ID: 1190759521

View in Genome Browser
Species Human (GRCh38)
Location X:53427986-53428008
Sequence ATCCACCTGATCCCAAAGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 348}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190759521_1190759531 20 Left 1190759521 X:53427986-53428008 CCTTTCTTTGGGATCAGGTGGAT 0: 1
1: 0
2: 4
3: 19
4: 348
Right 1190759531 X:53428029-53428051 GGTGGGAGACCGAAAGCGTCGGG 0: 1
1: 0
2: 1
3: 5
4: 69
1190759521_1190759526 3 Left 1190759521 X:53427986-53428008 CCTTTCTTTGGGATCAGGTGGAT 0: 1
1: 0
2: 4
3: 19
4: 348
Right 1190759526 X:53428012-53428034 CAGGCCCTGAACAACCAGGTGGG 0: 1
1: 0
2: 1
3: 15
4: 150
1190759521_1190759525 2 Left 1190759521 X:53427986-53428008 CCTTTCTTTGGGATCAGGTGGAT 0: 1
1: 0
2: 4
3: 19
4: 348
Right 1190759525 X:53428011-53428033 CCAGGCCCTGAACAACCAGGTGG 0: 1
1: 0
2: 0
3: 23
4: 231
1190759521_1190759523 -1 Left 1190759521 X:53427986-53428008 CCTTTCTTTGGGATCAGGTGGAT 0: 1
1: 0
2: 4
3: 19
4: 348
Right 1190759523 X:53428008-53428030 TGTCCAGGCCCTGAACAACCAGG 0: 1
1: 0
2: 1
3: 19
4: 139
1190759521_1190759530 19 Left 1190759521 X:53427986-53428008 CCTTTCTTTGGGATCAGGTGGAT 0: 1
1: 0
2: 4
3: 19
4: 348
Right 1190759530 X:53428028-53428050 AGGTGGGAGACCGAAAGCGTCGG 0: 1
1: 0
2: 0
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190759521 Original CRISPR ATCCACCTGATCCCAAAGAA AGG (reversed) Exonic
901646283 1:10718485-10718507 GTCCACCTGCTCCCCAAGGAGGG + Intronic
906571933 1:46849828-46849850 ATCATCCTGATACCAAAGACTGG + Intergenic
906908264 1:49918746-49918768 ATCATCCTGATACCAAAGACTGG + Intronic
908637761 1:66187314-66187336 ATCATCCTGATACCAAAGACTGG - Intronic
908639003 1:66201327-66201349 ATCATCCTGATACCAAAGACTGG - Intronic
909113966 1:71510827-71510849 ACCCACCCAAACCCAAAGAATGG - Intronic
909210388 1:72815445-72815467 ATCATCCTGATACCAAAGACGGG + Intergenic
910816037 1:91291712-91291734 ATCATCCTGATACCAAAGACGGG + Intronic
911322842 1:96435940-96435962 ATCATCCTGATACCAAAGACCGG - Intergenic
913341894 1:117766454-117766476 ATCATCCTGATACCAAAGCATGG - Intergenic
914989467 1:152485878-152485900 ACCCATCCAATCCCAAAGAATGG + Intergenic
916460370 1:165017851-165017873 ATCATCCTGATACCAAAGACTGG - Intergenic
919055768 1:192567970-192567992 ATCCACCTGTTCCAAATGCAGGG - Intergenic
919060287 1:192623321-192623343 ATCATCCTGATACCAAAGCATGG - Intergenic
919065213 1:192685434-192685456 ATCCTCCTGATACCAAAGCGTGG - Intergenic
919294927 1:195685703-195685725 ATTCATCTGATCTCAAAAAATGG - Intergenic
920202235 1:204266592-204266614 AGCCACCTGAACCCCAAGGAGGG - Intronic
1063340205 10:5255801-5255823 ATCATCCTGATACCAAAGACTGG + Intergenic
1064671486 10:17719292-17719314 ATCATCCTGATACCAAAGACTGG - Intergenic
1065123262 10:22548596-22548618 ATCAAACAGATCCCAAAGCAAGG + Intronic
1066655547 10:37696479-37696501 ATCATCCTGATACCAAAGCATGG + Intergenic
1066806675 10:39262922-39262944 ATCATCCTGATACCAAAGGATGG + Intergenic
1068586048 10:58799965-58799987 ATTCTCCTGATCCCTGAGAATGG + Intronic
1068641280 10:59410810-59410832 ATCATCCTGATACCAAAGACTGG - Intergenic
1068943235 10:62702153-62702175 ATCATCCTGATACCAAAGACCGG + Intergenic
1069110319 10:64438844-64438866 ATCATCCTGATACCAAAGACTGG - Intergenic
1071136456 10:82459678-82459700 ATCCACTTGATCCCAGAGAAAGG + Intronic
1071163926 10:82782868-82782890 ATCATCCTGATACCAAAGACGGG + Intronic
1071323431 10:84488221-84488243 ATCATCCTGATACCAAAGACTGG - Intronic
1071929711 10:90454693-90454715 ATGCACATGAACACAAAGAAGGG - Intergenic
1072243975 10:93524599-93524621 ATCATCCTGATACCAAAGACTGG + Intronic
1073173859 10:101538085-101538107 CTCCTCTTGATCCCAAAGTATGG + Intronic
1075165320 10:120063024-120063046 ATCCCACTGATACCAGAGAAAGG + Intergenic
1075402956 10:122173923-122173945 AGCCACCTGCTCCCATAGACAGG + Intronic
1077561157 11:3262266-3262288 ATCCATCCAAACCCAAAGAATGG - Intergenic
1077567053 11:3308095-3308117 ATCCATCCAAACCCAAAGAATGG - Intergenic
1077710855 11:4535402-4535424 ATCATCCTGATACCAAAGACTGG + Intergenic
1078394377 11:10966896-10966918 ATCGTCCTGATACCAAAGACTGG + Intergenic
1078718790 11:13864508-13864530 ATGCACCTGAGGCCAAAAAAGGG - Intergenic
1079773273 11:24491219-24491241 ATCCATATCTTCCCAAAGAAGGG - Intergenic
1080706169 11:34696216-34696238 ATACACATGAACACAAAGAAGGG - Intergenic
1082314290 11:50698102-50698124 GTCAACCTGATACCAAAGACAGG + Intergenic
1082316054 11:50723756-50723778 ATCCTCCTGATATTAAAGAAAGG + Intergenic
1082606057 11:55235308-55235330 ATCATCCTGATACCAAAGACGGG - Intergenic
1082833443 11:57636385-57636407 ACCCATCTAAACCCAAAGAATGG + Intergenic
1083003349 11:59317948-59317970 ATCATCCTGATCCCAAAGACTGG - Intergenic
1083522724 11:63330566-63330588 ATCATCCTGATGCCAAAGACTGG - Intronic
1086242059 11:84707073-84707095 ATCTTCCTGAGTCCAAAGAATGG + Intronic
1088262486 11:107957402-107957424 CTCCTCCTGATCCTAGAGAATGG + Intronic
1088958498 11:114635946-114635968 ATCATCCTGATACCAAAGACGGG - Intergenic
1089811832 11:121138463-121138485 ATCACCCTGATCTCAAAAAAGGG - Intronic
1091643193 12:2253135-2253157 ATCCACTTATCCCCAAAGAAGGG + Intronic
1091910116 12:4223760-4223782 GTCCACCTGGTACCAAAGATGGG + Intergenic
1094461239 12:30698528-30698550 TTCCACTTCATTCCAAAGAATGG + Intergenic
1095708042 12:45258995-45259017 ATCCACCCCTTCCCCAAGAAGGG - Intronic
1095870106 12:47017571-47017593 ATCCATCCAAACCCAAAGAATGG - Intergenic
1097150170 12:56971952-56971974 ATCAACCTGATACCAAAGCCTGG + Intergenic
1098642307 12:72853907-72853929 ATCATCCTGATACCAAAGACTGG - Intergenic
1098902753 12:76129948-76129970 ATCCACATGGACACAAAGAATGG - Intergenic
1099292761 12:80792036-80792058 TCCCAGCTGAACCCAAAGAAGGG + Intergenic
1099547901 12:84008382-84008404 ATCATCCTGATACCAAAGCAGGG - Intergenic
1099549213 12:84022309-84022331 ATCATCCTGATACCAAAGCAGGG + Intergenic
1099808068 12:87545126-87545148 ATCATCCTGATACCAAAGATGGG + Intergenic
1099862891 12:88241782-88241804 ATCATCCTGATCCCAAAGCCTGG + Intergenic
1099875786 12:88404229-88404251 ATCATCCTGATCCCAAAGCCTGG + Intergenic
1100827022 12:98484072-98484094 ATTCACCTTACCCCATAGAAGGG + Intergenic
1105647917 13:22340956-22340978 ATCATCCTGATACCAAAGACTGG + Intergenic
1106980531 13:35274025-35274047 ATCAACCTGATACCAAAGCCTGG + Intronic
1108989097 13:56632430-56632452 ATCATCCTGATCCCAAAGCCTGG + Intergenic
1109088007 13:58000907-58000929 ATCATCCTGATACCAAAGACTGG - Intergenic
1110418415 13:75277625-75277647 ATCCTCCTGATACCAAAGCCTGG + Intergenic
1110769231 13:79318563-79318585 TTCAGCGTGATCCCAAAGAATGG - Intronic
1111201555 13:84944744-84944766 ATCCACCTCTGCCCAAAAAATGG + Intergenic
1111895243 13:94133882-94133904 ATCCACCTCCTGCCAAAGACAGG + Intronic
1112069140 13:95828829-95828851 ATCATCCTGATACCAAAGACTGG + Intronic
1113646725 13:112002674-112002696 ATGCACCTGAGCCCAAATCAAGG - Intergenic
1114923148 14:27360023-27360045 ATCATCCTGATCCCAAAGCCTGG - Intergenic
1115995357 14:39190002-39190024 ACCAACATTATCCCAAAGAAAGG - Intergenic
1117786080 14:59286943-59286965 ATCACCCTGATACCAAAGACTGG + Intronic
1118358313 14:65034357-65034379 CTCCAACAGATCCCAAAAAAGGG + Intronic
1120070006 14:80092177-80092199 ATCAACCTGATACCAAAGCCGGG + Intergenic
1120182308 14:81356489-81356511 ATCCTCCTGATACCAAAGCCTGG - Intronic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1123575101 15:21657772-21657794 ATACACATGAACACAAAGAAGGG - Intergenic
1123611717 15:22100261-22100283 ATACACATGAACACAAAGAAGGG - Intergenic
1123676651 15:22715471-22715493 AGGCACCTGCTCCCACAGAAGGG + Intergenic
1124328867 15:28789734-28789756 AGGCACCTGCTCCCACAGAAGGG + Intergenic
1125078243 15:35646170-35646192 ATACACGTGAACACAAAGAAGGG + Intergenic
1125224599 15:37380985-37381007 ATCATCCTGATACCAAAGACTGG - Intergenic
1127400713 15:58582823-58582845 ATGTACTTGATCACAAAGAAAGG - Intergenic
1127524704 15:59781150-59781172 ATCATCCTGATCCCAAAGCCTGG - Intergenic
1127580361 15:60333371-60333393 ATCCTCCTGATCCCAAAGCCTGG + Intergenic
1129564307 15:76605504-76605526 ATCAACCTGATACCAAAGCCTGG - Intronic
1129936615 15:79456418-79456440 TTCAACCTGATCCAAATGAATGG + Exonic
1129984328 15:79903909-79903931 ATCCACCTGGTTCAAAAGGAAGG + Intronic
1131049193 15:89334980-89335002 ATCCACCTGCTCCTTGAGAAGGG - Intergenic
1131086863 15:89583208-89583230 TACCAGCTGTTCCCAAAGAAGGG + Intronic
1131210623 15:90492636-90492658 ATCCACCTGCTCCCCATAAAAGG - Exonic
1131632275 15:94190901-94190923 ATCAACCTAAACCCAAAGCAAGG + Intergenic
1131855792 15:96592530-96592552 ATCAATCTGATCCAAAAAAATGG + Intergenic
1132064313 15:98718109-98718131 ACCCACCTGATCCCCTTGAACGG - Intronic
1202983969 15_KI270727v1_random:392016-392038 ATACACATGAACACAAAGAAGGG - Intergenic
1134022262 16:10929442-10929464 AGGCACCTGCTCCCACAGAAGGG - Exonic
1134225805 16:12389172-12389194 AACCAGATGATGCCAAAGAAAGG - Intronic
1134297401 16:12959218-12959240 ATGAACCTGATTCCAAAAAAAGG + Intronic
1134758216 16:16688405-16688427 ATCAACCTGATACCAAAGCCTGG - Intergenic
1134987857 16:18670772-18670794 ATCAACCTGATACCAAAGCCTGG + Intergenic
1136653165 16:31690836-31690858 ATCATCCTGATACCAAAGCATGG + Intergenic
1137326342 16:47441339-47441361 ATCAACCTGATACCAAAGCCTGG + Intronic
1137337816 16:47568022-47568044 ATCACCCTGATACCAAAGCAAGG - Intronic
1137467405 16:48722620-48722642 ATCATCCTGATACCAAAGACTGG + Intergenic
1137553950 16:49458532-49458554 ATCCACCTGCTGCCCAAGGATGG + Intergenic
1137957916 16:52852197-52852219 CTCCACTGGAGCCCAAAGAATGG - Intergenic
1138784102 16:59825582-59825604 ATACACCTGGTCCCAAATCAAGG - Intergenic
1138866558 16:60828494-60828516 ATCAACCTGATACCAAAGCCTGG - Intergenic
1138892141 16:61156372-61156394 ATCAACCTGATACCAAAGCCTGG - Intergenic
1141053155 16:80791516-80791538 TTCCACAGGAGCCCAAAGAAAGG + Intronic
1143368137 17:6421695-6421717 TTCCAACTGCTCCCAAACAAAGG + Intronic
1149606596 17:57929371-57929393 ATCTATCTGACCCCAAAGACAGG + Intronic
1149857574 17:60096206-60096228 ATTCCCCTGATCCCAAGGAAGGG - Intergenic
1149894023 17:60415101-60415123 ATCCAGCAGGTCCCTAAGAAGGG + Intronic
1153424729 18:4949700-4949722 ATCCTCCTGATACCAAAAACGGG + Intergenic
1153494477 18:5683776-5683798 ATCCTCCTGATACCAAAGCCAGG - Intergenic
1155273312 18:24162065-24162087 ATCTACCTGATGCTAAATAAAGG - Exonic
1155681171 18:28488843-28488865 ATCATCCTGATACCAAAGACTGG - Intergenic
1155936851 18:31763479-31763501 ATCCCCCTGATCCCAGTGATTGG - Intergenic
1156156049 18:34302856-34302878 ATCCATCAGCTCCCAAACAAGGG - Intergenic
1156448961 18:37255801-37255823 ATCCACCTGAGCTCAAAGAAGGG + Intronic
1156532265 18:37829246-37829268 ATCAACCTGATACCAAAGCCTGG - Intergenic
1157538121 18:48476009-48476031 CTCCACCTGATCCCAGACACAGG + Intergenic
1158036472 18:53037707-53037729 GTCCACCTGATTTCAAAGACCGG - Intronic
1160399738 18:78601500-78601522 AGCCACCTGAACCCAAACCATGG - Intergenic
1163673685 19:18644676-18644698 ATCGACCTGATCCCATAGAAGGG - Intronic
1164361814 19:27521022-27521044 AACCTGCTGAACCCAAAGAAAGG - Intergenic
1164366175 19:27584485-27584507 ATCCTGCTGTTTCCAAAGAAAGG - Intergenic
1167855469 19:52234856-52234878 AACCACATGCTCCCAAACAATGG + Intergenic
925117477 2:1392485-1392507 ATCATCCTGATCCCAAAGCCTGG - Intronic
925334627 2:3086025-3086047 ATCATCCTGATACCAAAGACTGG + Intergenic
928072062 2:28226955-28226977 ATCCACCTCATCTCAGAAAATGG - Intronic
928837516 2:35565543-35565565 ATCATCCTGATACCAAAGCATGG - Intergenic
929651981 2:43689160-43689182 ATCCTCCACATTCCAAAGAAAGG - Intronic
930830555 2:55738843-55738865 ATCCTCCTGATACCAAAGCCGGG - Intergenic
930835644 2:55790596-55790618 ATCCTCCTGATACCAAAGCCGGG - Intergenic
931048473 2:58384020-58384042 ATCCTCCTGATACCAAAGCCGGG - Intergenic
931558806 2:63534370-63534392 ATCAACCTGATACCAAAGCCTGG + Intronic
933750460 2:85599697-85599719 ATCCACCTGGGCCCAGAGAAGGG + Exonic
933765447 2:85705553-85705575 ATCCACCTTTCTCCAAAGAATGG + Intergenic
935003603 2:99047233-99047255 ATCATCCTGATACCAAAGACTGG + Intronic
936806107 2:116334260-116334282 ATCATCCTGATGCCAAAGCATGG - Intergenic
936908148 2:117561444-117561466 AAACACCTGACCCCAAACAAGGG + Intergenic
938657082 2:133445671-133445693 TTCCACCTGGTCCCAGAGAAAGG + Intronic
939030773 2:137073085-137073107 ATCATCCTGATACCAAAGCATGG - Intronic
940120246 2:150256393-150256415 TCCCATCTGAACCCAAAGAAAGG - Intergenic
940379631 2:152999369-152999391 ATCATCCTGATCCCAAAGCCGGG + Intergenic
940644133 2:156372750-156372772 ATCATCCTGATACCAAAGCATGG - Intergenic
942716686 2:178901266-178901288 ATCATCCTGATACCAAAGCAAGG + Intronic
942886470 2:180930860-180930882 ATACACATGAACACAAAGAAGGG - Intergenic
942955591 2:181769098-181769120 ATCAACCTGATACCAAAGCCTGG - Intergenic
948518758 2:238522631-238522653 ACCCACCTGAGCCCAAAGGATGG - Intergenic
1169209274 20:3756575-3756597 ATCAACCTGGTCCCATTGAATGG - Intronic
1172122429 20:32606341-32606363 ACCCTCCTCATCCCAGAGAATGG + Intronic
1174894561 20:54435015-54435037 ATCAACCTGATTTTAAAGAAAGG + Intergenic
1176316585 21:5250827-5250849 ATCATCCTGATACCAAAGCATGG - Intergenic
1181331560 22:22096453-22096475 ATGCACCTGAACGTAAAGAAGGG + Intergenic
1181549035 22:23625896-23625918 ACCCATCTAAACCCAAAGAATGG - Intronic
1181712589 22:24699909-24699931 ATGCAGCTGATCCCAAACAAAGG + Intergenic
1182201049 22:28570500-28570522 ATACACATGAACACAAAGAAGGG + Intronic
1183929391 22:41227405-41227427 CTCCACCTCATGCCAAAGAACGG - Intronic
949456302 3:4242754-4242776 ATCATCCTGATCCCAAAGCCTGG - Intronic
949929761 3:9069455-9069477 ATCCACTTGATGCCAGGGAAGGG + Intronic
949942849 3:9167928-9167950 ATCCACCTAATGACAAATAATGG + Intronic
951684813 3:25332185-25332207 ATCATCCTGATACCAAAGCATGG + Intronic
952560508 3:34587296-34587318 ATACACGTGGTCACAAAGAAGGG - Intergenic
952612639 3:35229458-35229480 ATCATCCTGATACCAAAGCATGG + Intergenic
954622299 3:52003095-52003117 GTCCATCTGATCCCTAGGAAGGG - Intergenic
954800740 3:53185736-53185758 TTCCCCCTGAGGCCAAAGAAAGG + Intronic
955443322 3:58980365-58980387 ATCATCCTGATACCAAAGGACGG + Intronic
955854566 3:63259232-63259254 ATCATCCTGATACCAAAGCATGG + Intronic
957344906 3:78948183-78948205 ATCATCCTGATACCAAAGCATGG + Intronic
958092246 3:88891742-88891764 ATCATCCTGATACCAAAGACTGG + Intergenic
958184844 3:90107463-90107485 ATCATCCTGATACCAAAGACTGG - Intergenic
959835496 3:110913918-110913940 ATCATCCTGATACCAAAGATGGG - Intergenic
962182380 3:133221604-133221626 AGACACCTGATCACAAAGGAAGG - Intronic
963315487 3:143754145-143754167 AACCACCTGATTCCACAGCAGGG + Intronic
965272014 3:166629211-166629233 ATCAACCTGATACCAAAGCCTGG - Intergenic
968208919 3:196830403-196830425 ATCCAACTGTTTACAAAGAATGG - Exonic
968866138 4:3213195-3213217 CTCCACCTCACACCAAAGAAAGG + Intronic
969967619 4:11013294-11013316 ATCCATCTGATACCACAGCAAGG - Intergenic
970026672 4:11631344-11631366 ATCAGACTTATCCCAAAGAAAGG + Intergenic
970134464 4:12906951-12906973 ATCCACCTGATACCAAAGCCTGG + Intergenic
970917793 4:21355812-21355834 ATCATCCTGATCCCAAAACATGG + Intronic
971466836 4:26972721-26972743 ATCAACCTGATACCAAAGCCTGG - Intronic
972372128 4:38434678-38434700 ATCCTCCTGATACCAAAGCCTGG - Intergenic
973148597 4:46860550-46860572 ATTCACCAGATGTCAAAGAAGGG - Intronic
974612783 4:64238256-64238278 ATCCTCCTGATACCAAAGCCTGG - Intergenic
974723198 4:65768623-65768645 ATCCTCCTGATACCAAAGCCTGG - Intergenic
974917912 4:68200596-68200618 ATCATCCTGATACCAAAGCAGGG + Intergenic
974918196 4:68203487-68203509 ATCATCCTGATACCAAAGCAGGG + Intergenic
975520758 4:75298651-75298673 ATCATCCTGATACCAAAGACTGG + Intergenic
976428281 4:84931392-84931414 ATAATCCAGATCCCAAAGAAAGG - Intronic
976760386 4:88542597-88542619 ATCATCCTGATACCAAAGCATGG + Intronic
976828667 4:89288215-89288237 AGACATGTGATCCCAAAGAAAGG + Intronic
978163597 4:105579712-105579734 ATCATCCTGATACCAAAGACTGG - Intronic
978697557 4:111600465-111600487 ATCCAACACATCCCAAAGAAAGG - Intergenic
979177521 4:117682630-117682652 ATCATCCTGATACCAAAGACTGG - Intergenic
979599455 4:122571662-122571684 ATCATCCTGATACCAAAGACTGG - Intergenic
981100345 4:140822850-140822872 ATCATCCTGATACCAAAGACTGG - Intergenic
981299420 4:143170088-143170110 ATCATCCTGATACCAAAGACTGG + Intergenic
981603416 4:146517762-146517784 ATACCCCCGAGCCCAAAGAAGGG + Intronic
982052403 4:151514964-151514986 ATCAACCTGATACCAAAGCCAGG + Intronic
982310535 4:153980560-153980582 ATCATCCTGATACCAAAGAACGG - Intergenic
982859182 4:160427627-160427649 ATCCACTAGATTCCCAAGAAGGG - Intergenic
982906634 4:161083100-161083122 ATCATCCTGATACCAAAGACTGG + Intergenic
983594632 4:169452328-169452350 ATCATCCTGATACCAAAGACTGG + Intronic
983879392 4:172915906-172915928 ATCATCCTGATACCAAAGACTGG + Intronic
984882052 4:184418665-184418687 ATAAACCTGATCCCAAAACATGG - Exonic
985347621 4:189023213-189023235 ACTTACCTGATCCCAAAGCATGG + Intergenic
985558522 5:569898-569920 ATCCACATGGCCACAAAGAAGGG + Intergenic
986276142 5:6276743-6276765 ATCCATCTGATTCCAAAGAGTGG - Intergenic
987059779 5:14231493-14231515 TTCAACTTGATTCCAAAGAAAGG - Intronic
987456174 5:18149889-18149911 ATTCACTTGCTCCCAAGGAAAGG - Intergenic
988880610 5:35497894-35497916 ATCATCCTGATACCAAAGCAGGG + Intergenic
989044483 5:37261265-37261287 ATCATCCTGATACCAAAGCAGGG - Intergenic
989258608 5:39394197-39394219 ATCCACTTGAAGCCAAGGAAGGG - Intronic
989941784 5:50159646-50159668 ATCACCCTGATACCAAAGACGGG + Intergenic
989942559 5:50171272-50171294 ATCATCCTGATACCAAAGACGGG - Intergenic
990110218 5:52314239-52314261 ATCAACCTGATACCAAAGCCTGG + Intergenic
990482483 5:56224993-56225015 ATCAACCTGATACCAAAGCCTGG + Intronic
990657075 5:57969105-57969127 ATCATCCTGATACCAAAGACTGG - Intergenic
990899243 5:60732504-60732526 ATCATCCTGATACCAAAGACTGG + Intergenic
992609762 5:78497084-78497106 GTCCACCTGATCTCAACAAATGG + Intronic
994262986 5:97681749-97681771 ATCCTCCTGATACCAAAGCCTGG - Intergenic
994266249 5:97720270-97720292 ATCCTCCTGATACCAAAGCCGGG - Intergenic
994899186 5:105747733-105747755 ATCCACATGGACGCAAAGAAGGG - Intergenic
995713610 5:115059859-115059881 ATCATCCTGATACCAAAGACGGG + Intergenic
996146987 5:119988635-119988657 ATCCTCCTGATGCCAAAGCCTGG - Intergenic
997035424 5:130185198-130185220 ATGACCCTGATCCCAATGAAGGG + Exonic
997087745 5:130821259-130821281 ATCATCCTGATACCAAAGCAGGG + Intergenic
997745103 5:136292804-136292826 ATCATCCTGATACCAAAGCATGG + Intronic
999726474 5:154442458-154442480 GTCCACCTGTTCCCAAAGAAGGG + Intergenic
1000165467 5:158644009-158644031 CTCCACCAGACCCCAAAGACTGG + Intergenic
1000642540 5:163719768-163719790 ATCCACATGGACCCAAAGAAAGG + Intergenic
1001234030 5:170014479-170014501 ATCCACCAGATACCCAAAAAAGG - Intronic
1003647819 6:7929344-7929366 ATCATCCTGATACCAAAGACTGG + Intronic
1005739525 6:28777185-28777207 ATCCATCTAAACCCAAAGAATGG - Intergenic
1006691109 6:35886671-35886693 ATCATCCCAATCCCAAAGAAAGG - Intronic
1008083488 6:47219467-47219489 ATCATCCTGATACCAAAGCATGG + Intergenic
1008281588 6:49602178-49602200 ATCAACCTGATACCAAAGCCTGG + Intergenic
1008898564 6:56585075-56585097 ATCATCCTGATCCCAAAGCCGGG - Intronic
1008915452 6:56782204-56782226 ATCATCCTGATCCCAAAGCCGGG - Intronic
1009242006 6:61195451-61195473 CCCCACCAGAACCCAAAGAATGG - Intergenic
1009503940 6:64451519-64451541 ATCAACCTGATACCAAAGCCTGG + Intronic
1009819960 6:68787635-68787657 ATCATCCTGATACCAAAGACTGG - Intronic
1011848200 6:91592467-91592489 ATCATCCTGATACCAAAGCATGG + Intergenic
1011882986 6:92054114-92054136 ATCCAACTGATACCAACGATTGG - Intergenic
1011921623 6:92584125-92584147 ATACACCTACTCCCAAAGATGGG + Intergenic
1012081308 6:94761416-94761438 ATCATCCTGATACCAAAGATGGG + Intergenic
1012317485 6:97798281-97798303 ATCAACCTGATACCAAAGCCTGG + Intergenic
1012799372 6:103805497-103805519 ATCATCCTGATACCAAAGACTGG + Intergenic
1012821395 6:104089081-104089103 ATCATCCTGATACCAAAGACTGG + Intergenic
1013267716 6:108516161-108516183 ATCATCCTGATACCAAAGACTGG + Intronic
1013387719 6:109648751-109648773 ATCATCCTGATACCAAAGACTGG + Intronic
1014057511 6:117033444-117033466 ATCCAGATCATCCTAAAGAAGGG - Intergenic
1014674276 6:124345314-124345336 ATCATCCTGATACCAAAGACTGG - Intronic
1015698047 6:136003862-136003884 ATCATCCTGATACCAAAGCAGGG + Intronic
1016245295 6:141973181-141973203 ATCCTCCTGATACCAAAGCTGGG + Intergenic
1016338192 6:143031704-143031726 ATCATCCTGATACCAAAGACTGG - Intergenic
1016458404 6:144256439-144256461 ATTAACCTGATTCCAAAGACTGG - Intergenic
1018560979 6:165100698-165100720 GCCCACCAGAACCCAAAGAATGG + Intergenic
1019027097 6:168976577-168976599 ATCATCCTGATCCCAAAGCCTGG + Intergenic
1019072492 6:169359974-169359996 ATCATCCTGATCCCAAAGCCTGG + Intergenic
1019260829 7:81046-81068 ATGCATCTGATCAGAAAGAAGGG - Intergenic
1020385869 7:7601732-7601754 ATCATCCTGATACCAAAGACTGG + Intronic
1020609394 7:10376197-10376219 ATCATCCTGATACCAAAGACTGG + Intergenic
1021523089 7:21555907-21555929 ACCCATCCGAACCCAAAGAATGG + Intronic
1023586923 7:41740568-41740590 ATACAACAGATCCCAAAGTATGG - Intergenic
1026124420 7:67567098-67567120 ACCCATCCGAACCCAAAGAATGG + Intergenic
1026201233 7:68216247-68216269 CTCCACCTGACCCCACAGAAGGG + Intergenic
1026832258 7:73617460-73617482 AACCAACAGATCCCAAAGGAAGG + Intronic
1026909761 7:74084832-74084854 ATCCACCTGGCCCCAAGGCAGGG + Intronic
1027386987 7:77668602-77668624 TTCCACATTATCACAAAGAATGG + Intergenic
1029062609 7:97813993-97814015 ATCATCCTGATACCAAAGCATGG + Intergenic
1029216285 7:98952715-98952737 ATCCACACGTTGCCAAAGAAGGG + Intronic
1029838880 7:103341767-103341789 AAACACTTGATCCCAAAGACTGG - Exonic
1029916317 7:104213392-104213414 ATCATCCTGATACCAAAGCAAGG + Intergenic
1030725354 7:112920109-112920131 ATCATCCTGATACCAAAGACTGG + Intronic
1030912161 7:115263708-115263730 ATCATCCTGATACCAAAGCAGGG - Intergenic
1031612230 7:123841473-123841495 ATCATCCTGATACCAAAGACTGG - Intronic
1031624203 7:123973607-123973629 ATCCATGTGAGCCCAATGAAAGG + Intergenic
1031635472 7:124096569-124096591 ATCATCCTGATACCAAAGCAGGG - Intergenic
1032309191 7:130766910-130766932 ATCATCCTGATACCAAAGCACGG - Intergenic
1032635982 7:133709484-133709506 ATACATCTGATCCAAGAGAATGG + Intronic
1033928329 7:146491384-146491406 AACAACATGATCCCAAAGTAAGG + Intronic
1034353895 7:150435587-150435609 ACCCACCTCAGCCCAAAGAATGG - Intergenic
1035155814 7:156911869-156911891 ATCATCCTGATACCAAAGACTGG - Intergenic
1035824884 8:2633854-2633876 TTCCATCTGTTCCCCAAGAATGG - Intergenic
1036979823 8:13457725-13457747 AACCACCTGACTCCAAAGAAGGG - Intronic
1037125456 8:15342612-15342634 ATCTACCTGATTCTAAAGCAGGG + Intergenic
1037641319 8:20746305-20746327 ATCATCCTGATACCAAAGCATGG + Intergenic
1038065988 8:23964255-23964277 ATCCACTGGATGCCAAACAATGG - Intergenic
1039193737 8:35006556-35006578 AACCAGGTGAACCCAAAGAAAGG - Intergenic
1040321965 8:46316575-46316597 ATCCTCCTGAATCAAAAGAAAGG + Intergenic
1040606784 8:48941573-48941595 ATCATCCTGATACCAAAGACTGG - Intergenic
1040826327 8:51624209-51624231 ATCCACCTGACCCCAGATACTGG + Intronic
1041634441 8:60127140-60127162 ATCATCCTGATACCAAAGACTGG - Intergenic
1041854288 8:62432844-62432866 TTCCTACTGATCCCAAAGCAGGG + Intronic
1042323143 8:67499365-67499387 AAGCACCTGGTTCCAAAGAATGG + Intronic
1043746399 8:83878101-83878123 ATCATCCTGATCCCAAAGCCTGG - Intergenic
1044159942 8:88900572-88900594 ATCATCCTGATACCAAAGACTGG + Intergenic
1044470309 8:92559304-92559326 ATCATCCTGATACCAAAGCATGG - Intergenic
1044882723 8:96740944-96740966 ATCATCCTGATACCAAAGATGGG - Intronic
1045143212 8:99310668-99310690 ATCATCCTGATACCAAAGACTGG - Intronic
1046791487 8:118326826-118326848 ATCCCCCTGTCCCAAAAGAATGG - Intronic
1048090380 8:131234091-131234113 ATCATCCTGATACCAAAGACTGG - Intergenic
1051996697 9:23225728-23225750 ATCATCCTGATACCAAAGACTGG + Intergenic
1052217644 9:25986221-25986243 ATCATCCTGATACCAAAGACTGG + Intergenic
1052543848 9:29847010-29847032 ATCCACCTGATCCCAGCCACTGG + Intergenic
1052888310 9:33670990-33671012 ATCATCCTGATACCAAAGCATGG + Intergenic
1053592450 9:39527890-39527912 ATCCATCCAAACCCAAAGAATGG - Intergenic
1053850298 9:42283232-42283254 ATCCATCCAAACCCAAAGAATGG - Intergenic
1054573852 9:66837389-66837411 ATCCATCCAAACCCAAAGAATGG + Intergenic
1055099743 9:72451247-72451269 ATCAACCTGATACCAAAGCCGGG + Intergenic
1055495054 9:76845894-76845916 AGCCACCTGCTTCCAAAGAGTGG - Intronic
1060900587 9:127254053-127254075 ACCCACCAGATGCCAATGAAAGG - Intronic
1061074014 9:128329819-128329841 GTCTTCCTGTTCCCAAAGAATGG - Intronic
1062211582 9:135367128-135367150 ATCCACCTGAACGCAAAACATGG + Intergenic
1203380395 Un_KI270435v1:31878-31900 ATCATCCTGATACCAAAGACGGG + Intergenic
1185493485 X:537063-537085 ACACGCCTGATGCCAAAGAAAGG + Intergenic
1186571401 X:10718707-10718729 ATCATCCTGATACCAAAGCATGG + Intronic
1187793499 X:22976906-22976928 ATACACATGAACACAAAGAATGG + Intergenic
1190621891 X:52295427-52295449 ATCAACCTGATACCAAAGCCTGG + Intergenic
1190759521 X:53427986-53428008 ATCCACCTGATCCCAAAGAAAGG - Exonic
1191060854 X:56294612-56294634 ATCATCCTGATACCAAAGACTGG + Intergenic
1191066628 X:56355101-56355123 ATCATCCTGATACCAAAGATTGG - Intergenic
1191263502 X:58356613-58356635 AAACAGCTGAACCCAAAGAAAGG - Intergenic
1191269041 X:58438244-58438266 AAACAGCTGAACCCAAAGAAAGG + Intergenic
1191581197 X:62763263-62763285 ATCCTCCTGAATCAAAAGAAAGG + Intergenic
1191581261 X:62764115-62764137 ATCCTCCTGAATCAAAAGAAAGG + Intergenic
1191745368 X:64480851-64480873 ATCAACCTGATACCAAAGCCTGG - Intergenic
1191751354 X:64546298-64546320 ATCATCCTGATCCCAAAGCCGGG - Intergenic
1192029302 X:67492003-67492025 ATCATCCTGATACCAAAGACGGG + Intergenic
1192041675 X:67629118-67629140 ATCATCCTGATACCAAAGACGGG - Intronic
1192726506 X:73758845-73758867 ATCACCCTGATACCAAAGACAGG - Intergenic
1192848513 X:74929534-74929556 CTCAGCCTGCTCCCAAAGAAGGG + Intergenic
1192883247 X:75310321-75310343 ATCATCCTGATACCAAAGACTGG - Intergenic
1193047507 X:77068516-77068538 ATCCATCCAAACCCAAAGAAAGG - Intergenic
1193072651 X:77322527-77322549 ATCCTCCTGATACCAAAGCCAGG + Intergenic
1193354649 X:80503887-80503909 ATCACCCTGATACCAAAGCAAGG + Intergenic
1193363039 X:80598474-80598496 ATCATCCTGATCCCAAAGCCTGG - Intergenic
1193431531 X:81412448-81412470 ATCCACATGAGACTAAAGAAGGG + Intergenic
1193503017 X:82303543-82303565 ATACACATGAACACAAAGAAGGG + Intergenic
1194182237 X:90726596-90726618 ATGACCCTGATACCAAAGAAAGG + Intergenic
1195553245 X:106192022-106192044 ATCATCCTGATACCAAAGACTGG - Intronic
1195749401 X:108149204-108149226 ATCTACCTGCTGCCAAAGACTGG - Intronic
1195757781 X:108216277-108216299 ATCCAGCTGATACCAAGGAATGG + Intronic
1196137075 X:112221655-112221677 ATCCCTCTGATTCCACAGAAAGG - Intergenic
1196474444 X:116066377-116066399 ATCATCCTGATACCAAAGACTGG - Intergenic
1196479113 X:116124847-116124869 ATCATCCTGATACCAAAGACTGG + Intergenic
1196490062 X:116255016-116255038 ATCATCCTGATACCAAAGACTGG + Intergenic
1196898394 X:120360054-120360076 GTCCCCCTGTTCCCAAAGGAAGG - Intergenic
1197518451 X:127467065-127467087 ATCCAACTGATCCTTCAGAAGGG - Intergenic
1197910100 X:131472937-131472959 ATCATCCTGATCCCAAAGCCTGG - Intergenic
1197915316 X:131528126-131528148 ATCAACCTGATACCAAAGCCTGG + Intergenic
1198250793 X:134877565-134877587 AACCACCTGTTCCCATCGAAGGG + Intergenic
1199085488 X:143624422-143624444 ATCCAACTGATTCAAAAGAATGG + Exonic
1199226389 X:145379793-145379815 GTACACTTGATCACAAAGAAGGG - Intergenic
1199540769 X:148955781-148955803 TCCCAGCTGAACCCAAAGAAAGG + Exonic
1200528865 Y:4308557-4308579 ATGACCCTGATACCAAAGAAAGG + Intergenic
1201080563 Y:10240652-10240674 ATCATCCTGATACCAAAGACGGG - Intergenic
1202035346 Y:20628003-20628025 ATCAACCTGATACCAAAGCCGGG - Intergenic
1202327621 Y:23708125-23708147 ATCATCCTGATACCAAAGCAAGG + Intergenic
1202543149 Y:25961927-25961949 ATCATCCTGATACCAAAGCAAGG - Intergenic