ID: 1190760465

View in Genome Browser
Species Human (GRCh38)
Location X:53433965-53433987
Sequence GCTTCTGAGGAGAAGGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 648
Summary {0: 1, 1: 1, 2: 1, 3: 51, 4: 594}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190760450_1190760465 15 Left 1190760450 X:53433927-53433949 CCAGACCATCCCCACGCTGTCGC 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1190760465 X:53433965-53433987 GCTTCTGAGGAGAAGGGGGGAGG 0: 1
1: 1
2: 1
3: 51
4: 594
1190760451_1190760465 10 Left 1190760451 X:53433932-53433954 CCATCCCCACGCTGTCGCCTGCC 0: 1
1: 0
2: 2
3: 28
4: 370
Right 1190760465 X:53433965-53433987 GCTTCTGAGGAGAAGGGGGGAGG 0: 1
1: 1
2: 1
3: 51
4: 594
1190760456_1190760465 -7 Left 1190760456 X:53433949-53433971 CCTGCCTGTTCTCCAGGCTTCTG 0: 1
1: 0
2: 9
3: 61
4: 538
Right 1190760465 X:53433965-53433987 GCTTCTGAGGAGAAGGGGGGAGG 0: 1
1: 1
2: 1
3: 51
4: 594
1190760452_1190760465 6 Left 1190760452 X:53433936-53433958 CCCCACGCTGTCGCCTGCCTGTT 0: 1
1: 0
2: 1
3: 12
4: 127
Right 1190760465 X:53433965-53433987 GCTTCTGAGGAGAAGGGGGGAGG 0: 1
1: 1
2: 1
3: 51
4: 594
1190760453_1190760465 5 Left 1190760453 X:53433937-53433959 CCCACGCTGTCGCCTGCCTGTTC 0: 1
1: 0
2: 1
3: 21
4: 754
Right 1190760465 X:53433965-53433987 GCTTCTGAGGAGAAGGGGGGAGG 0: 1
1: 1
2: 1
3: 51
4: 594
1190760454_1190760465 4 Left 1190760454 X:53433938-53433960 CCACGCTGTCGCCTGCCTGTTCT 0: 1
1: 0
2: 2
3: 9
4: 209
Right 1190760465 X:53433965-53433987 GCTTCTGAGGAGAAGGGGGGAGG 0: 1
1: 1
2: 1
3: 51
4: 594
1190760449_1190760465 16 Left 1190760449 X:53433926-53433948 CCCAGACCATCCCCACGCTGTCG 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1190760465 X:53433965-53433987 GCTTCTGAGGAGAAGGGGGGAGG 0: 1
1: 1
2: 1
3: 51
4: 594

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190760465 Original CRISPR GCTTCTGAGGAGAAGGGGGG AGG Intronic
900090255 1:917172-917194 GCTTGGGAGCTGAAGGGGGGTGG + Intergenic
900417122 1:2540373-2540395 GCATCTGTGGAGATGGGGTGGGG + Intergenic
900543981 1:3218334-3218356 GCTTTATCGGAGAAGGGGGGAGG + Intronic
900919154 1:5659768-5659790 ACTCCTGAGGGGAAGGGGGCAGG - Intergenic
901022007 1:6260568-6260590 GCTTCTCAGGGGACGGGGGCGGG - Intronic
901271604 1:7956251-7956273 GCTTCTGGGGAGCAGGGCTGAGG + Intronic
902234358 1:15048140-15048162 GCTCCTCAGGACATGGGGGGAGG - Intronic
902595941 1:17509548-17509570 GCTTCAGAGGGGCAGGGGAGAGG + Intergenic
902619173 1:17640413-17640435 GCTTCTGAGTGGGAGGGAGGTGG + Intronic
902776218 1:18676554-18676576 TCCTCTTAGGAGAAGGGGGTGGG - Intronic
903380834 1:22895960-22895982 ACTTAGGAGGAGGAGGGGGGAGG + Intronic
903391987 1:22971215-22971237 CATTTTGAGGAGGAGGGGGGTGG - Intergenic
903666117 1:25008783-25008805 TCATTTGAGGAGAAAGGGGGAGG - Intergenic
904370766 1:30046109-30046131 GCTTCTGAGACGAAGGTGAGGGG - Intergenic
904403997 1:30274521-30274543 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
904409631 1:30317686-30317708 GCCTCTGAGGAGAGGGGCTGGGG - Intergenic
904886837 1:33744399-33744421 GCTTCTGAAGAAACTGGGGGAGG + Intronic
905884574 1:41484817-41484839 GCCTCTGCAGTGAAGGGGGGAGG + Intergenic
905943539 1:41883390-41883412 GCTGCTTAGGGGAAGGGTGGTGG - Intronic
906439399 1:45827932-45827954 GAGGCTGAGGAGAAGCGGGGAGG - Intronic
906955565 1:50370983-50371005 GTTTCAGAGGAGTAGGGTGGAGG - Intergenic
907369651 1:53992657-53992679 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
908826347 1:68136211-68136233 TCTTGTGGGGAGAAGGGAGGGGG - Intronic
908844121 1:68307152-68307174 GCTTCAGGGGAGAAAGGGTGAGG + Intergenic
909238327 1:73180855-73180877 GCTCCTGGGCAGAAGGGGGCGGG - Intergenic
909474851 1:76071478-76071500 GCCTCTGAGGAGAGGGAAGGTGG + Intergenic
909535264 1:76728627-76728649 GATGCTGAGGAGGAGGGTGGAGG - Intergenic
909995687 1:82276542-82276564 GATTTTGAGGAGAATGGGTGGGG - Intergenic
910012880 1:82486982-82487004 CTTTCTTAAGAGAAGGGGGGGGG + Intergenic
910293664 1:85623073-85623095 TCTTCTGTGGGGAAGGGTGGAGG + Intergenic
911038693 1:93575456-93575478 GCTTTTCATGAGAAGAGGGGAGG + Intronic
911090155 1:94011426-94011448 CCTGCTGAAGAGAGGGGGGGTGG - Intronic
911275530 1:95853679-95853701 GCTGCTGTGCAGAAGGGGGCAGG + Intergenic
911660922 1:100500335-100500357 GCTTCTGTAGAGAAGAGGGGAGG + Intronic
911718548 1:101164443-101164465 GCTTCTGAGGATAAGAGTTGAGG + Intergenic
912174455 1:107140036-107140058 GCTTCTGTGGAGGAGCCGGGGGG + Intronic
912941096 1:114045575-114045597 GTTTTTGAGGAGAAGGAGGTAGG + Intergenic
913004567 1:114616278-114616300 GCTTCTCAGGAGAAAGAGGCAGG + Intronic
915087993 1:153401330-153401352 GGTGCTGTGGAGAAAGGGGGCGG + Intergenic
915436555 1:155911169-155911191 GGTTCGGAGGAGAATGGGGAGGG - Intronic
915534619 1:156527797-156527819 GTTCCTGAAGAGAAGGGTGGGGG - Intronic
916016727 1:160756332-160756354 GGTTCTGAGGAGAGAGGGGAAGG - Intergenic
916107467 1:161441952-161441974 GCGAGTGAGGAGAAGGCGGGCGG - Intergenic
916109052 1:161449370-161449392 GCGAGTGAGGAGAAGGCGGGCGG - Intergenic
916110639 1:161456751-161456773 GCGAGTGAGGAGAAGGCGGGCGG - Intergenic
916112225 1:161464161-161464183 GCGAGTGAGGAGAAGGCGGGCGG - Intergenic
916113812 1:161471542-161471564 GCGAGTGAGGAGAAGGCGGGCGG - Intergenic
918945321 1:191057436-191057458 GCCTGTGAGGAGGTGGGGGGTGG - Intergenic
919432293 1:197510840-197510862 GCTTCCTAGGAGATGGAGGGAGG + Intronic
919513468 1:198494250-198494272 GCTCCTGGGCAGAAGGGGGTTGG - Intergenic
919709297 1:200710369-200710391 GCCTGTGAGGGGAAGGGGGAGGG + Intergenic
920399943 1:205670256-205670278 GCTGCTGGGGAGATGGTGGGAGG + Intronic
920674760 1:208031265-208031287 GGTTCTCAGGAGAAGGGAGCTGG - Intronic
921706000 1:218323603-218323625 GCTTCTGGGTAGAAGGGGGAGGG - Intronic
922041703 1:221903889-221903911 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
922614460 1:226953484-226953506 GGGCCTGAGGAGAAGGGGAGAGG + Intronic
922673398 1:227532373-227532395 GCTGCTGTGGAGAATGGGGGTGG + Intergenic
922697646 1:227739476-227739498 GGGTCTGAGGAGCAGGGGAGGGG + Intronic
923306137 1:232690551-232690573 GCTGCTGAGTAGACGGGGGCCGG - Intergenic
923412201 1:233721699-233721721 TCTTCATAGGAGAAGGGGTGAGG + Intergenic
923627812 1:235628403-235628425 CCTTGTTAGGAGACGGGGGGGGG + Intronic
923674370 1:236066835-236066857 GCTTCTGGGGAGCAGGCTGGGGG - Intergenic
924158506 1:241206334-241206356 GCTACTCAGGAGACGGAGGGAGG - Intronic
924326619 1:242901270-242901292 GCTTCAGGGGAGAAGGTGAGGGG - Intergenic
924579042 1:245307687-245307709 GCTTCAGAGGAAAGGGAGGGAGG - Intronic
1062938820 10:1406935-1406957 GCTTCTGGGGAGGATGGGGATGG - Intronic
1063092413 10:2878971-2878993 GATTCTGAGTAGAAGGAGGGTGG - Intergenic
1063393053 10:5662519-5662541 GACTCTGTCGAGAAGGGGGGGGG + Intronic
1064540617 10:16401878-16401900 GCTTCTCAGGAGATGGAGGCAGG - Intergenic
1065242409 10:23720009-23720031 GGGCCTGGGGAGAAGGGGGGAGG + Intronic
1065425539 10:25599062-25599084 TCTTCTGAGGAGAATGTGCGTGG + Exonic
1065751150 10:28888988-28889010 GCTTATGAGGCCAAGGTGGGAGG - Intergenic
1066029239 10:31401165-31401187 GCTTATGAGGAAAATGGGGTTGG + Intronic
1066050862 10:31633443-31633465 ACTGCTGAGGAGCAGGTGGGTGG + Intergenic
1066201435 10:33145615-33145637 GCCTTTGAGGTGAAGGGGAGGGG - Intergenic
1067373434 10:45705754-45705776 GCTTCAGAGGAGAAGGGCCAGGG - Intergenic
1067380259 10:45766460-45766482 GCTTCAGAGGAGAAGGGCCAGGG + Intronic
1067507956 10:46872561-46872583 GCTTCAGAAGAGAAGGGCAGGGG + Intergenic
1067654295 10:48179284-48179306 GCTTCAGAAGAGAAGGGCAGGGG - Intronic
1067887960 10:50107114-50107136 GCTTCAGAGGAGAAGGGCCAGGG + Intronic
1068423394 10:56823782-56823804 GCCTCTTAGGAGAAGAGGGGTGG - Intergenic
1069534104 10:69240579-69240601 GCCTCTGTGGGGAAGGAGGGAGG + Intronic
1070718577 10:78740293-78740315 GCTGGTGAGGAGATGGGGGAGGG + Intergenic
1070848468 10:79543167-79543189 GCTGGTGAGGAGAAGGGTGTAGG + Intergenic
1071498553 10:86187816-86187838 GCTCCTTAGGAGATGGGTGGTGG - Intronic
1071599711 10:86952668-86952690 GCTTCTGAGGAAACGGGGCAAGG + Intronic
1071878024 10:89863572-89863594 GCTTTTGAGGGGAAAGGGGTGGG + Intergenic
1072753291 10:97999607-97999629 GTTTCTGAGAAGAAGGGGGCAGG + Intronic
1074377835 10:112952874-112952896 GCTTCTTAGAAGAGGGAGGGAGG - Intronic
1074878872 10:117636056-117636078 GCTTCCCAGGAGCAGAGGGGAGG - Intergenic
1074947625 10:118296565-118296587 TCCTCTGAGGAGAAGGAGGCAGG - Intergenic
1075634085 10:124018598-124018620 GCTTCAGAGGAGGAGGGGACAGG + Intronic
1075924226 10:126237064-126237086 GCATCTGGGGAAATGGGGGGAGG - Intronic
1076584985 10:131540890-131540912 GCATCTGAGGAGGGGGAGGGGGG - Intergenic
1077479270 11:2805853-2805875 GATTATGAGGTCAAGGGGGGAGG - Intronic
1078196041 11:9137958-9137980 GCTTCTGAAGAGATGAGGAGAGG - Intronic
1078536523 11:12179372-12179394 GCTGCTGGGGAGAAGGTGAGAGG - Intronic
1079526806 11:21400218-21400240 GCTTTTGAGGAGAGTGGGGATGG - Intronic
1080257487 11:30307175-30307197 GCTTCAGGGGAGAAGGGGCAAGG - Intergenic
1081576707 11:44323168-44323190 GCTGCTGGGGAGAAGGGAGAAGG - Intergenic
1081838322 11:46176183-46176205 GGTTCTGAGTAGAAGGGGGTGGG - Intergenic
1081907557 11:46679325-46679347 GCCTCTGGGGTGAAGGGAGGGGG - Intronic
1083258965 11:61513024-61513046 GCCTCTGGGGAGTAGGGGGCAGG + Intergenic
1083306850 11:61765939-61765961 GCAGCTGCGGGGAAGGGGGGCGG - Exonic
1083396413 11:62395675-62395697 ACTTCAGAGGAGCAGGTGGGGGG - Intergenic
1083674743 11:64319057-64319079 GTTTGGGAGGAGAAGGGGGAAGG - Intronic
1083692090 11:64415515-64415537 GGGTCTGAGGAGAGGGGAGGAGG + Intergenic
1083799420 11:65037939-65037961 GCCTCTGAGGGGAAGGTGCGGGG - Intronic
1084326158 11:68401390-68401412 GGTTCTGATGAGCAGGCGGGCGG - Intronic
1084361485 11:68670840-68670862 GGTTCTGAGGGGCAGGGGGCGGG - Intergenic
1084372999 11:68756834-68756856 GTTTCTGAGGGGGAGGGGGCTGG + Exonic
1084622660 11:70283757-70283779 GCTTGCGGGGAGAAGGGGGACGG + Intronic
1084691319 11:70728539-70728561 GCTTCTGAGTGGAACGGGGCTGG + Intronic
1085043601 11:73340997-73341019 GCATGTGGGGAGAAGGGAGGAGG + Intronic
1085558822 11:77451248-77451270 GCTTCAGGGGAGAAGGGTGAGGG - Intronic
1086840009 11:91673401-91673423 GCTTCAGGGGAGGAGTGGGGAGG - Intergenic
1088468022 11:110162870-110162892 GCAGCTGAGAAGAAGGGAGGGGG - Intronic
1088487607 11:110355873-110355895 GCTACTGGGGAGTAGGGAGGGGG - Intergenic
1089558810 11:119332992-119333014 GATTCTGAGGCCAAGGGTGGAGG + Intergenic
1089681615 11:120121889-120121911 GGTTCTGAGGAGAGGGGTGCTGG + Intronic
1090310355 11:125731260-125731282 GCTTCTGAGGAGCAGCTCGGAGG + Intergenic
1090844266 11:130517861-130517883 GCTGCTGAGGAGAACAGTGGTGG - Intergenic
1091693626 12:2613265-2613287 CCCTCTGTGGAGAAGGGGGAAGG + Intronic
1091696830 12:2633363-2633385 GCCTCTGTGGAGAAGGGGTAGGG + Intronic
1091937341 12:4444317-4444339 GCTTTCTAGGAGAAGGGGGATGG - Intronic
1092066177 12:5591281-5591303 GCTTCTTAGGGGAAAGGGTGTGG + Intronic
1094141666 12:27188158-27188180 GCTTCTGAGGCTGAGGGTGGGGG - Intergenic
1094506362 12:31064808-31064830 GCTTCTGTGGAGTTGGGGTGTGG - Intergenic
1096253252 12:50047075-50047097 GCTTCCCAGGAAAAGGGTGGAGG + Intergenic
1096700613 12:53380470-53380492 GCCTCCGAGGAGGAGGGGGATGG + Intronic
1096788076 12:54029220-54029242 CAGTCTGAGGAGAAGGGAGGGGG + Intronic
1096793045 12:54056992-54057014 GTTTGTTAGGAGAAGGTGGGAGG + Intergenic
1096829263 12:54301547-54301569 ACTTCTGAGGCTGAGGGGGGAGG - Intronic
1097697940 12:62792714-62792736 GCTTCTAGGGAGGAGGGGGAGGG - Intronic
1098951574 12:76645308-76645330 GCTCCTGGGCAGAAGGGGGCGGG + Intergenic
1099664737 12:85613544-85613566 GCTTCAGGGGAGAAGGGCGAGGG + Intergenic
1099693477 12:85991460-85991482 ACTTCTGGGGGGAAGGGGGTGGG - Intronic
1100856757 12:98764169-98764191 TCTTTTGAGGAGCAGGGGAGAGG - Intronic
1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG + Intronic
1101343901 12:103867251-103867273 GCCTCTCAGGAGAAGGGAGATGG + Intergenic
1102026974 12:109719241-109719263 GCTTCTCAGCAAAATGGGGGTGG - Intronic
1102763287 12:115408290-115408312 GTTTCTGAGGGGAAGGTGGAAGG + Intergenic
1103620801 12:122186052-122186074 GCTTCCGGGGAGCAGGGGGTGGG + Intronic
1103946747 12:124531475-124531497 GCCTGTGGGGAGAAGGAGGGAGG + Intronic
1103985677 12:124765845-124765867 GCTTCTGAGGAGCCTGGGAGAGG - Intergenic
1103998171 12:124843277-124843299 CTTTCTGTGGAGATGGGGGGGGG + Intronic
1104371472 12:128227588-128227610 GCTTCTTACGAGCTGGGGGGAGG + Intergenic
1105618860 13:22047596-22047618 GCTACTGAGGAGAAAGAGGTGGG - Intergenic
1106333571 13:28762815-28762837 GTCTCTGAGGAGGAGCGGGGAGG + Intergenic
1106352064 13:28940449-28940471 GTTTGTGGGGAGAAGGGGCGTGG + Intronic
1106353165 13:28954583-28954605 GATTCTGAGGAGGAAGGTGGTGG + Intronic
1106379514 13:29223089-29223111 GCTTCTGGGCAGAAAGGGGTGGG + Intronic
1106956549 13:34943685-34943707 GCTTCTGAGATGGAGGGGGATGG - Intronic
1107159473 13:37209317-37209339 ACTTCTGAGGAGAATGGAGTAGG - Intergenic
1107549326 13:41459639-41459661 GCTTTTGAGGTGAAAGGGGATGG + Intronic
1107882294 13:44843268-44843290 GAGTGGGAGGAGAAGGGGGGTGG + Intergenic
1110655713 13:77996225-77996247 GCTACTGAGGTGAAGTGAGGAGG - Intergenic
1110712335 13:78663999-78664021 GCTAGTGAGGAGTGGGGGGGTGG + Intergenic
1111963895 13:94841251-94841273 TCTTCTGAGGGCAAGGGGTGGGG + Intergenic
1112036736 13:95503817-95503839 GCTGCTAGGGAGAAGGGGGAGGG + Intronic
1112211720 13:97384493-97384515 GCTGCTGTGGAGAAGAGGTGTGG + Intronic
1113243577 13:108368169-108368191 GCTTGATAGGAGAAGGTGGGAGG + Intergenic
1113363792 13:109656841-109656863 GCATCTGAGGAGTGGGGGAGTGG + Intergenic
1113437965 13:110307618-110307640 GCTTGGGAGTAGAAAGGGGGAGG + Intronic
1115891378 14:38033425-38033447 ACTTCTGATGAGTAGGGTGGTGG + Intronic
1116441697 14:44962011-44962033 GCTACAGCGGAGAAGGGAGGAGG - Intronic
1118101824 14:62614340-62614362 CCTACTGATGTGAAGGGGGGGGG - Intergenic
1119858427 14:77918598-77918620 GCCTCTGAGTAGGAGGGGGCTGG + Intronic
1119948839 14:78723484-78723506 GATTCTTAGGAGGAGTGGGGAGG + Intronic
1120727510 14:87961628-87961650 GCTTCAGAGGAGAAAGGAGAAGG - Intronic
1121584321 14:95052408-95052430 GCTTCCGACGAGGAGGAGGGCGG - Intergenic
1121899908 14:97684462-97684484 GCTCCTGAGGAGTAAGGGGCAGG - Intergenic
1122947141 14:105017161-105017183 GCTCCTGGGGAGGTGGGGGGCGG + Intronic
1122974350 14:105164959-105164981 GCTTATGAGGAGAACGGGATGGG - Intronic
1123185377 14:106511576-106511598 GCTTCTGTAGAGAAGGGATGTGG + Intergenic
1202906014 14_GL000194v1_random:72883-72905 CCTTCCGAGGAGGAGCGGGGCGG + Intergenic
1123572998 15:21634234-21634256 GCTTAGGAGGAGTAGGTGGGTGG + Intergenic
1123609617 15:22076819-22076841 GCTTAGGAGGAGTAGGTGGGTGG + Intergenic
1124453805 15:29822356-29822378 GCTTCCGAGGAGACGCCGGGAGG - Exonic
1124469459 15:29969708-29969730 GCTTCTCAGGAGAATGAGGGGGG + Intergenic
1125752359 15:42037187-42037209 GCTCCTGGGTAGAAGGGGGTGGG + Intronic
1126112943 15:45186415-45186437 TCTGCTGAGGAGAAGGGGGCAGG + Intronic
1126483711 15:49155756-49155778 ACTTCGGAGGAAACGGGGGGTGG - Intronic
1127041591 15:54983029-54983051 GCCTTTGAGGAGAAGGAGAGAGG - Intergenic
1127184672 15:56465594-56465616 GCTTCTGCGGGGGGGGGGGGGGG - Intergenic
1127430602 15:58903536-58903558 GCATCTGACGGGGAGGGGGGAGG + Intronic
1128224041 15:65989366-65989388 GCTGGAGAGGAGAAGGGAGGTGG - Intronic
1129194550 15:73956157-73956179 GCATCTGAGGTGCAGGGGGAGGG - Intergenic
1129264308 15:74385811-74385833 GCTTCTGTGGGGGAGGGGGAAGG - Intergenic
1129267107 15:74399651-74399673 GCCTCTGAGGAGCAGATGGGAGG + Intergenic
1129416977 15:75389516-75389538 GGTTCTGAAGAGAGGAGGGGAGG - Intronic
1129656054 15:77526506-77526528 GGTTCTGAGAAGATGGGGGAAGG - Intergenic
1129686382 15:77688433-77688455 GCTTCTGATAAGATGGGGAGAGG + Intronic
1129874338 15:78963109-78963131 GCTTCAGAGCAGGAGTGGGGTGG - Intronic
1130115180 15:81000533-81000555 GCTTCTGGGCTGAAGGGAGGAGG - Intergenic
1130460660 15:84156642-84156664 GCTGCTGAGGTGATGGGGGAAGG - Intergenic
1131071756 15:89470608-89470630 GCTCCTGGGAAGAAGGGGTGAGG - Intergenic
1131303239 15:91218398-91218420 GCTTCAGGGGAGAAGGGGAAGGG + Intronic
1131386434 15:92012024-92012046 GCCTCAGAGGAGAAGGAGGGTGG + Intronic
1131676109 15:94672348-94672370 GCTTCTAGGGAGGAGGGGGTAGG + Intergenic
1131999317 15:98163374-98163396 GCTTCTCAGCAGAAAGGGGCAGG - Intergenic
1202981859 15_KI270727v1_random:368603-368625 GCTTAGGAGGAGTAGGTGGGTGG + Intergenic
1132854406 16:2038492-2038514 GCTGCTGAGGGGAGGGGGCGGGG - Exonic
1132872399 16:2121775-2121797 GGTCCTGGGGAGCAGGGGGGTGG - Intronic
1133229134 16:4358230-4358252 GCATCTCAGCAGAAGGGGGTAGG + Intronic
1133412667 16:5581120-5581142 GATCCAGAGGAGAAGGGGGCAGG + Intergenic
1134038410 16:11049618-11049640 GCTTCTGAGTGGAAGGGGGTGGG + Intronic
1134551456 16:15140857-15140879 GGTCCTGGGGAGCAGGGGGGTGG - Intergenic
1135057105 16:19240688-19240710 GCTTCTGGGCAGAAGAGGGCTGG - Intronic
1135597766 16:23756369-23756391 GCATCTGGGGAGAGGGTGGGAGG - Exonic
1135996830 16:27256402-27256424 GCTTGTGAGGAGAAGCAGAGTGG - Intronic
1136272721 16:29158188-29158210 TCTTCTGAGGAGAATGGGATGGG + Intergenic
1136458592 16:30395978-30396000 GCCTCTGGGGAGATAGGGGGAGG + Intronic
1137401652 16:48158422-48158444 GCTCCTGTGCAGAAGGGTGGAGG + Intergenic
1137588605 16:49679721-49679743 GCTCCTGAGCAGAAAGGGGCGGG + Intronic
1137617455 16:49856145-49856167 GGTTGGGAGGAGGAGGGGGGCGG - Intronic
1138492621 16:57385087-57385109 GCTTCGGAGGGGAAGGAGTGGGG + Intergenic
1139970283 16:70770058-70770080 GCATCCCAGGAGAAAGGGGGAGG - Intronic
1140457292 16:75112797-75112819 GCTGCTGGGGAGAGGTGGGGAGG - Intronic
1141212607 16:81995189-81995211 GCTTCTGAGGAGTGTGTGGGAGG - Exonic
1141689307 16:85587471-85587493 GCTTCAGAGGGGGAGGGGGAGGG + Intergenic
1141832433 16:86517200-86517222 GCTTCTAAGGAGTAAAGGGGTGG + Intergenic
1142183952 16:88685743-88685765 GCTTCTGGGGTGAAGGGAGGTGG + Intronic
1142476039 17:190772-190794 GCTACTCAGGAGGAGTGGGGAGG + Intergenic
1142711904 17:1728041-1728063 GCTGCTGAGGAGGAGGAGAGCGG + Exonic
1142981897 17:3677254-3677276 GCCTCTGAGGAGGGGTGGGGAGG + Intronic
1143165558 17:4895650-4895672 GCCTCAGATGAGAATGGGGGCGG + Intronic
1143530872 17:7502688-7502710 GCTTTTGAGAAGAAGTGAGGAGG + Exonic
1144805637 17:17965099-17965121 GCTTCTGTGCAGAATTGGGGAGG - Intronic
1146197761 17:30827703-30827725 GCTACTCAGGAGAATGGGGCAGG - Intergenic
1147140570 17:38458504-38458526 GCTTCTCAGGAGACAGGGAGGGG + Intronic
1147369010 17:39978894-39978916 GCTACTCAGGAGAAGGAGGCAGG + Intergenic
1148060514 17:44832874-44832896 GCTTCAGGGGAGAAAGGGGCGGG - Intergenic
1148213219 17:45820491-45820513 CCTTCTAAGGAGATGGGGAGGGG - Intronic
1148853213 17:50564812-50564834 GATTCTGGGGAGAAGGGCTGGGG + Intronic
1149123170 17:53195277-53195299 GCTTCTGAAGATAAGGGGCTGGG - Intergenic
1149474018 17:56944108-56944130 GCTTCGGGGGCGAAGGTGGGAGG - Intronic
1149581634 17:57754685-57754707 GCCTGGGAGGAGAAGAGGGGAGG + Intergenic
1149614605 17:57987896-57987918 GCTGCTGAGGTGAAAGGAGGCGG - Intronic
1149884642 17:60328041-60328063 GCTCCTGGGCAGAAGGGGGCAGG + Intronic
1150292711 17:63990797-63990819 GCTGCTGTGGGGACGGGGGGTGG - Intergenic
1151216354 17:72579382-72579404 GATTCTGAGGGGCAGGGGGAAGG - Intergenic
1152509784 17:80778685-80778707 GCTTCTCGGGAGAAGGAGGCAGG + Intronic
1152685857 17:81693635-81693657 GCAGCTGAGGACAAGCGGGGAGG - Exonic
1152937065 17:83145388-83145410 GCTTCTGTGGTGAATCGGGGGGG - Intergenic
1153181905 18:2444732-2444754 GCTTCAGAAGGGAAAGGGGGAGG + Intergenic
1153284742 18:3447861-3447883 ACTTTCCAGGAGAAGGGGGGAGG - Intronic
1156398196 18:36717945-36717967 GATGATGAGGAGAAGGGGGATGG + Exonic
1156460401 18:37318457-37318479 ACTTCTGGGGAGAAGGGGAAGGG - Intronic
1157136777 18:45063794-45063816 GCTTCTGGAGAGAAGGGCGTGGG - Exonic
1157508618 18:48251110-48251132 GCTACTCAGGAGAATGGGGCAGG + Intronic
1157533313 18:48440464-48440486 GCCTCTGTGGAGAAGGGGAGAGG - Intergenic
1157600096 18:48888441-48888463 GCTTCTCAGGAGAAGGGGGGCGG - Intergenic
1158015688 18:52780759-52780781 TCTTCAGGGGAGAAGGGAGGAGG + Intronic
1158023393 18:52869562-52869584 GCTCCTGGGCAGAAGGGGGTGGG - Intronic
1158198096 18:54910590-54910612 GCTCCTGGGCAGAAGGGGGCAGG - Intronic
1159400271 18:67923325-67923347 TCTTCTAATGACAAGGGGGGAGG + Intergenic
1159674524 18:71265368-71265390 GCTACTCAGGAGAATGGGGCAGG - Intergenic
1159766912 18:72502562-72502584 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
1159787357 18:72730167-72730189 GCTTGTGAGGTGATGGGGAGGGG - Intergenic
1159973083 18:74677332-74677354 CCTTCTGAGGCCAAGGTGGGTGG - Intronic
1160594101 18:79962458-79962480 GCTGCTGAGGAGGAGGAGGCAGG - Intergenic
1161059671 19:2208591-2208613 GCCTCAGAGGAGAAGGCGAGAGG - Intronic
1161168202 19:2799885-2799907 GCTTCTGTGCTGAAGGGCGGCGG + Intronic
1161626143 19:5327970-5327992 TCTCCTGAGGAGAAGGTGAGAGG - Intronic
1161930162 19:7334040-7334062 GTTTCTTAGGAGAATGGGAGGGG - Intergenic
1161990433 19:7681353-7681375 GCTCCTGAAGAGAAATGGGGTGG - Intronic
1162786870 19:13040530-13040552 GCTCCTGAGGAGAGGGAGGGAGG - Intronic
1162863612 19:13526888-13526910 GCTTCTTGGGAGTTGGGGGGCGG + Intronic
1162977608 19:14217583-14217605 GCACCTGGGGAGAAGGGGCGGGG - Intergenic
1163314182 19:16531311-16531333 GCCTCTTGGGAGAAGGAGGGAGG + Intronic
1163643762 19:18476627-18476649 GCCTCAGAGGAGAAGGGCTGAGG + Intronic
1164658689 19:29942883-29942905 GCTTCTGAGCTGAAGGCGTGCGG + Intronic
1164959825 19:32418166-32418188 GTTTCAGAGGACAAGGGTGGTGG - Intronic
1165083897 19:33329313-33329335 GCTGCTGAGGACCAGGGGAGGGG - Intergenic
1166381898 19:42359076-42359098 GCTGTTGGGGAGACGGGGGGTGG - Exonic
1166388036 19:42392950-42392972 GGTTCTGGGGAGAAAGGGGCTGG - Intergenic
1166920413 19:46225411-46225433 TGTTCTGAGGAGAAGGAAGGAGG - Intergenic
1166992998 19:46704476-46704498 GCTGGTGAGGAGATGGGGGATGG - Exonic
1167129033 19:47572644-47572666 GATTCTGAGCAGAAGGGGCCTGG + Intergenic
1167270324 19:48502382-48502404 GCTACTAAGGGGAAGGGGGAAGG - Intronic
1167346221 19:48947125-48947147 GCTCCTGGGCAGAAGGGGGCAGG + Intergenic
1167593140 19:50415105-50415127 GGATCTGAGGAGGAGGGGGCTGG - Intronic
1168063983 19:53909261-53909283 GCTACTGCGGAGGAGGGGAGGGG - Intergenic
1168076469 19:53982991-53983013 GCTTCGGAGGGGGAGGGGGGCGG - Exonic
1168112341 19:54200495-54200517 GCTACTGGGGAGGAGGTGGGAGG + Intergenic
1168271383 19:55251639-55251661 GCATCTGGGCAGAAGTGGGGAGG - Intronic
1168389420 19:55993584-55993606 GGTTGAGAGGAGGAGGGGGGAGG - Intergenic
1202647013 1_KI270706v1_random:152495-152517 TCTTCGGAGGAGGAGAGGGGCGG - Intergenic
924969711 2:114599-114621 GCTTCTGAGAAGAACAGAGGTGG + Intergenic
925175531 2:1781256-1781278 CCACCTGAGGAGAAGGGGTGCGG + Intergenic
926241792 2:11094341-11094363 GCCTGTGAGCAGAAAGGGGGAGG - Intergenic
926395739 2:12440657-12440679 GCTGCTGGGGAGAGGGAGGGAGG - Intergenic
926934598 2:18074271-18074293 GCTTCTGAGGATGAGGGGACAGG - Intronic
927533879 2:23836999-23837021 GCTCCTGGGCAGAAGGGGGTGGG - Intronic
927542837 2:23927620-23927642 GCTTAAGAAGAGAAGGGGGGGGG + Intronic
927688611 2:25191185-25191207 ACTTCTGAGGACAAGGTCGGAGG + Intergenic
930110574 2:47675446-47675468 GCTTCTGAGAAGCAGGAGGGAGG - Intergenic
930611991 2:53554162-53554184 GCTCCTGGGCAGAAGGGGGAGGG + Intronic
930620767 2:53641357-53641379 GCTTCTGTGGAGGTGGGGCGGGG + Intronic
931321910 2:61180328-61180350 TGTTCTGAGGCGAAGGGGGAAGG - Intronic
931938458 2:67225019-67225041 CCTTCTTGGGAGAAGGGTGGTGG - Intergenic
932054768 2:68432943-68432965 GCTCCTGAGTAGAAGTGGGTGGG - Intergenic
932165766 2:69505088-69505110 GCTGTTGGGGAGAAGGAGGGAGG - Intronic
932276656 2:70456673-70456695 GCTTATGTGGAGAAGGGAAGGGG + Intronic
932369347 2:71174574-71174596 GCTGCAGAGGGGAAGGAGGGAGG + Intergenic
932405749 2:71511863-71511885 GCTCCAGAGGAGTAGGGGGCGGG - Exonic
933774529 2:85764208-85764230 GCTTCTGGGGAGCATAGGGGAGG + Intronic
933894435 2:86797832-86797854 GCTTTTCATGAGAAGGCGGGTGG - Intronic
934102706 2:88668067-88668089 GCTTCAGAGGATAAGAGGTGAGG - Intergenic
934500587 2:94857634-94857656 TCTTCCGAGGAGGAGCGGGGCGG - Intergenic
935664298 2:105496776-105496798 GGATGTGAGGAGAAGGGGTGAGG + Intergenic
936573169 2:113633235-113633257 GCTACTGAGGAGGAGGAGGTGGG - Intronic
937655563 2:124371169-124371191 GCTTCAGAGAAGAAGGGTGAGGG + Intronic
937905498 2:127050968-127050990 GCCACCGAGGAGAAGAGGGGCGG + Intronic
938087360 2:128410209-128410231 GCCTCTGAGGGAAAGGGTGGTGG + Intergenic
938501934 2:131834949-131834971 GCTTCTGAGCAGGAGGGGGTCGG + Intergenic
938548226 2:132353628-132353650 TCTTCGGAGGAGAAGAGGGGCGG + Intergenic
939141873 2:138363725-138363747 GCTTCAGGGGAGAAGGGATGAGG - Intergenic
940092728 2:149938944-149938966 GCTGCAGAGCAGAAGGAGGGAGG - Intergenic
940694300 2:156959560-156959582 GCTCCTGAGCAGAAAGGGGCGGG - Intergenic
941718302 2:168786837-168786859 GCTACTCTGGAGGAGGGGGGAGG - Intronic
941834563 2:170002384-170002406 GCTGCTGAGGAAAATGGGAGAGG - Intronic
941876341 2:170437370-170437392 GCTTCAAGGGAGAAGGGGGTGGG - Intronic
941949045 2:171133940-171133962 GCTACTTGGGAGAAGGTGGGAGG - Intronic
942030710 2:171956062-171956084 GCTACTGAGGAGAATGAGGCAGG + Intronic
943690101 2:190860924-190860946 GCCTCTGAGGGGCGGGGGGGGGG - Intergenic
943928510 2:193819713-193819735 GCTCCTGAGCAGAAAGGGGTGGG - Intergenic
944840078 2:203616265-203616287 ACTGCTTAGGAGAATGGGGGAGG + Intergenic
946307603 2:218865096-218865118 GCTTCTGATGAGAACAGGGCAGG - Intronic
948551570 2:238776157-238776179 GCTGCTCATGAGAAGGGGAGTGG + Intergenic
948575419 2:238946760-238946782 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
948647846 2:239419454-239419476 GCTGCTGAGGAAAGGGTGGGTGG + Intergenic
948691947 2:239711684-239711706 GATTCTGAGGAGAAAAGAGGAGG - Intergenic
1168757668 20:327418-327440 GCTTCTGGGGAGGAGGGGGCTGG + Exonic
1169072044 20:2738688-2738710 GGGCCTGAGGAGAAGGGGAGGGG - Intronic
1169137381 20:3205335-3205357 TCTTTTGAGGGGAAGGGGAGGGG + Intergenic
1169146395 20:3255281-3255303 GCTTCTGCAGAGATGGGGAGTGG + Exonic
1169523949 20:6402737-6402759 GCTTCTGAGAAGAAAGGAGCTGG - Intergenic
1170743991 20:19081909-19081931 GGTGGTGAGGAGAAGGGGGGTGG - Intergenic
1170984390 20:21244601-21244623 GCTTCTGAGGATGAGGAGAGAGG - Intronic
1171236923 20:23534938-23534960 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
1171877100 20:30586400-30586422 TCTTCGGAGGAGAAGAGGGGCGG + Intergenic
1171891810 20:30724336-30724358 CCTTCCGAGGAGGAGCGGGGTGG - Intergenic
1172180024 20:32997245-32997267 GTTTCTGAGGAGGAAGGAGGAGG - Intronic
1172231208 20:33337495-33337517 GCTGCTGAGGAGGAGGACGGGGG + Intergenic
1172373040 20:34410597-34410619 ACTTGGGAGGATAAGGGGGGAGG + Intronic
1172461227 20:35120420-35120442 GCCTGTGAGGAGAGGGGAGGAGG - Intronic
1173321255 20:41989277-41989299 GCTTCAGAGGAGGAGGGAAGGGG - Intergenic
1173362218 20:42355039-42355061 GCCTCTGAGAAGGAGTGGGGTGG - Intronic
1173824688 20:46040690-46040712 GATTCTGAGGGGCAGGGAGGGGG - Intronic
1173858091 20:46263928-46263950 GCATCTGAGGAAGAGGGTGGTGG + Intronic
1173884585 20:46446012-46446034 GCTCCTGGGCAGAAGGGGGCAGG - Intergenic
1174216605 20:48921197-48921219 GCGGCGGAGGGGAAGGGGGGAGG - Intergenic
1174655251 20:52166561-52166583 GCTTGTGAGGCTAAGGTGGGAGG - Intronic
1174807726 20:53618883-53618905 GCGACTGAGGAGGTGGGGGGGGG + Intergenic
1175091355 20:56507235-56507257 GCTACTGCGGAGATGGGGAGTGG - Intronic
1175285772 20:57835881-57835903 GCTTTCGAGGAGAAGGCGTGAGG + Intergenic
1175814359 20:61875859-61875881 GCTACAGAGGAGATGGGGGACGG - Intronic
1175815811 20:61882729-61882751 GCGTCTCAGGAGAATGGGAGAGG + Intronic
1176604856 21:8820279-8820301 TCTTCGGAGGAGGAGAGGGGCGG + Intergenic
1176625369 21:9087639-9087661 CCTTCCGAGGAGGAGCGGGGTGG + Intergenic
1176867878 21:14063829-14063851 CCTTCCGAGGAGAAGCAGGGCGG + Intergenic
1176998820 21:15587110-15587132 GCTTCAGAGGAGAAGGGGCAAGG - Intergenic
1177404316 21:20645790-20645812 GCTTCTGGGAAGAAAGGGGTGGG + Intergenic
1177762591 21:25419045-25419067 GCTTCTGAGGATGTGTGGGGTGG - Intergenic
1179085884 21:38217302-38217324 GATTGTGAGGAGAAGAGTGGGGG + Intronic
1179143500 21:38748118-38748140 GGGTCTGAGGAGCAGGGGAGGGG - Intergenic
1179286728 21:39983901-39983923 GCTTCAGAGGACAATGGGGAAGG - Intergenic
1180095777 21:45554903-45554925 GCTTCTGGGGAGAAGGCGAGGGG - Intergenic
1180347146 22:11711884-11711906 TCTTCGGAGGAGGAGAGGGGCGG + Intergenic
1180354894 22:11829974-11829996 TCTTCGGAGGAGGAGAGGGGCGG + Intergenic
1180383357 22:12162357-12162379 TCTTCGGAGGAGGAGAGGGGCGG - Intergenic
1180853949 22:19035005-19035027 GCTACTGAGGAGAGGATGGGAGG + Intergenic
1180949555 22:19714953-19714975 GCTTCAGAGGAGAGGAGTGGGGG + Intronic
1181305833 22:21916774-21916796 GCTTCAGAGGAGCAGGGGTGTGG + Intergenic
1181361433 22:22340398-22340420 GCTTCTGAGGACCAAGGGCGTGG - Intergenic
1181402188 22:22656679-22656701 TCTTCTGTGGAGAATGGAGGTGG - Intergenic
1181579024 22:23816684-23816706 GCTTCAAAGAAGAAGGGGTGAGG + Intronic
1182446097 22:30390475-30390497 GTATCTGAGGAGAAGGGGACTGG + Intronic
1182554253 22:31120450-31120472 TCTTGTCAGGAGAAGGGGGTAGG - Intergenic
1182586197 22:31345646-31345668 GCTGCTGAGGGGAAGGGAGGGGG - Exonic
1183024980 22:35058263-35058285 GCTTCTGAGCAGAAAGGGACGGG - Intergenic
1183942015 22:41301422-41301444 GCACCTGGGGAGAAGGGCGGGGG - Intergenic
1183969792 22:41468425-41468447 GCCTCTGATGAGAAGAGGGCGGG - Intronic
1184031343 22:41896700-41896722 GCACCTGAGGAGAGGGGGAGGGG + Intronic
1184512780 22:44942998-44943020 CCTTCTGAGGATGGGGGGGGGGG - Intronic
1184601950 22:45549010-45549032 GCTGCTGAGGGGAGGGGAGGAGG - Intronic
1184865849 22:47201602-47201624 GCTTCTGGGCCGAAGGGGGCGGG - Intergenic
1185089175 22:48756320-48756342 CCTTCTGGGGTGAAGGGAGGGGG + Intronic
1185427016 22:50777645-50777667 GCTACTGAGGAGGAGGAGGTGGG + Intronic
949770613 3:7573115-7573137 GGTTCTGATGAGGAGGGGTGAGG - Intronic
950132736 3:10558439-10558461 GCTTCTGAGAAGGTGGGAGGAGG + Intronic
950168102 3:10816529-10816551 GATAGTGAGGAGAAGGGGAGGGG + Intronic
950433677 3:12966443-12966465 CCTTCTGAGGAGCAGGGGGGTGG - Intronic
950552505 3:13675284-13675306 GCTACTGAGGTGATGAGGGGAGG - Intergenic
950556556 3:13699472-13699494 GCATCTGAGGTGATGGGGTGTGG - Intergenic
950917428 3:16660088-16660110 GCTTCAGAGGAGAAGAGCAGGGG + Intronic
952297494 3:32074127-32074149 GGTTCTGAGGTGCAGGGAGGTGG - Intronic
952490711 3:33870010-33870032 GCTGATGAGGGGAAGGGGGATGG + Intergenic
953187410 3:40651750-40651772 GATGCTGAGGAGGAGAGGGGAGG - Intergenic
953203355 3:40797839-40797861 GTTTCTGAGTAGCAGGAGGGTGG + Intergenic
953250064 3:41237363-41237385 GCTACTGGGGAGACGGGGGCAGG + Intronic
953925789 3:46981859-46981881 CCTCCTGAGGGGATGGGGGGTGG - Intronic
954196892 3:49002311-49002333 GCATCTGAGGAGAAGGCCGGGGG - Intronic
954737002 3:52715046-52715068 GCTACTGGGCAGAAGGGGGCGGG + Intronic
955450991 3:59066296-59066318 GCTTCTGAGGGTAGGGGTGGTGG - Intergenic
956636110 3:71367161-71367183 ACTTCTGTGCAGAAGGAGGGAGG + Intronic
956722475 3:72130552-72130574 ACTTCTGCGGAGGAGGGGTGTGG - Intergenic
956728973 3:72179151-72179173 GCTTCAGGGGAGAAGGGTTGGGG - Intergenic
957039387 3:75325737-75325759 GCTACTGAGGCCAAGGTGGGAGG + Intergenic
957287076 3:78230761-78230783 GCTTCAGAGGAGAAGGAGGATGG + Intergenic
957638318 3:82815576-82815598 GTTCCTGAGCAGAAGGGGGTGGG - Intergenic
959056748 3:101574522-101574544 GATTCCGAGGAGAAGGGAGATGG + Intronic
959189189 3:103088238-103088260 GCTTCTGAGGAGATAGGTGTGGG - Intergenic
959344584 3:105177294-105177316 GCTTCTGGGGAGAAGGGCAGAGG + Intergenic
959495749 3:107049339-107049361 GCTTCCCAGGAGAAGAGGGAAGG - Intergenic
960596787 3:119414486-119414508 GCTTCTGAGGGGAAAGGCTGTGG + Exonic
960634257 3:119768189-119768211 GCTCCTGGGCAGAAGGGGGCAGG - Intergenic
960712675 3:120546578-120546600 ACTTCTGTGAAGAATGGGGGAGG - Intergenic
960727680 3:120686976-120686998 GCTTCAGGGGAGAAGGGGTAAGG + Exonic
963146346 3:141999141-141999163 GCTGCGGAGGAGAAAGAGGGAGG - Intronic
963167521 3:142220616-142220638 CATTCTGAGGAGAAGGGTAGAGG - Intronic
964664422 3:159156385-159156407 ACTCCTGAGGAGTAGAGGGGAGG + Intronic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
967691480 3:192479164-192479186 ACTGGTGAGGAGAAGGAGGGAGG - Intronic
968076018 3:195816496-195816518 CCTTGTAAGGAGAAGGGCGGAGG - Intergenic
968322936 3:197787442-197787464 TCTACTGAGTAGAAGGGGGAAGG + Exonic
968353373 3:198080885-198080907 TCTTCGGAGGAGGAGCGGGGCGG - Intergenic
968480035 4:829191-829213 GCATCTGAGGAGCAGAGGGCTGG - Intergenic
968534006 4:1112788-1112810 GATACCGAGGAGATGGGGGGAGG - Intronic
968959588 4:3736316-3736338 GCTTCTGGGCAGCAGGGGGTGGG - Intergenic
969133007 4:5005449-5005471 GCTTCTGCAGAGAAGGGAGGAGG - Intergenic
969239133 4:5888040-5888062 GCCTCTGGGGACAATGGGGGTGG - Intronic
969398752 4:6939727-6939749 GTTCCTGAGGAGAGGGGTGGGGG + Intronic
969429532 4:7146054-7146076 GCTGCTGGGGTGAATGGGGGAGG + Intergenic
969597400 4:8157193-8157215 GCATCTGACGAGAAGGGGTGTGG - Intronic
970474727 4:16410770-16410792 GCTTAAGATGAGAGGGGGGGGGG - Intergenic
972159974 4:36212135-36212157 GCTACTGTGGGGAAGGGGTGTGG + Intronic
972290353 4:37685828-37685850 GCCTTTGAGGACAAGGGCGGCGG + Intronic
972661293 4:41119025-41119047 GCTACTCAGGAGGAGGGGGCAGG + Intronic
972788161 4:42346410-42346432 GCTTCTGGGCAGAAAGGGGCAGG + Intergenic
973534543 4:51867829-51867851 GCTTCTGCGCAGAAAGGGGTGGG - Intronic
973706904 4:53590076-53590098 GCTTGTGAGTTTAAGGGGGGGGG - Intronic
974984476 4:69003911-69003933 GATTCAGAGGAGAGGGTGGGAGG + Intergenic
975040884 4:69743547-69743569 GCTCCTGGGCAGAAGGGGGTGGG - Intronic
975913650 4:79297811-79297833 GCTTCTGTGTGGAAGGGGGTGGG + Intronic
976700770 4:87966595-87966617 GCTCCTGGGCAGAAGGGGGCAGG + Intergenic
976709305 4:88052375-88052397 ACTTCGGAGGATAAGGTGGGAGG - Intronic
977748189 4:100576824-100576846 GCTTCAGAAGAGAAAGGGAGTGG + Intronic
978347664 4:107788637-107788659 GCTCCTGAGCAGAAAGGGGTGGG - Intergenic
979107362 4:116705362-116705384 GTTTCTGAGGAGCAGGGGGAGGG - Intergenic
979665725 4:123308935-123308957 GTTTCTGAGAAGATGGGGAGAGG - Intronic
979956134 4:126955847-126955869 GCTTCTGGGCAGAAAGGGGTGGG + Intergenic
981119987 4:141038924-141038946 GCCTTTGGGGAGAAGGGAGGAGG + Intronic
981878782 4:149581919-149581941 GTATGTGAGGAGAAGGGGAGGGG + Intergenic
983069723 4:163254153-163254175 GTTTCTGAGCAGAAAGGGGTGGG - Intergenic
984954436 4:185031518-185031540 GCTTGGGAGAACAAGGGGGGAGG + Intergenic
985657136 5:1138016-1138038 ACTTCTGAGAAGAGGAGGGGCGG - Intergenic
985778402 5:1857195-1857217 GCTGCTGAGGAGCTGGGTGGGGG - Intergenic
986428671 5:7660028-7660050 GCTTGAGAGGAGAAGGTGGGAGG + Intronic
987320930 5:16768782-16768804 GCTTGGGAGGAGAGGGTGGGAGG - Intronic
987537694 5:19208979-19209001 GCTTCTGGGCAGAAAGGGGCAGG + Intergenic
988112553 5:26841368-26841390 GCTTCAGGGGAGAAGGGTGGGGG + Intergenic
988323267 5:29728094-29728116 ACTTTAGAGGAAAAGGGGGGAGG + Intergenic
989112081 5:37916001-37916023 TCTTCGGAGGGGAAGGTGGGGGG + Intergenic
992220957 5:74572990-74573012 GCTTCAGGGGAGAAGGGTGAGGG - Intergenic
993364591 5:87020160-87020182 GGTTCTGAGGAGAGGGAGGGAGG - Intergenic
994692397 5:103034759-103034781 GCTTCTGGGCAGAAAGGGGCAGG - Intergenic
996362506 5:122665664-122665686 GTTTCTGAAGAGAAGGGAGGAGG + Intergenic
996520242 5:124418146-124418168 GCTTCAGGGGAGAAGGGCTGGGG + Intergenic
997985927 5:138501673-138501695 GCGTCTGTGGAGAAGGCTGGAGG + Intergenic
998396862 5:141824248-141824270 GCTTGTCAGGAGAAGAGGTGAGG - Intergenic
998940862 5:147280602-147280624 GCTGCTGTGGGGAATGGGGGTGG - Intronic
999182459 5:149679745-149679767 CCTTCTGGGAAGAAGGGGAGAGG + Intergenic
1001366091 5:171141493-171141515 GCTTCTGGGGAGGCGGAGGGAGG + Intronic
1001536631 5:172502742-172502764 GCTTTTGAGGAGGAGGTGGTGGG + Intergenic
1002375405 5:178785304-178785326 GCTTCCTTGGGGAAGGGGGGCGG + Intergenic
1002394317 5:178941351-178941373 TCGTCTGGGGAGAAGGGCGGAGG + Exonic
1002525193 5:179811743-179811765 ACTTCTGAGGGGGAGGGGAGGGG + Intronic
1002842480 6:918130-918152 GCAGCTGAGGAGATGGGGGATGG + Intergenic
1003018678 6:2490507-2490529 GCATCTGAGAAGGAGGGGGAGGG - Intergenic
1003164601 6:3665267-3665289 GCTTATTAGGAGAAGGTGGAGGG - Intergenic
1003339464 6:5205758-5205780 GCTTCTGAGAAGGAGTGAGGTGG - Intronic
1004305883 6:14501671-14501693 GCTGGGGGGGAGAAGGGGGGGGG + Intergenic
1004348792 6:14872698-14872720 GCTTCAGGGGAGAAGGGCAGTGG + Intergenic
1004357471 6:14942536-14942558 GCTTCAGGGGAGAAGGGCAGTGG - Intergenic
1004869783 6:19893159-19893181 GCTTGGGAGGATAAGGTGGGAGG + Intergenic
1005009569 6:21322976-21322998 TTTTCTGAGGAGGAGGAGGGAGG + Intergenic
1005402531 6:25449371-25449393 GGTTCTGAGGAGGAGGATGGGGG + Intronic
1005901079 6:30216729-30216751 GCTTCAGGGAAGAAGGGGCGAGG - Intergenic
1006210441 6:32389091-32389113 CTTTCTGAGGACAAGGCGGGTGG - Intergenic
1006448874 6:34094724-34094746 GCTTCTGATCAGGAGGGGCGTGG - Intronic
1006742045 6:36315987-36316009 GCTTCTGAGAAGTGGGGGAGAGG - Exonic
1007098639 6:39229567-39229589 GCTTGTGCGGGGAAGGGGCGGGG - Intergenic
1007578286 6:42939774-42939796 GCCTCTAGGGAGAAGGGGTGGGG + Intergenic
1007617188 6:43187053-43187075 GCAGCTGTGGAGAAGGGGGCAGG + Exonic
1007896131 6:45361024-45361046 GCTACTCAGGAGATGGGGGCAGG + Intronic
1007917599 6:45575569-45575591 GCTTCTGAGGAGTACAGGGGTGG + Intronic
1008954611 6:57201029-57201051 GCTTCAGAGGAGAAGGGGCTAGG - Intronic
1009284431 6:61798014-61798036 ACTTGAGAGGAGAAGGTGGGAGG - Intronic
1009578569 6:65500177-65500199 GCTTCTGAGGCAAAGGAGGCAGG + Intronic
1011111967 6:83848785-83848807 GCTTCTGAAGAGACAGGGGCTGG - Intergenic
1011656571 6:89557280-89557302 GCATGTGAGCAGAAGGGAGGGGG + Intronic
1011868472 6:91861833-91861855 ACTTCAGAGGCTAAGGGGGGAGG + Intergenic
1012052301 6:94361420-94361442 GCTTCTGGGTGGAAGGGGGTGGG - Intergenic
1012752755 6:103184192-103184214 GCTTCTGAACAGAAGAGGGTGGG + Intergenic
1012957598 6:105587998-105588020 GCCTCTTGGGAGAAGGGGGAGGG - Intergenic
1013642817 6:112103638-112103660 GCTTCTCAGAAGAATGGAGGGGG + Intergenic
1016370233 6:143366144-143366166 GTCCCTGAGGAGAAGGGGAGGGG - Intergenic
1017822962 6:158061973-158061995 GCTTCTGAAAAGAGGAGGGGAGG - Exonic
1017953966 6:159162664-159162686 TCTTCTATGGAGAAGGGGGAAGG + Intergenic
1018475442 6:164135607-164135629 CTTTCTGGGGAGAAGGGGAGAGG + Intergenic
1018582276 6:165317489-165317511 GCCTCTGAGGAGCGGGGGTGGGG - Intergenic
1018740600 6:166725686-166725708 GCATCTGAAGAGAAGGCAGGTGG - Intronic
1018902880 6:168060086-168060108 GCTTCTTAGGAGTGTGGGGGGGG + Intronic
1018958856 6:168432076-168432098 GGTTCTGAAGAGAAGAGAGGGGG - Intergenic
1019490598 7:1311461-1311483 GCTTCTGGGGAGAGGGCAGGGGG + Intergenic
1019499248 7:1356105-1356127 GCTGTTGAGGACAAGGCGGGAGG - Intergenic
1019707832 7:2504924-2504946 GCCTCTGTGGAGCCGGGGGGGGG - Intergenic
1020136678 7:5591869-5591891 GATTCTGAGGATGGGGGGGGGGG + Intergenic
1020509074 7:9029919-9029941 GCCTTTGAGGAGAAAGGCGGGGG + Intergenic
1020679101 7:11214856-11214878 CATTCTGAAGAGAAGGGTGGTGG - Intergenic
1020799271 7:12713892-12713914 GCTTCAGGGGAGAAGGGAGGCGG + Intergenic
1021853296 7:24829572-24829594 AGAACTGAGGAGAAGGGGGGTGG - Intronic
1022293973 7:29032365-29032387 TCTTCTTAGGAGAGTGGGGGTGG - Intronic
1023213484 7:37833267-37833289 GGTTCTGCTGAGAAAGGGGGAGG + Intronic
1023909804 7:44545623-44545645 GCTTCTCAGGAGACGGAGGTTGG - Intergenic
1023973558 7:45010019-45010041 GCTACTGAGGAGACTGGGGCGGG - Intronic
1024246010 7:47471187-47471209 GCCTGTGGGGAGAAGGGGTGAGG + Intronic
1024560458 7:50640487-50640509 CCTTCTAAAGAGAAGGGTGGAGG - Intronic
1024609792 7:51054660-51054682 GCTTCTGAGGAGGCTGGGGCTGG - Intronic
1025145055 7:56494946-56494968 GCATCTGAGGGGCAGTGGGGAGG - Intergenic
1025255424 7:57381362-57381384 CCTTCCCAGGAGAAGTGGGGTGG + Intergenic
1025939914 7:66068314-66068336 GTTCCAAAGGAGAAGGGGGGTGG - Intergenic
1026360652 7:69598899-69598921 GCGGCGGAGGAGAAGGGAGGCGG - Intronic
1026729756 7:72901321-72901343 GCTACTCAGGATAAGGTGGGAGG - Intronic
1027575166 7:79922267-79922289 GCTCCTGAGAAGAAAGGGGCAGG + Intergenic
1028385967 7:90253633-90253655 GCTTGAGAGGAGGAGGCGGGTGG - Intronic
1028475094 7:91244626-91244648 AATGCTGAGGAGAAGGGAGGAGG - Intergenic
1029005502 7:97204971-97204993 GCCTCTGAGGAGAGGGGCAGTGG + Intergenic
1029367337 7:100125060-100125082 GCTTCTGGGGTGGAGGGTGGGGG + Exonic
1029566902 7:101344776-101344798 GCTTCTGAGGAGCACAGGGTAGG + Intergenic
1030570263 7:111213432-111213454 GCTCCTGAGTGGAAGGGGGTGGG + Intronic
1031470486 7:122162963-122162985 GCTTCTGAGGAGGCTGAGGGGGG + Intergenic
1031836435 7:126685803-126685825 GCTCCTGGGCAGAAGGGGGAAGG + Intronic
1032076938 7:128840529-128840551 CCCTCTGAGGAGATGGGGGCAGG - Exonic
1032858630 7:135858049-135858071 GCTCCTGAGTGGAAGGGGGTGGG - Intergenic
1033597778 7:142868955-142868977 GCTGCTGAGGGGAAGGGGCAGGG - Exonic
1033628997 7:143139053-143139075 CCTGGTGAGGAGAAGGTGGGAGG - Exonic
1034128754 7:148697804-148697826 GCTGCTGTGGTGACGGGGGGTGG - Intergenic
1034422464 7:150996744-150996766 GCTCCTGGGGAGGAGAGGGGTGG - Exonic
1034452616 7:151145299-151145321 GCTTGTGAGGAAAGGGGAGGAGG + Intergenic
1034454279 7:151157656-151157678 GCTACTGAGCAAAAGGGGGAAGG - Intronic
1034456726 7:151174684-151174706 GCGGCTGAGGAGAAGCGGAGAGG - Intronic
1034928128 7:155139940-155139962 GCTTCTGGGAAGAGAGGGGGAGG + Intergenic
1035387332 7:158482920-158482942 GCCTCCGAGGAGAAGGGGCTGGG - Intronic
1035626939 8:1077398-1077420 GGTTCTCAGGAGCAGAGGGGCGG + Intergenic
1037487774 8:19364583-19364605 GCCTCTGGGGGGGAGGGGGGCGG - Intronic
1037693570 8:21204612-21204634 GGTGCTGAGGAGAAGAGTGGGGG + Intergenic
1039007468 8:33056010-33056032 TCCTCTGTGGATAAGGGGGGAGG - Intergenic
1039324906 8:36474506-36474528 GGTTGTCAGGAGAAGAGGGGAGG + Intergenic
1040592233 8:48804329-48804351 CCTTCAGAGGAGAGGGAGGGTGG + Intergenic
1040658578 8:49542948-49542970 GCTTGTGTGGAGTAGGGGGAGGG + Intronic
1040941851 8:52842461-52842483 GTATCTGAGGACAATGGGGGAGG + Intergenic
1041512400 8:58666430-58666452 GCTTCTGAGGAGAAATAAGGAGG + Intergenic
1042337070 8:67640223-67640245 GCTCCTGGGCAGAAGGGGGCAGG - Intronic
1042353278 8:67799808-67799830 GGTTCTGAGGCCAAGGAGGGTGG + Intergenic
1043568141 8:81570942-81570964 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
1044731647 8:95233124-95233146 GCTTCTTGGAAGAAGGGGGTGGG - Intergenic
1045542020 8:103095545-103095567 GCTTCATGGGAGAAGGGTGGAGG + Intergenic
1046395297 8:113632869-113632891 GCTCCTGGGCAGAAGGGGGCAGG - Intergenic
1046969988 8:120212136-120212158 GCTCCCCAGGAGAAGGTGGGTGG - Intronic
1048395569 8:134011076-134011098 GCTTCTGAGGAGGGGGGCGAGGG - Intergenic
1048774615 8:137932084-137932106 GTTTATGTGGAGAAGGCGGGGGG + Intergenic
1049434685 8:142581078-142581100 GAGTCTGAGGAGAAGATGGGAGG + Intergenic
1049478527 8:142808000-142808022 GCCTCTGAGGGGAGGGGAGGGGG + Intergenic
1050213361 9:3290914-3290936 GCTTCAGAGGAGAAGGAGTGAGG - Intronic
1050848771 9:10258010-10258032 GCTTGTGGGGAGAAGGGGGCAGG + Intronic
1051170915 9:14316767-14316789 GATTCTGAGGGGAGGGGGTGGGG + Intronic
1051256519 9:15219527-15219549 GCTTCAGGGGAGAAGGGTGAGGG - Intronic
1051263057 9:15284724-15284746 TCTTCTGAGGAGAGGAAGGGAGG + Intronic
1052223521 9:26056208-26056230 GCATCTTGGGAGAAGGGGTGGGG + Intergenic
1052366938 9:27622552-27622574 TCTTCTGAGGAGATGAGGGTTGG + Intergenic
1052463165 9:28793969-28793991 GGTTTTGAGGAGTAGGAGGGTGG - Intergenic
1053656585 9:40222914-40222936 CCTTCTGAGGAGGAGCGGGGCGG + Intergenic
1053752654 9:41273061-41273083 TCTTCGGAGGAGAAGAGGGGCGG - Intergenic
1053906939 9:42852136-42852158 CCTTCCGAGGAGGAGCGGGGTGG + Intergenic
1054258182 9:62837413-62837435 TCTTCGGAGGAGAAGAGGGGTGG - Intergenic
1054351617 9:64021384-64021406 TCTTTGGAGGAGAAGAGGGGTGG + Intergenic
1054357004 9:64071361-64071383 CCTTCCGAGGAGGAGCGGGGCGG + Intergenic
1054368689 9:64369136-64369158 CCTTCCGAGGAGGAGCGGGGCGG + Intergenic
1054528030 9:66153371-66153393 CCTTCCGAGGAGGAGCGGGGCGG - Intergenic
1054676318 9:67858888-67858910 CCTTCTGAGGAGGAGCGGGGCGG + Intergenic
1056094035 9:83232802-83232824 GCTGCAGAGGAGAGGGGGAGTGG - Intergenic
1057183082 9:93040261-93040283 GGTCCTGAGGGGAAGGGTGGAGG - Intergenic
1057587741 9:96344792-96344814 GCTTCTGATGATGAGGGGTGGGG - Intronic
1057607612 9:96511612-96511634 CCTTCTGGGGAGAAGGGGATGGG + Intronic
1058425164 9:104869605-104869627 GGTGCTGAGGAGAAGGGGTGAGG + Intronic
1058951445 9:109907546-109907568 GCTTCTGAGAGGAAGGGGTAGGG + Intronic
1060257757 9:122047514-122047536 TCTTCTGGGGAGAGGGGGTGGGG - Intronic
1060400319 9:123344754-123344776 GCTGCTGGGGAGAGGGGAGGAGG + Intergenic
1060416582 9:123435004-123435026 GGATCTGGGGAGAAGGAGGGCGG + Intronic
1060583251 9:124770696-124770718 GGTGCTGAGGGGACGGGGGGAGG + Intronic
1060819340 9:126652283-126652305 TCTGAGGAGGAGAAGGGGGGGGG + Intronic
1061864185 9:133484027-133484049 GCTGCTGGGGAGAAAGAGGGCGG + Intergenic
1062027542 9:134347473-134347495 GCTTCTGCCGAGCAGGAGGGGGG + Intronic
1062121541 9:134836499-134836521 GCTCCTGAGGGGAACGGGGCCGG + Intronic
1062445623 9:136592969-136592991 GCTTCTTGGGAGAAGGATGGGGG + Intergenic
1062497515 9:136838725-136838747 GCTTCTGAGCAGGAAGGGGTCGG - Intronic
1202800595 9_KI270719v1_random:170963-170985 TCTTCGGAGGAGAAGAGGGGCGG + Intergenic
1203696979 Un_GL000214v1:108661-108683 TCTTCGGAGGAGGAGAGGGGCGG - Intergenic
1203748543 Un_GL000218v1:58100-58122 CCTTCCGAGGAGGAGCGGGGCGG + Intergenic
1203561177 Un_KI270744v1:59920-59942 CCTTCCGAGGAGGAGCGGGGCGG - Intergenic
1186863036 X:13691845-13691867 GGTGCTGATGAGAAGGGCGGTGG + Intronic
1188112806 X:26212091-26212113 GCTACTGTGGGGAAGGGTGGGGG + Intergenic
1188522441 X:31053750-31053772 GTTTCTGAGGAGAGAGAGGGAGG - Intergenic
1188567596 X:31544431-31544453 GCTTCAGGGGAGAAGGGGGAAGG - Intronic
1190652161 X:52577897-52577919 GGTTCTTGGGAGAAAGGGGGAGG - Intergenic
1190684246 X:52856381-52856403 GCTTCAGGGGAGAAGGGTTGGGG - Intergenic
1190760465 X:53433965-53433987 GCTTCTGAGGAGAAGGGGGGAGG + Intronic
1191055290 X:56233768-56233790 GCTTCTGAAAAGAAGGAGGAGGG + Intronic
1192138762 X:68630451-68630473 GCTTCTGCAGAGCACGGGGGTGG + Intergenic
1192147022 X:68688842-68688864 GCTTCTGCAGAGCACGGGGGTGG - Intronic
1193554124 X:82932501-82932523 GCTTCTTGGAAGAAGGGGGAGGG + Intergenic
1194050283 X:89059636-89059658 GCTTCAGAGGAGAAAGGTGAGGG + Intergenic
1194966675 X:100296505-100296527 GCTCTTGAGGTGGAGGGGGGAGG + Exonic
1195277872 X:103299790-103299812 GGTTCTCAGGAGAAGGCGGCTGG + Intergenic
1195504021 X:105636159-105636181 GATTCAGAGGACAAGGGGGAAGG + Intronic
1195655002 X:107324854-107324876 GCTTCTGGGCTGAAGGGGGCGGG + Intergenic
1196345252 X:114648281-114648303 GCTTCAGAGGAGAAGGGTGAGGG + Intronic
1196785545 X:119418743-119418765 GCTTCTGGTGGGAAGGGGGGTGG + Intronic
1196968959 X:121087723-121087745 AATTCAGAGGAGAAGGTGGGAGG - Intergenic
1197149827 X:123207997-123208019 GCTTCTGAGCAGCAGGAGGAAGG - Intronic
1197664912 X:129213099-129213121 GCTTATGAGGAAAATGGGGTTGG + Intergenic
1198131973 X:133704724-133704746 GCTTCATGGGAGAAGGGGTGAGG + Intronic
1198139511 X:133788717-133788739 GCATAGGAGGAGGAGGGGGGAGG - Intronic
1198275474 X:135094837-135094859 GCCTCTGAGGAGTAGGGCTGGGG - Intergenic
1199188012 X:144939484-144939506 GCTTCTGGGTGGAAGGGGGCAGG - Intergenic
1199783087 X:151081382-151081404 GCTTTTGAGCAGAGGAGGGGTGG + Intergenic
1200140813 X:153902110-153902132 GCTTCTGCAGAGAAGAGTGGAGG - Intronic
1201153516 Y:11107941-11107963 TCTTCGGAGGAGAAGAGGGGCGG + Intergenic
1201161888 Y:11173070-11173092 CGTTCTGAGGAGGAGCGGGGCGG + Intergenic
1201224048 Y:11799837-11799859 GCTTCAGGGGAGAAGGTGAGGGG - Intergenic
1202375353 Y:24230244-24230266 GCTACTCAGGAGAATGAGGGAGG + Intergenic
1202378588 Y:24258538-24258560 GCTGCTGAGGTGATGGGGGAAGG + Intergenic
1202492194 Y:25411583-25411605 GCTGCTGAGGTGATGGGGGAAGG - Intergenic
1202495427 Y:25439876-25439898 GCTACTCAGGAGAATGAGGGAGG - Intergenic