ID: 1190762452

View in Genome Browser
Species Human (GRCh38)
Location X:53447884-53447906
Sequence GACTGAGGAAGGTCTTGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190762452 Original CRISPR GACTGAGGAAGGTCTTGAGT GGG (reversed) Intergenic
902261255 1:15226530-15226552 GACACAGGAAGGTCTGCAGTGGG - Intergenic
903596775 1:24501648-24501670 GCCTCTGAAAGGTCTTGAGTGGG + Intergenic
905391160 1:37636085-37636107 GAGAGAGGAGGGACTTGAGTGGG - Intergenic
906072213 1:43025298-43025320 GACTGAGGAAGTCGTGGAGTTGG - Intergenic
906186320 1:43864690-43864712 GACTGAGGAAGGTAATGCTTGGG + Intronic
907975372 1:59426389-59426411 GAAGGAGGAAGGAATTGAGTTGG + Intronic
910394072 1:86774343-86774365 GACTGAAGAAGGACTTGAGCTGG + Intergenic
911014481 1:93317654-93317676 GAAAGAGGAAGGGCTTGGGTGGG - Intergenic
911969304 1:104409648-104409670 GACTGTGGAAGGAGTTGAGTAGG - Intergenic
912256088 1:108059380-108059402 CACAGGGCAAGGTCTTGAGTGGG - Intergenic
915062789 1:153200287-153200309 GTCTGAGGAAAATATTGAGTTGG + Intergenic
915311732 1:155008672-155008694 GACTGAGTAAGGACAGGAGTGGG + Intronic
917164709 1:172098916-172098938 GACTGTGGAAGGTCCTGTGCAGG + Intronic
918107374 1:181426286-181426308 GACATAGGAAGGGCTTGAGACGG - Intronic
919878340 1:201886683-201886705 GAGTGAGGAGGGGCTTGGGTGGG - Intergenic
920228197 1:204453100-204453122 GACTGAGGAGGGTCCTGGGGAGG - Intronic
923023395 1:230185023-230185045 GAATGAGGAATGTCTTTAATGGG - Intronic
1063243346 10:4193599-4193621 AACTAAGGGAGGTGTTGAGTAGG - Intergenic
1063451255 10:6151763-6151785 GAAAGAGGAAGGTCTTGCCTAGG + Intronic
1064233106 10:13547366-13547388 CACTTAGGAAGCTCTTTAGTAGG + Intergenic
1065167482 10:22994668-22994690 GACGGAGGAAGGACTGGAGGGGG + Intronic
1065664951 10:28049139-28049161 GACTGAGGCCAATCTTGAGTAGG + Intergenic
1070561082 10:77567004-77567026 GAACTGGGAAGGTCTTGAGTAGG - Intronic
1071986294 10:91054235-91054257 AACTGTGGATGGTCTTGAGCAGG + Intergenic
1072317680 10:94219530-94219552 GACTCAAGAAGGGCTTTAGTTGG + Intronic
1072491719 10:95913103-95913125 GACTGGGAAAGGTATTGGGTGGG - Intronic
1076685306 10:132195991-132196013 GTCTGAGGAAGGTCATGTTTGGG - Intronic
1077616104 11:3675262-3675284 GACTGAGGCAGGCATGGAGTTGG - Exonic
1081021789 11:37957198-37957220 GATTGAGCAAGGCCTGGAGTGGG - Intergenic
1084182078 11:67451851-67451873 GGCTGAGGCAGCTGTTGAGTAGG + Exonic
1085604163 11:77882403-77882425 GATCGTGGAAGGTCTTGAGAGGG - Intronic
1086903144 11:92390276-92390298 GAGTTAGGTAGGACTTGAGTAGG + Intronic
1087095403 11:94313172-94313194 CCCTGAGGAAGGACTTGAATAGG - Intergenic
1087221040 11:95546554-95546576 GACTGGGGAAGCTCCTGAGGAGG + Intergenic
1087895784 11:103584252-103584274 GACAAAGGAAGGTGTTAAGTGGG + Intergenic
1089151339 11:116366733-116366755 AAGTCAGGAGGGTCTTGAGTTGG - Intergenic
1090037563 11:123262094-123262116 GACTGAGAAACATCTTGAGAAGG - Intergenic
1092318334 12:7442979-7443001 GAAAGATGAAGGTCTTGAATTGG - Intronic
1093513466 12:19956757-19956779 GCATGAGGAAGTTCTTTAGTGGG + Intergenic
1095894521 12:47267047-47267069 GAGGGAGGAAGGTCTTGCCTTGG + Intergenic
1096841945 12:54385188-54385210 GACTGAGGAAGGTTGGGAGAAGG - Intronic
1099747726 12:86727944-86727966 AACTGAAGAAGCTCTTGAGAAGG + Intronic
1104067202 12:125315872-125315894 GACTGAGGATGCTCTGGAGGTGG + Intronic
1107157491 13:37186432-37186454 GCCTGAGGTAGGGCTTGAGGAGG + Intergenic
1107190593 13:37579978-37580000 GGCTGAGGAAGGTGCTAAGTGGG + Exonic
1109591301 13:64486645-64486667 AATTGAGGCAGGACTTGAGTAGG - Intergenic
1110480834 13:75974017-75974039 AACTGAGGAATTTCCTGAGTGGG + Intergenic
1113504249 13:110802726-110802748 GACTGGAAAAGGACTTGAGTGGG - Intergenic
1119892253 14:78191716-78191738 GAATGAGGAAAATCTTGAGATGG + Intergenic
1119943502 14:78666867-78666889 AACTGCAGAAGGCCTTGAGTGGG - Intronic
1121787608 14:96674197-96674219 GCCTGAGGAAGTTCTTGAGTGGG - Intergenic
1122631806 14:103110689-103110711 GACTGAGGCAGGTCCAGAGCAGG + Intergenic
1124125534 15:26935619-26935641 GATTGAGGAAAGTGATGAGTGGG + Intronic
1125602916 15:40925461-40925483 GAGTGAGGAAGGTGATGACTTGG - Intergenic
1127796534 15:62443095-62443117 GATTGAGGAGGATCTTGAGATGG - Intronic
1130650648 15:85760370-85760392 CACTGAGCAAGGCCCTGAGTAGG + Exonic
1131276686 15:90988134-90988156 GCCTGGGGAAGCTCTTTAGTTGG - Intronic
1131422943 15:92322372-92322394 GAATGAGGAAGGCGGTGAGTAGG - Intergenic
1132061521 15:98696353-98696375 GACCAAGGAAGGTCTCTAGTGGG - Intronic
1136025398 16:27465171-27465193 CACTGAGGATGGGCTTGATTTGG - Intronic
1136630010 16:31484593-31484615 GGCTGAGGAATGTGTTGAGGTGG + Intronic
1137491976 16:48940683-48940705 GTCTGAGGAAGCACTTGAGATGG - Intergenic
1143706485 17:8701194-8701216 AACTGGAGAAGGTCTTGTGTTGG - Intergenic
1144787132 17:17838110-17838132 GACTTATGAAGGTCTGGGGTCGG - Intergenic
1147996355 17:44362392-44362414 GACTGAGGCAGGCCTAGAGCCGG - Intronic
1148653076 17:49263583-49263605 GACCCAAGAAGGTCTTGACTAGG - Intergenic
1149232260 17:54548354-54548376 GGCTGGGAAAGGTATTGAGTCGG - Intergenic
1150849748 17:68693312-68693334 CACTTTGGATGGTCTTGAGTGGG - Intergenic
1153815700 18:8788202-8788224 GACTGAGGCAGGGCTGGAGCTGG + Intronic
1156995230 18:43457776-43457798 GAGTCAGGAAGGTATTGTGTTGG - Intergenic
1157257814 18:46154048-46154070 GATGGAGGAAGGTTTTGTGTTGG + Intergenic
1158689399 18:59646486-59646508 GACGGATGAGGGTCTTGGGTTGG + Intronic
1159024938 18:63175083-63175105 GACTGAGGAAGTGCTTGTGGGGG - Intronic
1159733053 18:72055532-72055554 GACTAAGGAAGGTCTTGATGAGG - Intergenic
1160491178 18:79337644-79337666 TAGAGAGGAAGGTCTGGAGTAGG - Intronic
1163649789 19:18510540-18510562 GACAGAGGAAGGTCTCGAGCAGG - Intronic
1166671263 19:44710789-44710811 GACTGAGAAAAGTCTTGGGGGGG - Intergenic
1168499324 19:56880103-56880125 GACTGAGGGAAGTGGTGAGTGGG + Intergenic
925123363 2:1436918-1436940 GACTGAGGGAGGAGTTGAGAAGG - Intronic
926741767 2:16117142-16117164 GAATGTGGAAGGTCTACAGTGGG + Intergenic
927413366 2:22851744-22851766 AACAGAGAAAGTTCTTGAGTTGG - Intergenic
927460700 2:23295949-23295971 GACAGAGGCAGGTCTGGAGAAGG - Intergenic
927610142 2:24530768-24530790 GACTGAGAAATGTCTTGAAGGGG + Intronic
927790186 2:26003468-26003490 GGCTGAAGAAGGTATGGAGTGGG - Intergenic
928282837 2:29964078-29964100 GACTGAGGCAGGGCGGGAGTGGG - Intergenic
928579288 2:32690544-32690566 CACTAAGGGAGGACTTGAGTTGG + Intronic
933919540 2:87030786-87030808 GAGTGAGGAAGGCTTTGAGATGG - Intergenic
934003454 2:87739116-87739138 GAGTGAGGAAGGCTTTGAGATGG + Intergenic
935730684 2:106062828-106062850 GAATGACGTAGGTCTTGGGTGGG - Intergenic
936289076 2:111205218-111205240 GACTGAGGATCTTCTTGAGGAGG - Intergenic
937990882 2:127661660-127661682 GGCTGAGGAAGGGCATGAGATGG - Intronic
939770752 2:146313897-146313919 GTCTTAGGAAGGTCCTGAATTGG - Intergenic
940780921 2:157932923-157932945 GACTGAGAAAAGTCTGGAGGCGG - Intronic
941846667 2:170140896-170140918 GTCTGAGGGAGATCATGAGTGGG + Intergenic
943235544 2:185313880-185313902 GACAGAGGTAGGTCCTGAGGTGG - Intergenic
943590010 2:189785065-189785087 TCCTGAGGAAAGTCTTGATTAGG + Intronic
946018278 2:216621400-216621422 AACTGAGGAAGCCCTTGAGCAGG + Intergenic
948086775 2:235256992-235257014 GAGTGTGGAAGGTGCTGAGTGGG - Intergenic
1171186880 20:23129122-23129144 GAGGGAGGCAGGACTTGAGTGGG + Intergenic
1172275679 20:33677654-33677676 GCGTGAGGTAGGTTTTGAGTGGG - Intronic
1173516407 20:43667822-43667844 GACTGAGAAGGGTGCTGAGTTGG + Intronic
1173551132 20:43933894-43933916 GCCTGAGGATGGCCTTGAGGAGG + Intronic
1174270621 20:49365719-49365741 GACTTTCAAAGGTCTTGAGTGGG + Exonic
1174287026 20:49481089-49481111 GACTGAGGAAGGCTTGGGGTGGG - Intronic
1174538751 20:51273253-51273275 TAGTGAGGGAGGTGTTGAGTTGG + Intergenic
1177776988 21:25578798-25578820 AACTGAGCAAGGTCCTGAGCTGG - Intergenic
1178977069 21:37229178-37229200 GACTGATGATGGTCTAGAGCAGG + Intronic
1180918352 22:19505264-19505286 CCCTGAGGAAGGCCTTGAGCGGG + Intronic
1183336788 22:37253167-37253189 GACTGAGAAATGTCTTTAGCTGG - Intergenic
1184254110 22:43277298-43277320 GCCATGGGAAGGTCTTGAGTGGG + Intronic
1184321249 22:43743792-43743814 GATGGAGGAAGGTCTTGAATAGG + Intronic
949198238 3:1339225-1339247 GATTGAGGAGGGCATTGAGTGGG - Intronic
950265873 3:11572511-11572533 GACTGAGGAGGGCCTGGAGCAGG - Intronic
952295833 3:32061112-32061134 GCCTGAGGAAGCACATGAGTTGG - Intronic
952500123 3:33953862-33953884 GCCTGTGAAAGGTGTTGAGTTGG - Intergenic
953720414 3:45350028-45350050 AACAGAGGTAGGTCTGGAGTAGG - Intergenic
953998877 3:47540866-47540888 GACTGGTGAAGGTCTTGGCTGGG + Intergenic
956300765 3:67770284-67770306 CACTGAGTCAGTTCTTGAGTGGG + Intergenic
956754897 3:72375262-72375284 GACTGAGAATGGTCTTGATAAGG + Exonic
963265049 3:143231652-143231674 GGTGGAGGAAGGTGTTGAGTTGG - Intergenic
965462397 3:168983070-168983092 TGCTGAGGAGGGTCTTGAGGAGG - Intergenic
965816946 3:172646682-172646704 GCCTGAGGAAGAACTTGAGCAGG - Intronic
966816699 3:183895853-183895875 GACTGAGGAAGGACTTCATGGGG + Intergenic
967617434 3:191588344-191588366 TATTAAGGAAGGTCTTGAATTGG + Intergenic
969133370 4:5009862-5009884 GACTTAGGAATGCCTTGAGCTGG + Intergenic
970202134 4:13620771-13620793 CAGTGAGGAAGGTCTTTACTGGG + Intronic
971502560 4:27332659-27332681 GACATAGAAAAGTCTTGAGTGGG + Intergenic
979992672 4:127393561-127393583 GACTGGGGAAGGCCCTGAGGTGG - Intergenic
981954834 4:150457773-150457795 AACTGAGGTAGGTTTAGAGTAGG - Intronic
983010189 4:162537375-162537397 GACTGAGGAAGGGGTTTTGTTGG + Intergenic
984658305 4:182343907-182343929 CACTGAGGGAGGTCTGGAGCAGG + Intronic
988988406 5:36644825-36644847 GGCTGAGGAATGTCTTGACTTGG - Intronic
990862878 5:60347410-60347432 AGCTGTGGAAGGTCTTAAGTAGG + Intronic
996789518 5:127277703-127277725 TAATGATGAAGGTCTGGAGTAGG + Intergenic
997784155 5:136692233-136692255 TACTGAGGTAGGAGTTGAGTTGG + Intergenic
999282942 5:150376673-150376695 GGCTGAGGATGGGCTTGACTGGG + Intronic
999955783 5:156700082-156700104 GACTGAGGATGGAGTTTAGTTGG - Intronic
1000794053 5:165642705-165642727 GACTGAAGAACTTCTTAAGTAGG + Intergenic
1002176180 5:177402786-177402808 GAGAGAGGAAGGGCATGAGTGGG - Intronic
1003268584 6:4588105-4588127 GATTGTGGAAGGTATTGTGTAGG - Intergenic
1005237752 6:23785390-23785412 GACTTAGGAAGTTCTTGAGTTGG - Intergenic
1005381366 6:25237449-25237471 GAGTGAGGTAGGTCTTGGGCAGG - Intergenic
1007246620 6:40468014-40468036 CACTTAGGAAGGTCATGAGCAGG - Intronic
1007730928 6:43945733-43945755 AATTGAGGAAGGACTTGACTGGG + Intergenic
1007736111 6:43983292-43983314 GACTCAGGAAGGTCATGGTTTGG - Intergenic
1011051868 6:83159932-83159954 AACTGAGGAAGGTTTTCAGAGGG - Exonic
1015413428 6:132920793-132920815 AAGTGGGGAAGGTGTTGAGTTGG + Intergenic
1016661854 6:146590358-146590380 TGGTGAGGAATGTCTTGAGTAGG - Intergenic
1018604236 6:165579968-165579990 GAGTGAGGAGGGTCAGGAGTTGG - Intronic
1022642679 7:32203184-32203206 GACTGAGAAATGCCATGAGTGGG - Intronic
1023138704 7:37079765-37079787 GGCTGGGGAAGGAGTTGAGTGGG - Intronic
1023926490 7:44673630-44673652 GACTGAGGATGGGATGGAGTGGG - Intronic
1024441275 7:49421280-49421302 GACTGAGGAGGCTCTTCTGTTGG + Intergenic
1024484571 7:49903624-49903646 GGCAGAGGGAGGTCTTGATTGGG + Intronic
1029909526 7:104130605-104130627 GGCTGACGCAGGTCTTGGGTTGG - Intronic
1033152986 7:138932768-138932790 GACTCCGTAGGGTCTTGAGTGGG - Intronic
1035462202 7:159048945-159048967 GAATGAGGAATCTTTTGAGTGGG - Intronic
1039773377 8:40711517-40711539 GACAGAGGAAAGTGTTGAATGGG + Intronic
1042214822 8:66420260-66420282 GAAAGAGGAAGTTCCTGAGTTGG - Intergenic
1042443980 8:68862208-68862230 GTCTCAGGAAGGTCCTGAGCTGG + Intergenic
1043734753 8:83729434-83729456 GACTGAGCAATCTCTTGAGAAGG - Intergenic
1043917596 8:85940549-85940571 GAATGAGGAAGGGCTGGAGAAGG + Intergenic
1045355799 8:101387890-101387912 AACTGAGGCATGTCTAGAGTGGG + Intergenic
1045858161 8:106788372-106788394 GACTTAGGCAGGTCTTCAGAAGG - Intergenic
1047859412 8:128948111-128948133 ATCTGAGGAAGGTCATGATTTGG + Intergenic
1048838913 8:138547515-138547537 GACTGAGCAAGGTGTTGAAGGGG - Intergenic
1052940181 9:34126604-34126626 GAGAGAGGAAGGACTTGAGCCGG + Exonic
1054476312 9:65575732-65575754 TTCTGAGGAAGGGCTTGAATTGG - Intergenic
1055116575 9:72611742-72611764 GCCAGAAGAAGGTCTTGGGTGGG + Intronic
1056328601 9:85503024-85503046 GACTGTGGAAGGCCTTGAATGGG + Intergenic
1056425542 9:86472211-86472233 CACTGTGGAAGGTTGTGAGTGGG + Intergenic
1057112283 9:92484737-92484759 GACTGAGGAGTGCCTTGGGTGGG - Intronic
1058732374 9:107862469-107862491 GAGGGTGGAAGGTCTTGACTAGG - Intergenic
1186292460 X:8115256-8115278 AATTGAGGGAGGTTTTGAGTAGG + Intergenic
1189725492 X:43964449-43964471 GTCTGAGGAGGGACTGGAGTGGG + Intronic
1190762452 X:53447884-53447906 GACTGAGGAAGGTCTTGAGTGGG - Intergenic
1191680396 X:63834195-63834217 GACTGAGGCACTTCATGAGTAGG - Intergenic
1193325666 X:80176576-80176598 GACTGAGGAGGCTCTGAAGTAGG - Intergenic
1194980343 X:100433895-100433917 GACTGAGAAAGGGCTTTACTAGG - Intergenic
1197693383 X:129525437-129525459 GATAGAGCAAGGTGTTGAGTAGG - Intergenic