ID: 1190761402

View in Genome Browser
Species Human (GRCh38)
Location X:53440939-53440961
Sequence CGACCTTGGCGGGCGCGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 79}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190761402_1190761408 -6 Left 1190761402 X:53440939-53440961 CCGCTCCGCGCCCGCCAAGGTCG 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1190761408 X:53440956-53440978 AGGTCGAGTTAGGAAAGACTTGG 0: 1
1: 0
2: 0
3: 7
4: 82
1190761402_1190761409 9 Left 1190761402 X:53440939-53440961 CCGCTCCGCGCCCGCCAAGGTCG 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1190761409 X:53440971-53440993 AGACTTGGAACAGAATTAAACGG 0: 1
1: 0
2: 3
3: 30
4: 359
1190761402_1190761411 16 Left 1190761402 X:53440939-53440961 CCGCTCCGCGCCCGCCAAGGTCG 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1190761411 X:53440978-53441000 GAACAGAATTAAACGGCTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 112
1190761402_1190761412 17 Left 1190761402 X:53440939-53440961 CCGCTCCGCGCCCGCCAAGGTCG 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1190761412 X:53440979-53441001 AACAGAATTAAACGGCTTTGGGG 0: 1
1: 0
2: 0
3: 12
4: 132
1190761402_1190761410 15 Left 1190761402 X:53440939-53440961 CCGCTCCGCGCCCGCCAAGGTCG 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1190761410 X:53440977-53440999 GGAACAGAATTAAACGGCTTTGG 0: 1
1: 0
2: 0
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190761402 Original CRISPR CGACCTTGGCGGGCGCGGAG CGG (reversed) Intergenic
900580252 1:3405190-3405212 AGACCCTGGCGGGCTCGGGGTGG - Intronic
900626589 1:3611377-3611399 CGACCTTGGGCTCCGCGGAGCGG - Exonic
903278844 1:22238629-22238651 GGGCCTTGGCGGGAGGGGAGTGG + Intergenic
904050210 1:27634293-27634315 AGACCGCCGCGGGCGCGGAGGGG + Intronic
922821409 1:228487925-228487947 GGACCGGGGCGGGGGCGGAGAGG - Intronic
1066325061 10:34350624-34350646 CCATCTTGGCGGGGGGGGAGGGG + Intronic
1073088537 10:100912717-100912739 CGGCCTTGGCCGGCGCGCGGGGG - Intronic
1074434516 10:113422574-113422596 CAACATTGGTGGGCGGGGAGAGG - Intergenic
1083681925 11:64355251-64355273 AGACCTTGGCAGGCGGGCAGCGG + Exonic
1083922435 11:65787874-65787896 CCACTTTGGGGGGCGGGGAGCGG + Intronic
1091381949 12:67395-67417 CGCCCTTGCCGAGGGCGGAGGGG - Exonic
1092239769 12:6829390-6829412 AGACCTCTGCGGGCGGGGAGGGG + Intronic
1096127681 12:49131497-49131519 CGGCCAGGCCGGGCGCGGAGTGG - Intergenic
1096178601 12:49538889-49538911 GGACCTCGGCGGGGGCGGGGAGG - Intergenic
1105293849 13:19071631-19071653 CAGCCTTGGCGGGGGAGGAGGGG - Intergenic
1105409867 13:20162009-20162031 AGACCTTGGGGGACGGGGAGGGG - Intergenic
1105723866 13:23142090-23142112 CGGCCTTGGCCAGCCCGGAGAGG - Intergenic
1106264866 13:28100682-28100704 GGACCGAGGCGGGAGCGGAGAGG + Intergenic
1112290647 13:98142520-98142542 GGACGTGGGCGGGCGCGGGGTGG + Intergenic
1115474611 14:33800794-33800816 TCACCTCGGCGGGCGCGTAGCGG - Exonic
1115664712 14:35534383-35534405 CCTCCTTGCCCGGCGCGGAGCGG + Exonic
1117097611 14:52314298-52314320 CGGCCTTGGCCGGCGCGGGTAGG + Intronic
1123625585 15:22224862-22224884 AGACCTTGACGGGGGCGGGGTGG - Intergenic
1128214362 15:65924162-65924184 CCACCTGGGCTGGCGAGGAGAGG + Intronic
1132050811 15:98606366-98606388 CCATCTTGGCGGCCGTGGAGAGG - Intergenic
1134134020 16:11668249-11668271 CGGCCCTGGCGAGCGCGGATTGG - Intergenic
1139209559 16:65064053-65064075 AGACCTTGGCGGCCAGGGAGGGG + Intronic
1141841457 16:86576733-86576755 GGACCTAGGCGGGCGCGGCCGGG + Intronic
1148122545 17:45221665-45221687 CAACCATGGCGGGCGGGGAGTGG - Intronic
1148445207 17:47733391-47733413 CGACCCTCTCGCGCGCGGAGGGG + Exonic
1150488660 17:65560558-65560580 CGGCAGTGGCGGGGGCGGAGAGG - Intronic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1153480420 18:5542840-5542862 TGAACTTGGCGGGCGTGGGGGGG + Intronic
1155284211 18:24271884-24271906 CGGCCCGGGCGGGCGCGGCGCGG - Intronic
1160390478 18:78527639-78527661 CGACAGTGGTGGGCGTGGAGGGG - Intergenic
1162095267 19:8306436-8306458 CGACCTGGAGGGGCACGGAGGGG + Intronic
1163427073 19:17245676-17245698 CGCCCGTGGCGGGGGGGGAGGGG + Exonic
1163591168 19:18194901-18194923 AGAGCTGGGCGGGGGCGGAGCGG - Intronic
1163597077 19:18226385-18226407 GGACCGGGGCGGGCGCGGGGGGG + Intronic
1163830713 19:19545981-19546003 CTACCCCGGCGGGTGCGGAGGGG - Exonic
939990739 2:148875428-148875450 CCACCTTCCCGGGCTCGGAGCGG + Exonic
948975506 2:241461273-241461295 CTGGCTTGGGGGGCGCGGAGGGG - Intronic
948983585 2:241507553-241507575 AGACCCTGGCGGGCGCTGAGGGG - Intronic
948988651 2:241541077-241541099 CAAGCAGGGCGGGCGCGGAGCGG - Intergenic
1172117978 20:32583312-32583334 CGGCCCGGGCGGCCGCGGAGGGG + Intronic
1173617263 20:44411277-44411299 CGACCTGGGCAGAGGCGGAGAGG - Intronic
1175765250 20:61587879-61587901 GGGCCTGGGCGGGGGCGGAGTGG - Intronic
1176283253 20:64327438-64327460 CGCCCTTGCCGAGGGCGGAGGGG + Intergenic
1176555503 21:8252637-8252659 CGGCCTTTGCGGGCGTGCAGGGG + Intergenic
1178487559 21:33028343-33028365 CGACCCTGGAGGGCGCGGTCGGG - Exonic
1179951673 21:44711988-44712010 CGACCATGGCAGGCCGGGAGCGG + Intergenic
1180052034 21:45335705-45335727 CGTCCCTGGAGGGCGAGGAGGGG + Intergenic
1180421091 22:12815561-12815583 CGACCCTGGCGGGGGCTGGGAGG - Intergenic
1180754368 22:18150118-18150140 AGACCAAGGCGGGCCCGGAGCGG + Exonic
1181680941 22:24495399-24495421 TGGCCATGGCGGGCGCTGAGTGG + Exonic
955770350 3:62378745-62378767 AGACCTGGGCGGGGGCGTAGGGG + Intergenic
957959174 3:87227423-87227445 GGACCTTGGCGGGTTCGGGGTGG - Exonic
966866453 3:184261279-184261301 CGGACATGGCGGGCGCGGGGTGG + Exonic
967184115 3:186930755-186930777 CGACCGGCGTGGGCGCGGAGCGG + Exonic
968603497 4:1520975-1520997 CGACCTGGGCGGGGCTGGAGGGG - Intergenic
971245005 4:24919497-24919519 CAACCTTGGCGGGCAGGGGGTGG + Intronic
981354676 4:143774483-143774505 CAACCTTGGTGGGAGCTGAGGGG + Intergenic
985209860 4:187581087-187581109 AGACCTTGGCTGGCAAGGAGAGG + Intergenic
996862665 5:128083750-128083772 CGAGTGTGGCGGGCGCGGGGCGG - Exonic
997968091 5:138376014-138376036 CCACCTTGGCTGGCGTGCAGTGG + Intronic
1002527071 5:179820802-179820824 CGACGGTGGCGGGGGCGGGGAGG + Exonic
1004442065 6:15663045-15663067 CGAGCCTGGCGCGCGCGGGGCGG - Intronic
1006471995 6:34234948-34234970 CGGCCTTGGAGAGCGCGAAGTGG + Intergenic
1007623526 6:43229255-43229277 CGAGCTGGGCGCGCGCGGTGAGG - Exonic
1013152494 6:107459701-107459723 CGACCTTTGCTGGCCCAGAGCGG - Intergenic
1017073855 6:150600180-150600202 GGGCCTTGGGGGGCGCCGAGCGG + Intronic
1019563938 7:1670543-1670565 GGAACTTGGCGGCGGCGGAGCGG + Intergenic
1025813371 7:64889242-64889264 GGCCCTTTGCGGGCGGGGAGCGG - Intronic
1029655863 7:101924049-101924071 CGACCCTGGCAGGCACGGTGAGG + Intronic
1031526352 7:122825864-122825886 TGACCTTGGCTGGCCTGGAGGGG - Intronic
1035221005 7:157406546-157406568 GGACCTGGCCGGGGGCGGAGTGG + Intronic
1035450399 7:158973943-158973965 CGAGGGTGGGGGGCGCGGAGAGG - Intergenic
1035450417 7:158973982-158974004 CGAGGGTGGGGGGCGCGGAGAGG - Intergenic
1035450436 7:158974022-158974044 CGAGGGTGGGGGGCGCGGAGAGG - Intergenic
1049418466 8:142506177-142506199 CGACCTTGGCAGGAGCCGAGTGG + Intronic
1190761402 X:53440939-53440961 CGACCTTGGCGGGCGCGGAGCGG - Intergenic
1196491728 X:116275346-116275368 CGACCTTGACGGGAGAGGAAAGG - Intergenic
1196828386 X:119758451-119758473 AGGCCTTGGGGGGCGTGGAGGGG - Intergenic
1200169208 X:154060220-154060242 TTACTTTGGCGGGGGCGGAGGGG - Intronic