127964111-127964133 CAGGACAAGCAGATGGGTTCAGG + Intergenic
1048013966 8:130481446-130481468 CAGTACAGGCAGAAGTGCTGAGG + Intergenic
1048611495 8:136027873-136027895 CAGGAAAGACAGAGGTGGCTTGG + Intergenic
1048992040 8:139766189-139766211 CAGGGCTGGCAGAGCTGGTGAGG - Intronic
1049642364 8:143721450-143721472 CAGCACAGGCAGAAGGGGCCCGG - Intronic
1051588260 9:18749584-18749606 CAGGCCAGGCAGAGCCGGCCTGG - Intronic
1054875031 9:70087101-70087123 CAGGACAGTAGAAGGTGGTCAGG - Intronic
1055625174 9:78169038-78169060 AAAGACAGGCAGAGCTGTTCTGG + Intergenic
1056549330 9:87638657-87638679 CAAGGCAGGAAGAGGTGGTCTGG + Intronic
1057556876 9:96095182-96095204 CAGGACTGGCAGCGTGGGTCAGG - Intergenic
1058784917 9:108377594-108377616 CATGATGGGAAGAGGTGGTCAGG - Intergenic
1060407059 9:123378030-123378052 CTGGAGAACCAGAGGTGGTCAGG - Exonic
1060925927 9:127455119-127455141 TAGGAAAGACAGAGGTGGACTGG + Intronic
1060976624 9:127768768-127768790 GAGGACAGGGAGGGGTGGGCTGG - Intronic
1061315774 9:129794997-129795019 CAGGACAGGCAGGGATGGGATGG + Intergenic
1061455648 9:130695673-130695695 CAGGGCAGGCAGGGGTGGGGTGG - Intronic
1061533970 9:131236149-131236171 CAGGACACTCACAGGTGGGCAGG - Intergenic
1061958554 9:133976389-133976411 CAGGAGAGGCAGGGCTGGGCGGG - Intronic
1061958916 9:133978133-133978155 CAGGACAGGCAGGGCTGGGCAGG + Intronic
1062048778 9:134436697-134436719 CAGGCCAGGCAGAGAAGGGCAGG - Exonic
1062130735 9:134891781-134891803 CTGGACAGGAAGAGGGGGTGGGG - Intergenic
1062186997 9:135223550-135223572 CAGGAGGGCCAGAGGTGGACAGG + Intergenic
1062197575 9:135282786-135282808 CAGGAACAGCACAGGTGGTCAGG + Intergenic
1062285584 9:135771194-135771216 CAGGACAGGGGGAGGTGACCAGG + Intronic
1062481472 9:136754440-136754462 CAGGAGGGGCAGGGGTGGGCGGG + Exonic
1062597122 9:137304411-137304433 GGGGTCAGGCAGAGGTGGTGGGG + Intergenic
1186211259 X:7252869-7252891 CAGGACAGGCACAGTCGTTCAGG + Intronic
1187718472 X:22127872-22127894 CAGGGAAGACAGAGGTGGTGGGG + Intronic
1188663659 X:32791288-32791310 CAGGAAAAGCATAGGTGGGCTGG - Intronic
1189298689 X:39936836-39936858 CAGGCCTGGCAGAGGTGGTGGGG - Intergenic
1189480620 X:41389702-41389724 CAGGACAGAGAGAGGAGGGCGGG + Intergenic
1189577926 X:42375302-42375324 CAGGGCAGGCAGGGCTGGTCAGG + Intergenic
1189580013 X:42396198-42396220 CAGGACAGGCTGAAATTGTCAGG - Intergenic
1189617096 X:42794861-42794883 CAGGTCAGTCAGAGGTTCTCTGG + Intergenic
1189792676 X:44618856-44618878 GAGGACAGGCAAATGTTGTCTGG - Intergenic
1190175492 X:48145644-48145666 CATGACAGGAAGTGGGGGTCAGG + Intergenic
1190198346 X:48339210-48339232 CATGACAGGAAGTGGGGGTCAGG - Intergenic
1190665108 X:52689672-52689694 CATGACAGGAAGTGGGGGTCAGG - Intronic
1190674314 X:52768747-52768769 CATGACAGGAAGTGGGGGTCAGG + Intronic
1190752599 X:53375253-53375275 CAGGACAGGCAGAGGTGGTCAGG - Exonic
1191644570 X:63466713-63466735 CAGGCCAGTCAGAGGTTCTCTGG + Intergenic
1191785909 X:64917039-64917061 CAGGAGATGTAGAGTTGGTCTGG + Exonic
1192940905 X:75910588-75910610 CACCACTGGCAGTGGTGGTCTGG - Intergenic
1194258302 X:91662384-91662406 CAGGAGGGGCAGAGGTGGAAAGG + Intergenic
1195646271 X:107234003-107234025 CAAGACAGGTAGTGGTGGTGAGG + Intronic
1196645802 X:118116649-118116671 CAGGACAGGGTGAAGTGGTCGGG - Intronic
1197922359 X:131608865-131608887 CAGGCCAAGCAAAGGTGGACAGG - Intergenic
1200360365 X:155598966-155598988 CAGGAGTGGCAGAGGTGGAAGGG - Intronic
1200915407 Y:8567028-8567050 TGGTACAGGCAGAGGTGGCCTGG - Intergenic
1200933955 Y:8722098-8722120 TGGTACAGGCAGAGCTGGTCTGG + Intergenic
1202367788 Y:24178799-24178821 CAGGACTGGTAGAGGCTGTCAGG + Intergenic
1202502995 Y:25491324-25491346 CAGGACTGGTAGAGGCTGTCAGG - Intergenic