ID: 1190765665

View in Genome Browser
Species Human (GRCh38)
Location X:53473637-53473659
Sequence AGTCAGGGTTGGAACTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 406}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190765655_1190765665 9 Left 1190765655 X:53473605-53473627 CCACTATAGAGTTATGCCTTGAG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1190765665 X:53473637-53473659 AGTCAGGGTTGGAACTGGAGAGG 0: 1
1: 0
2: 2
3: 48
4: 406
1190765660_1190765665 -7 Left 1190765660 X:53473621-53473643 CCTTGAGGGCTGGGAAAGTCAGG 0: 1
1: 1
2: 2
3: 34
4: 308
Right 1190765665 X:53473637-53473659 AGTCAGGGTTGGAACTGGAGAGG 0: 1
1: 0
2: 2
3: 48
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190765665 Original CRISPR AGTCAGGGTTGGAACTGGAG AGG Intergenic
900741689 1:4334116-4334138 CATCAGTGCTGGAACTGGAGAGG + Intergenic
901159390 1:7163390-7163412 TGGCAGGGGTGGACCTGGAGAGG + Intronic
901210878 1:7525347-7525369 AGTCAGGGCTGGAGCTGGGATGG - Intronic
902630383 1:17701243-17701265 GGTGAGGGTTGGAAGGGGAGGGG + Intergenic
902815638 1:18915022-18915044 AGGCAGGGTTGGAACTGGGTGGG - Intronic
905239667 1:36573335-36573357 GGTCAGGGCTGGAACAGGAGGGG + Intergenic
907283206 1:53363981-53364003 AGTAAGGGTGGGGACTGGGGAGG - Intergenic
907518406 1:55007721-55007743 AGACAGGGATGGGAGTGGAGTGG - Intronic
908407769 1:63831517-63831539 AGCCATGGCTGGAACTGGAGTGG + Intronic
908487685 1:64611073-64611095 AGCCATGGCTGGAGCTGGAGTGG + Intronic
909867054 1:80686463-80686485 AGCCATAGCTGGAACTGGAGTGG + Intergenic
910103074 1:83599162-83599184 AGTCATAGCTGGAATTGGAGTGG + Intergenic
910350795 1:86295234-86295256 AGTGAGGGTTGGTACATGAGTGG - Intergenic
912735908 1:112149443-112149465 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
912924857 1:113905044-113905066 AATTAAGGCTGGAACTGGAGAGG - Intronic
913133358 1:115863345-115863367 AGTCAGGCTGGGAGCTGGACTGG + Intergenic
915304510 1:154969973-154969995 AGTGAGCATTAGAACTGGAGGGG + Intronic
915514374 1:156404209-156404231 GGACAGGGTTGGAAGGGGAGGGG - Intergenic
915637742 1:157198315-157198337 AGGCAGGGTTGGGACTGGGGTGG + Intergenic
915670697 1:157486413-157486435 AGGCAGGGTTGGAACTGGGGTGG - Intergenic
916852134 1:168714268-168714290 AGTCAGTGCTGGATCGGGAGTGG - Exonic
918844742 1:189594885-189594907 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
921736407 1:218633535-218633557 GGTCAGGGTTAGACCTGGAGAGG + Intergenic
921758359 1:218884089-218884111 AGCCATGGCTGGAGCTGGAGTGG + Intergenic
922230301 1:223679963-223679985 AGACAGAGTTGGAGCTGGAGAGG - Intergenic
922730230 1:227945686-227945708 AGGCGGGGCTGGAGCTGGAGGGG - Intronic
923555782 1:234999486-234999508 TGTCAGGGTTGGCTCTGCAGCGG - Intergenic
924625603 1:245694689-245694711 AGCCAGGCCTGGAACAGGAGGGG + Intronic
924792996 1:247270113-247270135 AGCCAAGGCTGGAACTGGAATGG + Intergenic
924936588 1:248777253-248777275 AGCCATGGATGGAGCTGGAGTGG - Intergenic
1062770511 10:96622-96644 AGCCACAGCTGGAACTGGAGTGG + Intergenic
1063122507 10:3114772-3114794 AGTGAGGATGGGAACTGCAGGGG + Intronic
1064250722 10:13704529-13704551 GGTCTGAGTTGGACCTGGAGGGG - Intronic
1064639814 10:17404278-17404300 TGTCCGAGTTGGAAGTGGAGTGG + Intronic
1065488287 10:26255467-26255489 AGGCAGGGCTGAAGCTGGAGGGG + Intronic
1066040973 10:31547833-31547855 AGCCAAGGCTGGAGCTGGAGTGG - Intergenic
1066058577 10:31703181-31703203 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
1067922738 10:50476722-50476744 AGTCATGGCTAGAGCTGGAGTGG - Intronic
1070759292 10:79013577-79013599 GCTCAGTGTTGGAGCTGGAGAGG - Intergenic
1070805578 10:79268838-79268860 AGGCAGGTTTGGAGATGGAGAGG + Intronic
1070974957 10:80599221-80599243 AGTCTGGGCTGGGAGTGGAGTGG + Intronic
1071048970 10:81422453-81422475 AGTCAGGCTTAGAACTTCAGTGG - Intergenic
1071515022 10:86291480-86291502 AGGCAGGGCTGGTACTGGCGAGG - Intronic
1073103522 10:101019323-101019345 AGCCAGGGTTAGAACCGCAGTGG + Intronic
1075172369 10:120127731-120127753 AGTCAGGGTTGGGCCTGAAGAGG + Intergenic
1075217790 10:120553768-120553790 AGCCATGGCTGGAGCTGGAGTGG + Intronic
1076741612 10:132488458-132488480 CGTCAGGGTGGGAACCGGAGGGG + Intergenic
1077011710 11:381677-381699 AGGCAGGGCTGGAGGTGGAGCGG + Exonic
1077086249 11:752945-752967 AGACAGGGTTGGAATTGAATTGG + Intronic
1077378129 11:2215171-2215193 AGTCAGGCATGGACCTGCAGAGG - Intergenic
1077455127 11:2673841-2673863 AGTCAAGGTTGGATATGAAGAGG + Intronic
1078598585 11:12711171-12711193 AGTCAGGGTAGTCACTGGGGAGG + Intronic
1078887668 11:15520930-15520952 AGTCTGGAGTGGAAATGGAGAGG - Intergenic
1079300811 11:19277400-19277422 AGCCAGTGATGAAACTGGAGTGG - Intergenic
1079725417 11:23874729-23874751 AGGCAGGTTTGGGACTGAAGTGG + Intergenic
1081260703 11:40956787-40956809 AGTGAAGGTTGGAATGGGAGGGG - Intronic
1081270548 11:41077526-41077548 AGCCATGGCTGGAGCTGGAGTGG + Intronic
1082787092 11:57323304-57323326 AGTCAGGATGGGAACTGAGGAGG - Intronic
1083994922 11:66267136-66267158 AATAAGGGATGGAGCTGGAGTGG - Exonic
1084066196 11:66705655-66705677 AGTCAGCGAAGGCACTGGAGAGG - Intronic
1084451607 11:69242385-69242407 GGTGAGGCTGGGAACTGGAGTGG - Intergenic
1084559158 11:69892999-69893021 AGTCGGGGCTGGACCTGGAGGGG + Intergenic
1084838691 11:71827330-71827352 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
1086729321 11:90228154-90228176 AGCCATAGCTGGAACTGGAGTGG + Intergenic
1086771681 11:90774898-90774920 TGTCAGGGTTAGACCTGAAGAGG + Intergenic
1087437894 11:98145581-98145603 AGCCATGGCTGGAGCTGGAGTGG + Intergenic
1087781182 11:102302815-102302837 AGCCATGGGTGGAGCTGGAGTGG + Intergenic
1087962954 11:104374673-104374695 GGAGAGGGTTGAAACTGGAGGGG + Intergenic
1088012087 11:105016247-105016269 ATTCAGGGTTGGGAATGCAGTGG + Intronic
1089970530 11:122689623-122689645 AGACAGTGTTGGAACTGAATTGG - Intronic
1090756366 11:129795196-129795218 AGCCAAGGCTGGAGCTGGAGTGG + Intergenic
1092049423 12:5457260-5457282 AGTCAAGGTAGGAGCTGGAATGG - Intronic
1092275794 12:7060187-7060209 AGTCTGGGTTGGATCTGAAAGGG + Intronic
1092399988 12:8166759-8166781 AGCCATGGCTGGAGCTGGAGTGG + Intronic
1093853527 12:24070227-24070249 AGGAAGGGGTGGAAATGGAGGGG - Intergenic
1094108653 12:26838584-26838606 TGTCAGGGGTGGAGCTGAAGGGG - Intergenic
1095242597 12:39878994-39879016 AGTCACAGCTGGAGCTGGAGAGG - Intronic
1095426819 12:42083843-42083865 AGTGGAGGTTGGAAGTGGAGGGG - Exonic
1095930404 12:47619876-47619898 AGGCAGTGTAGGAACTGGATTGG + Intergenic
1096630905 12:52926184-52926206 AGTCTGGCTGGGCACTGGAGAGG - Intronic
1096881989 12:54680742-54680764 AAGCAGGGCTGGAGCTGGAGAGG - Intergenic
1097118397 12:56716097-56716119 AGGCAGAGTGGGAACTGGGGAGG + Exonic
1098521171 12:71436657-71436679 AGTCATGGCTAGAACTGCAGTGG + Intronic
1098849596 12:75579735-75579757 AGTCAGGCTTGGAAGAGAAGAGG - Intergenic
1099360373 12:81693440-81693462 AGTCATGGTGGGAAGTGAAGGGG - Intronic
1100862207 12:98818128-98818150 AGGGAGGGAGGGAACTGGAGAGG - Intronic
1100885915 12:99069915-99069937 AGTCAGGATTGAAACTGGCCAGG - Intronic
1101035179 12:100698689-100698711 ACACAGGGCTGGAAATGGAGGGG + Intergenic
1101150179 12:101877036-101877058 AGACAGGGTGGGAACGGGTGGGG - Intergenic
1102170243 12:110836759-110836781 AGTGAGGGCTGGAGCTGGGGAGG + Intergenic
1104256393 12:127143066-127143088 GGTCAGGGTTAGACCTGAAGAGG + Intergenic
1104298229 12:127538598-127538620 AGTCAAGCTGGGAACTGCAGAGG + Intergenic
1108883960 13:55156582-55156604 AGCCACAGTTGGAACTGGAGTGG - Intergenic
1109910557 13:68905478-68905500 AGTCACAGCTGGACCTGGAGTGG - Intergenic
1111008529 13:82281700-82281722 AATCATGGCTGGAGCTGGAGTGG + Intergenic
1111318041 13:86586486-86586508 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
1111871525 13:93838828-93838850 AGTCAGGGATGGAACTGTTTGGG + Intronic
1112451012 13:99509589-99509611 AGCCATGGCTGGAGCTGGAGTGG + Intronic
1112881300 13:104109387-104109409 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
1113648103 13:112012989-112013011 GTTCATCGTTGGAACTGGAGGGG - Intergenic
1114568078 14:23647042-23647064 ACTCAGGGTTAGAACTGGGGAGG + Intergenic
1115944402 14:38643670-38643692 AGCCATGGTTGGAGCTGGAGTGG - Intergenic
1117202776 14:53409662-53409684 ACTCAGTGTTGGACCTGGTGGGG + Intergenic
1117899003 14:60514554-60514576 AGTGACGGGTGGAAGTGGAGTGG - Intronic
1117984578 14:61374665-61374687 AGCCATGGTTGAAGCTGGAGTGG + Intronic
1119698019 14:76729540-76729562 AGTTATTGTTGCAACTGGAGGGG + Intergenic
1120771449 14:88384841-88384863 TGTCAGGATTGGAGGTGGAGTGG + Intergenic
1120873647 14:89359910-89359932 GCTCATGGTGGGAACTGGAGCGG + Intronic
1120974696 14:90238230-90238252 AGGCAGGAGTGGAGCTGGAGAGG + Intergenic
1121140751 14:91539499-91539521 AGCCATGGCTGGAGCTGGAGTGG + Intergenic
1121369323 14:93342350-93342372 AGCCATGGCTGGAGCTGGAGTGG + Intronic
1122165284 14:99818637-99818659 AGTCAGAGCTGGAGCTTGAGAGG + Intronic
1122310815 14:100792864-100792886 GGTCAGGGTGGGCACTGGGGAGG + Intergenic
1122476493 14:102013583-102013605 AGTCAGGGCTGAGACTAGAGAGG + Intronic
1123154749 14:106213306-106213328 ATTCAGGGGAGGGACTGGAGTGG - Intergenic
1202902645 14_GL000194v1_random:52332-52354 AGTCGGGTTTGGAGCTGGGGAGG + Intergenic
1126204731 15:46033051-46033073 ACTCAGGTTTGGAACTGTAGAGG - Intergenic
1126552992 15:49953456-49953478 GGTCAGGGTTAGACCTGAAGAGG + Intronic
1126783687 15:52159590-52159612 AGTCATGGCTGGAACTCAAGAGG + Intronic
1127117344 15:55742220-55742242 TGGCAGGGTTGGAAGTGAAGTGG - Intronic
1127505826 15:59596831-59596853 GGTGAGGGGTGGAACTGCAGAGG + Intronic
1130537906 15:84800016-84800038 AGTGAGGCTTGGAGCTGGAAGGG + Intronic
1130989846 15:88869769-88869791 ACTCAGGATTGGAATGGGAGAGG - Intronic
1131987603 15:98060731-98060753 AGTCACAGCTGGAGCTGGAGCGG + Intergenic
1132180981 15:99752736-99752758 AGGCAGAGTTGGAGCTGGAATGG - Intergenic
1132590131 16:723002-723024 AGGCAGAGCTGGAACGGGAGCGG - Exonic
1132939982 16:2501659-2501681 AGGGAGGGTGGGAGCTGGAGGGG + Exonic
1134352896 16:13454381-13454403 AGTCAGAGTGAGAAGTGGAGAGG - Intergenic
1135484910 16:22855734-22855756 AGTCAGCGTATGAAGTGGAGAGG - Intronic
1136998616 16:35208480-35208502 AGTCAGGAGAGGAACTTGAGGGG + Intergenic
1138122930 16:54414917-54414939 AGTTAGGGGTGGGTCTGGAGAGG + Intergenic
1138590831 16:57998892-57998914 ACTCAGGGTAGCAACAGGAGAGG - Intronic
1139194865 16:64907062-64907084 AGACAAGGTTGGAACTGGAAAGG - Intergenic
1139430871 16:66910429-66910451 AGTCAGGGCTGGGGCAGGAGGGG + Exonic
1139442168 16:66973840-66973862 GGTCAGGGCTGGAATTGGTGAGG - Exonic
1139661688 16:68425283-68425305 AGTCAAGGCTGGAACTGGTGAGG + Intronic
1140277447 16:73523304-73523326 TGTCAGGGCTGAAATTGGAGTGG - Intergenic
1140697963 16:77553548-77553570 AGTCAGGGTTGAGACTGAGGAGG - Intergenic
1140899439 16:79354318-79354340 GGTCAGGGATGCAACAGGAGAGG + Intergenic
1141690000 16:85591305-85591327 TGACAGGGTAGCAACTGGAGGGG - Intergenic
1142418191 16:89954392-89954414 AGTCAGGGTGGGAGCTGGGCAGG + Intronic
1142909925 17:3080097-3080119 AGCCATGGCTGGAGCTGGAGTGG + Intergenic
1142924579 17:3223712-3223734 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
1143066701 17:4255108-4255130 AGTGTGGGTTAGAACTGGAGTGG - Intronic
1144257215 17:13480868-13480890 AGCCATGGATGGAACTGGAGTGG - Intergenic
1144507952 17:15849353-15849375 AGGCAAGGCAGGAACTGGAGAGG - Intergenic
1145172076 17:20666985-20667007 AGGCAAGGCAGGAACTGGAGAGG - Intergenic
1147897028 17:43757683-43757705 AGGCAAGGTTGGGACTGGGGTGG + Intronic
1149145018 17:53479831-53479853 AAAGAGGGTTGGAACTGAAGAGG - Intergenic
1149884794 17:60328926-60328948 AGTCAGGCGTGGAGCTGGGGAGG - Intronic
1150270100 17:63858511-63858533 AGTTAGGGTTTGAATTGAAGGGG + Intergenic
1150963560 17:69940921-69940943 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
1151442126 17:74136180-74136202 GGACAGGGTTGGAGCTGGGGGGG + Intergenic
1152250801 17:79211703-79211725 AGTCAGGGCTGGAGATGGACCGG - Intronic
1152881043 17:82815449-82815471 AACCAGGGTGGGAACTGGGGTGG + Intronic
1152898495 17:82926922-82926944 AGTCAGGGTGGGAAGTGGGAGGG + Intronic
1153515443 18:5896360-5896382 AATCAGGGTTGGAATCAGAGAGG + Intergenic
1153556882 18:6324029-6324051 AGCCATGGCTGGAGCTGGAGTGG - Intronic
1155809075 18:30208598-30208620 AGCCATGGCTGGAACTGGAGAGG + Intergenic
1156458001 18:37305531-37305553 AGTCAGCATTTCAACTGGAGGGG - Intronic
1156904480 18:42337050-42337072 AGCCAGGGCTGAAGCTGGAGTGG + Intergenic
1157373446 18:47139715-47139737 AGACAGTGTTGGAACTGAATTGG + Intronic
1159288836 18:66390661-66390683 AGCCAGAGCTGGAACTGGAATGG - Intergenic
1159707806 18:71715246-71715268 AGACTGGATTGGAAGTGGAGTGG - Intergenic
1159707885 18:71715878-71715900 AGTGAGGGTATGAGCTGGAGTGG + Intergenic
1160732182 19:646295-646317 AGTTGGAGTTGGAGCTGGAGAGG - Intergenic
1161718700 19:5891841-5891863 AGTCAGGGCTGGAACTGAGGAGG - Exonic
1162082582 19:8227197-8227219 AGACAGGGTTGATACAGGAGAGG - Intronic
1162386005 19:10361101-10361123 AGGCAGGGTTGGATGTGCAGGGG + Intronic
1165399546 19:35589216-35589238 AGCCTGGGCTGGATCTGGAGAGG - Intergenic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
1165798470 19:38532938-38532960 GGTCAGGGCTGGAATTGGGGAGG + Intronic
1165804609 19:38572830-38572852 AGTCGGGGCTGGCAGTGGAGAGG - Intronic
1166277402 19:41763488-41763510 AGTCAGGGAAGAAACAGGAGAGG + Intronic
1166332238 19:42085437-42085459 ATCCAGGGATGGAAATGGAGAGG + Intergenic
1166424171 19:42661344-42661366 AGTCAGGGAGGGACCAGGAGAGG + Intronic
1166646180 19:44533312-44533334 GGTAAGGGTGGGAAGTGGAGAGG - Intergenic
1166999827 19:46739192-46739214 GGTCAGGGATGGCAGTGGAGAGG + Intronic
1167258584 19:48444723-48444745 AATAAGGGTTGGATTTGGAGAGG - Exonic
1167780015 19:51593105-51593127 AATCAGTGTTGGAAGTGGGGTGG - Intergenic
1167969600 19:53179831-53179853 AGACAGTGTTGGAACTGAACTGG + Intronic
925035922 2:685817-685839 AGTCATGGCTGGAGCTGGAGTGG - Intergenic
925973230 2:9122344-9122366 AGTCAGGAGGGGAGCTGGAGAGG - Intergenic
926467208 2:13205900-13205922 AGCCATGGCTGGAAGTGGAGTGG - Intergenic
927055758 2:19364164-19364186 AGTGAGGGGTGGAAAGGGAGTGG + Intergenic
927329097 2:21841635-21841657 AGTCATGGCTGGAGCTGGAGTGG - Intergenic
927794065 2:26033508-26033530 CGTCAGGGCTGGCCCTGGAGAGG + Intergenic
928578470 2:32680622-32680644 AGTCAGGGTAGGGACTGGATGGG + Intronic
928733525 2:34260285-34260307 AGTCAGGGTTGGCACTATATTGG + Intergenic
928797507 2:35040221-35040243 AGCCAAAGCTGGAACTGGAGTGG - Intergenic
928849943 2:35734004-35734026 AGTCAGGGTGGGGCCAGGAGAGG + Intergenic
929370919 2:41223021-41223043 GGTCAGGGTTAGACCTGAAGAGG - Intergenic
930119453 2:47748214-47748236 AGCCAAGGCTGGAACTGGAGTGG - Intronic
931837096 2:66110512-66110534 TGTATGGGTTGGTACTGGAGAGG + Intergenic
932001245 2:67887004-67887026 AGTCAAGGTTGGATCAGGGGAGG - Intergenic
932481123 2:72039975-72039997 AGTCAGGGAAGGAGCTGGGGAGG - Intergenic
933864172 2:86500728-86500750 AGTCACAGCTGGAGCTGGAGTGG + Intergenic
934504018 2:94878060-94878082 AGTCGGGTTTGGAGCTGGGGAGG - Intergenic
935340289 2:102053545-102053567 AGTGAGGCGTGGAACTGGGGTGG + Intergenic
937491415 2:122371835-122371857 AGCCATGGCTGGAGCTGGAGCGG + Intergenic
937884298 2:126889558-126889580 TGGCAGGGTTGGAAATGGACAGG - Intergenic
937895185 2:126972462-126972484 AAGCAGGGCTGGCACTGGAGGGG + Intergenic
939145600 2:138411061-138411083 AGTCAGGACTGGAACTACAGTGG + Intergenic
939852907 2:147321332-147321354 AGCCATGGATGGAATTGGAGTGG - Intergenic
940826269 2:158416140-158416162 AGCCATGGCTGGAGCTGGAGTGG + Intronic
942644520 2:178095878-178095900 AGCCATAGTTGGAACTGGAGTGG + Intronic
942924081 2:181411476-181411498 GGTCAGGGTTAGACCTGAAGAGG - Intergenic
943143932 2:184018275-184018297 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
944943103 2:204651929-204651951 AGCCATGGCTGGAACTGGAGTGG + Intronic
945336634 2:208600035-208600057 AGCCACAGTTGGAGCTGGAGTGG + Intronic
945900655 2:215534002-215534024 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
948030276 2:234812081-234812103 AGTCAGAGTTGGAGAAGGAGAGG - Intergenic
948104214 2:235400175-235400197 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
948292432 2:236835721-236835743 AGCCATGGTTGGAGCTGGAGTGG + Intergenic
948773163 2:240262789-240262811 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
1168870262 20:1121471-1121493 ATTCAGAGTGGAAACTGGAGAGG + Intronic
1171360988 20:24586207-24586229 AGGCAGGGGTGTAGCTGGAGGGG + Intronic
1171485606 20:25483398-25483420 AGTCTTTGTTGGAACTGCAGTGG + Intronic
1173752330 20:45487326-45487348 AGTCGGGGCTGGAGGTGGAGTGG - Intergenic
1174108313 20:48179058-48179080 AGCCAGGATTGGAACCTGAGTGG - Intergenic
1174172248 20:48624843-48624865 AGCCAGGGTTGGAGCTGGAGGGG - Exonic
1175369549 20:58478747-58478769 AGTCAGGCTTGAAGCAGGAGAGG + Intronic
1176121590 20:63456560-63456582 AGCCAGGGTTGGGTCAGGAGGGG + Intronic
1176622009 21:9067099-9067121 AGTCGGGTTTGGAGCTGGGGAGG + Intergenic
1177212013 21:18083167-18083189 AGCCATGGCTGGAGCTGGAGTGG - Intronic
1177236144 21:18391976-18391998 AGCCATGGCTGGAGCTGGAGTGG + Intronic
1178013685 21:28317780-28317802 AGTCATGGCTGGAGCTGGTGTGG - Intergenic
1178486651 21:33023613-33023635 AGTCAGGGGTGAAAGTCGAGGGG - Intergenic
1182786241 22:32910002-32910024 TCTCTGGGTTGGCACTGGAGGGG + Intronic
1184043568 22:41958404-41958426 GCTCAGGCTTGGAACTGGTGAGG + Intergenic
1184245802 22:43235242-43235264 ACCCAGGGTTGGAGCTTGAGTGG + Intronic
1184538999 22:45107380-45107402 CATCTGGGATGGAACTGGAGAGG - Intergenic
1184751056 22:46487020-46487042 AGTGAGGGCAGGAAGTGGAGGGG - Intronic
951132871 3:19069025-19069047 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
951180697 3:19655033-19655055 AGCCATGGCTGGAGCTGGAGTGG + Intergenic
952220028 3:31315743-31315765 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
952221407 3:31327466-31327488 AACCAAGGCTGGAACTGGAGTGG + Intergenic
952419033 3:33114640-33114662 AGCCAGGTCTAGAACTGGAGGGG - Intronic
953095005 3:39766505-39766527 AGCCATGGCTGGAGCTGGAGTGG + Intergenic
953963128 3:47282177-47282199 AGTCAGTTTTCGAACTAGAGGGG - Intronic
954622357 3:52003409-52003431 AGTCAGGGAGGGAACCAGAGAGG + Intergenic
954714445 3:52520169-52520191 AGTCATGGTTGGAGGTGGAAAGG - Intronic
956059594 3:65336080-65336102 TGGGAGGTTTGGAACTGGAGTGG + Intergenic
958063722 3:88516137-88516159 AGCAAGAGTTGGAAATGGAGGGG - Intergenic
958546085 3:95552446-95552468 TGTCAGGCTTGGTACTGGAATGG + Intergenic
958583892 3:96061460-96061482 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
959601363 3:108190114-108190136 AATCAGGGTTTGAACTGCACAGG - Intronic
959901049 3:111662168-111662190 AGGCACAGTTGGAGCTGGAGTGG + Intronic
960256528 3:115516748-115516770 AGCCATGGCTGGAGCTGGAGTGG + Intergenic
960538464 3:118839257-118839279 AGCCATGGCTGGAACTGGAGTGG + Intergenic
960541943 3:118871290-118871312 AGTCGTGGCTGGAGCTGGAGTGG - Intergenic
960565336 3:119126270-119126292 GGTCAGGGTTAGACCTGAAGAGG - Intronic
961207431 3:125096118-125096140 AGTCCAGGTGGGAACTGGACTGG - Intronic
962005579 3:131346025-131346047 AGGCAGGGTTGGTAGGGGAGAGG + Intronic
962408422 3:135120162-135120184 AATCAGGGTTGGAATTGCATTGG + Intronic
963799330 3:149660325-149660347 AATCAGGGTTGGAATTAGATGGG + Intronic
963799336 3:149660355-149660377 AATCTGGGTTGGAACTGGATGGG + Intronic
965398403 3:168188751-168188773 AGACAGTGATGGAACAGGAGCGG - Intergenic
966075847 3:175936189-175936211 AGTCAAGACTGGAGCTGGAGAGG - Intergenic
967251673 3:187546517-187546539 AATCAGGGAAGGAACTAGAGAGG - Intergenic
967411160 3:189167690-189167712 AGTCAGGTGAGGATCTGGAGTGG + Intronic
967768336 3:193307164-193307186 AGTGTGGGTTGGAAGCGGAGGGG - Intronic
968751403 4:2391177-2391199 AGTCAGGGATGGAGCAGAAGGGG - Intronic
969780114 4:9394815-9394837 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
970278674 4:14429799-14429821 AGGCAGGATAGGGACTGGAGTGG + Intergenic
970494303 4:16609600-16609622 GGTCAGGGTTGGGCCTGAAGAGG - Intronic
970659236 4:18265288-18265310 AGCCATGGCTGGAGCTGGAGTGG + Intergenic
971853179 4:32010437-32010459 AGTCAGGGTTAGGCCTGAAGAGG - Intergenic
971943631 4:33246098-33246120 AGCCACAGTTGGAGCTGGAGTGG + Intergenic
972847134 4:43004114-43004136 AGTCATGGCTGGTGCTGGAGTGG - Intronic
973131559 4:46654150-46654172 AGCCAAGGCTGGAGCTGGAGTGG + Intergenic
973666593 4:53165544-53165566 AGTCAGGGTGGGAGCAGGAGTGG - Intronic
974760363 4:66266433-66266455 GGTCAGGGTTAGACCTGAAGAGG - Intergenic
976807422 4:89063523-89063545 GGTCAGGGTTAGACCTGAAGAGG + Intronic
977989257 4:103421039-103421061 AGCCATGGCTGGAGCTGGAGTGG + Intergenic
978983656 4:114982902-114982924 AGCCATGGCTGGAGCTGGAGTGG - Intronic
979336819 4:119472686-119472708 AGTCAGGGCTGTGACTAGAGTGG + Intergenic
979969242 4:127114163-127114185 AGCCATGGGTGGAGCTGGAGTGG - Intergenic
980247544 4:130267078-130267100 AGCCATGGCTGGAAGTGGAGTGG - Intergenic
980706619 4:136504658-136504680 AGTGAGGGTAGGAAATGTAGAGG + Intergenic
980830656 4:138126772-138126794 AGCCAAGGCTGGAGCTGGAGTGG - Intergenic
980971803 4:139574080-139574102 AGGCAGAGGTGGATCTGGAGAGG + Intronic
982607893 4:157537625-157537647 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
983072171 4:163281017-163281039 AGCCAGGGTTGGAGTTCGAGTGG + Intergenic
983120531 4:163878516-163878538 AGTCAGGGTTAAATCTGGAAAGG - Intronic
984335016 4:178379351-178379373 AATCAGGGTTAGACCTGAAGAGG - Intergenic
984856796 4:184202413-184202435 AGTCTGGAGTGGAACAGGAGGGG + Intronic
984870224 4:184318597-184318619 ACTCAGGGTGGAAAGTGGAGGGG - Intergenic
985076761 4:186223993-186224015 AGTCACAGCTGGAGCTGGAGTGG - Intronic
986014653 5:3747499-3747521 AGCCATGGGTGGACCTGGAGTGG - Intergenic
987918580 5:24248845-24248867 AGCCACAGTTGGAGCTGGAGTGG + Intergenic
988059507 5:26148952-26148974 GGTCAGGGTTAGACCTGAAGAGG - Intergenic
988147640 5:27330935-27330957 AGTCATGGCTGGAGCTGGAGTGG - Intergenic
988647272 5:33108356-33108378 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
988770467 5:34427700-34427722 AGCCATGGGTGGAGCTGGAGTGG + Intergenic
989092051 5:37743667-37743689 GGTCAGGGTTAGACCTGAAGAGG - Intronic
989817255 5:45751152-45751174 AGTCATGGCTGAAGCTGGAGTGG + Intergenic
990136007 5:52645019-52645041 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
990285670 5:54298554-54298576 AGAAAGGGCTGGAACTGGAGGGG - Intronic
990809810 5:59710179-59710201 AGTCAGGGATGAAACAGGAATGG + Intronic
991981104 5:72231701-72231723 AGTTTGGGTAGGAACTGAAGAGG - Intronic
992425219 5:76650002-76650024 AGCCATGGTTAGATCTGGAGCGG + Intronic
992954179 5:81890869-81890891 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
993253144 5:85553811-85553833 AGCCAGAGTTGGAGCTGAAGTGG + Intergenic
993442927 5:87978616-87978638 AGCCACAGTTGGAGCTGGAGTGG - Intergenic
993752886 5:91692181-91692203 AGCCATGGCTGGAACTGGAATGG + Intergenic
994878917 5:105461099-105461121 AGCCATGGCTGGAGCTGGAGTGG + Intergenic
995183134 5:109247278-109247300 AGTCCAGGTATGAACTGGAGAGG + Intergenic
995779825 5:115763059-115763081 AGCCATGGCTGGAGCTGGAGTGG + Intergenic
996027029 5:118657713-118657735 AGCCATGGCTGGAGCTGGAGTGG + Intergenic
996893838 5:128456193-128456215 GGTCAGGGTTAGACCTGAAGAGG - Intronic
997197427 5:131989255-131989277 AGCCAGGGTGGGAAGAGGAGTGG + Intronic
997273719 5:132564795-132564817 AGCCATGGCTGGAGCTGGAGTGG - Intronic
999615438 5:153418049-153418071 AGGCAGTGTTGGAAATGAAGAGG - Intergenic
999693474 5:154168475-154168497 AGTCAGGGTTGGAAAGAGAAGGG - Intronic
1001970997 5:175954844-175954866 AGTCAGGCCTGGCACAGGAGAGG + Intronic
1001994228 5:176142695-176142717 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
1002246445 5:177888933-177888955 AGTCAGGCCTGGCACAGGAGAGG - Intergenic
1002794052 6:456529-456551 AGCCACAGCTGGAACTGGAGTGG + Intergenic
1003335818 6:5171282-5171304 AGTTAGGGTAGGAGCTGGAGAGG - Intronic
1003484438 6:6563463-6563485 AGCCATGGCTGGAGCTGGAGTGG + Intergenic
1003630628 6:7783115-7783137 AGAAAGGGTTTGCACTGGAGAGG + Intronic
1004041115 6:11976640-11976662 ACTCAGGGATGGATCTGGTGTGG - Intergenic
1004837960 6:19549352-19549374 AGTCAGGGTTGGATATAGATTGG - Intergenic
1007361520 6:41360146-41360168 AGCCAAGGCTGGAGCTGGAGTGG - Intergenic
1007419984 6:41713467-41713489 AGTCAGCGTAGGGACCGGAGGGG - Intronic
1008741571 6:54615166-54615188 GGTCAGGGTTAGACCTGAAGAGG - Intergenic
1009763567 6:68039105-68039127 AGCCACGGCTGGAGCTGGAGTGG + Intergenic
1010536596 6:77038543-77038565 AATCATGGCTGGAAATGGAGTGG - Intergenic
1010610899 6:77952883-77952905 AGTCATGGATGGAAGTGAAGGGG - Intergenic
1010611009 6:77953795-77953817 AGCCATGGCTAGAACTGGAGTGG - Intergenic
1011748944 6:90435976-90435998 AGGCAGGGTTGAAACTAGTGAGG + Intergenic
1012485877 6:99722314-99722336 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
1012663970 6:101943100-101943122 AGCCATGGCTGGAGCTGGAGTGG - Intronic
1013082444 6:106824219-106824241 AGTGAGGGGTGGGGCTGGAGGGG + Intergenic
1013227171 6:108128401-108128423 AGTCAGGGATGGACCTGGCAAGG - Intronic
1013716422 6:112968085-112968107 AGCCACGGCTGGAGCTGGAGTGG + Intergenic
1014864021 6:126505951-126505973 GGTCAGGGTTGGGCCTGAAGAGG - Intergenic
1016718654 6:147266163-147266185 GGTAAGGGATGGAACTGGAGAGG + Intronic
1017124202 6:151050669-151050691 AGACAGGGTCGGAACTGAACTGG + Intronic
1019536901 7:1533933-1533955 AGCCAGGGCGGGGACTGGAGGGG + Intronic
1019594798 7:1853564-1853586 AGGCAGGGTGGGGGCTGGAGCGG - Intronic
1019710406 7:2515796-2515818 AGGCAGGGTTGGGAATGGTGGGG + Intronic
1020223968 7:6265123-6265145 AGTCAGGGAGGAAACGGGAGAGG + Intronic
1020249108 7:6452955-6452977 AGGCAGGGGTGGGGCTGGAGCGG + Intronic
1020810724 7:12846848-12846870 AGCCATGGCTGGAGCTGGAGTGG + Intergenic
1021249552 7:18307185-18307207 AGCCAGGATTTGAACTTGAGAGG - Intronic
1021925843 7:25532885-25532907 TGTCAGGGTAGGAGATGGAGTGG - Intergenic
1022537233 7:31105806-31105828 AGTAGGAGCTGGAACTGGAGAGG + Intronic
1022839876 7:34153671-34153693 AGTCAGGATTTGTAATGGAGTGG + Exonic
1023316085 7:38938719-38938741 AGTCACAGTGAGAACTGGAGAGG + Intergenic
1023420854 7:39978071-39978093 TGTCAGAGTTGGAAGTAGAGAGG + Intronic
1024497758 7:50067874-50067896 AGTTAGAGTTAGAACTGGTGTGG + Intronic
1027666456 7:81047128-81047150 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
1027959045 7:84919983-84920005 AGCCATGGTTGGAGCTGGAGTGG + Intergenic
1028281739 7:88938101-88938123 AAGCAGGGTTGGAAGTGGGGAGG + Intronic
1029131561 7:98335274-98335296 GGTCAGCGTTGGAAGTGGAAAGG - Intronic
1031279904 7:119785752-119785774 AGTATGAGTTGGAACAGGAGTGG - Intergenic
1032196184 7:129789927-129789949 AGGGAGGGTAGGAAGTGGAGGGG + Intergenic
1032346319 7:131119774-131119796 AGCCATGGCTGGAGCTGGAGTGG + Intronic
1033104980 7:138512624-138512646 AGCCATGGCTGGAACTGGAGAGG + Intronic
1034585773 7:152091012-152091034 AGTCAGGGTTGTGGTTGGAGAGG + Intronic
1034845731 7:154442880-154442902 AACCAGGGTGGGAACAGGAGCGG - Intronic
1035128585 7:156629872-156629894 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
1035482717 7:159200477-159200499 AGTCAGGGGTGGCCCAGGAGGGG + Intergenic
1036277533 8:7368794-7368816 AGCCATGGCTGGAGCTGGAGTGG - Intronic
1036638759 8:10569174-10569196 AGCCAGGATTGGAATCGGAGTGG + Intergenic
1036742160 8:11372843-11372865 AGTCATGGTTGCCTCTGGAGAGG - Intergenic
1037552751 8:19991000-19991022 ATACAGAGCTGGAACTGGAGAGG - Intergenic
1038298827 8:26323375-26323397 AGACAGTGTTGGAACTGAATGGG - Intronic
1041436933 8:57852373-57852395 AGGCAGAGTTGCAACTTGAGAGG + Intergenic
1042274806 8:66993206-66993228 AGGTAGGGATGGAAATGGAGTGG - Intronic
1042424612 8:68632722-68632744 AGCCACGGCTGGAGCTGGAGTGG - Intronic
1042640957 8:70933406-70933428 AGTCAGAGTTGGAGATGAAGGGG + Intergenic
1043065748 8:75568014-75568036 AGCCATGGCTGGAGCTGGAGTGG + Intergenic
1043085529 8:75827128-75827150 AGACATGGCTGGAGCTGGAGTGG - Intergenic
1043214603 8:77569909-77569931 AGCCATGGCTGGAGCTGGAGTGG + Intergenic
1043518539 8:81019483-81019505 AGCCATGGCTGGAACTGAAGCGG - Intronic
1043593611 8:81858749-81858771 AGTCAGGGTTTGAAATGAGGAGG - Intergenic
1044356143 8:91224929-91224951 GGTCAGGGTTAGACCTGAAGAGG + Intronic
1044429330 8:92090118-92090140 AGTCAGTGATTGAACTGGAAAGG + Intronic
1044941428 8:97347913-97347935 GGACAGGGAAGGAACTGGAGTGG + Intergenic
1045520164 8:102896529-102896551 ACTCAGCTTTGGTACTGGAGGGG - Intronic
1045791314 8:105987931-105987953 AGCCATGGCTGGACCTGGAGTGG - Intergenic
1046134063 8:110003889-110003911 AGCCATGGCTGGAGCTGGAGTGG + Intergenic
1046324243 8:112620017-112620039 AACCAGGGATGGAAGTGGAGTGG + Intronic
1047536719 8:125726748-125726770 AGTTAGGTTTGGGAGTGGAGGGG + Intergenic
1048142046 8:131804139-131804161 GGGCAGGGTTGGAGGTGGAGGGG + Intergenic
1048213420 8:132475999-132476021 AGCCATGGCTGGAACTGGAGCGG - Intronic
1048839341 8:138551328-138551350 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
1049422608 8:142523588-142523610 AGTCAGGGGTGGATCAGGAGGGG + Intronic
1049603618 8:143519209-143519231 GGTCAGGGTAGGAGCTGGGGAGG + Intronic
1050674551 9:8037016-8037038 AGCCATGGCTGGAGCTGGAGTGG + Intergenic
1050907839 9:11027461-11027483 AGCCAAGGCTGGAGCTGGAGTGG + Intergenic
1050987549 9:12102236-12102258 AGACAGGGCTGGAGCTGGGGTGG + Intergenic
1051064707 9:13088842-13088864 GGACAGGGTGGGAGCTGGAGGGG + Intergenic
1052168071 9:25357855-25357877 AGCCATGGCTGGAGCTGGAGTGG + Intergenic
1053119039 9:35531474-35531496 AGTAGGGATAGGAACTGGAGAGG + Intronic
1053125841 9:35580332-35580354 AGCCATGGCTGGAACTGAAGTGG - Intergenic
1053264272 9:36699095-36699117 AGCCATGGCTGGAACTGGAGTGG + Intergenic
1054797174 9:69313298-69313320 AGTCACAGCTGGAGCTGGAGTGG + Intergenic
1055597900 9:77884168-77884190 TCTCAGGGTTGGAACTGGGAGGG + Intronic
1055698627 9:78917154-78917176 AGCCACAGTTGGAGCTGGAGTGG - Intergenic
1057332487 9:94128854-94128876 AGCCATGGTTGGAGTTGGAGTGG - Intergenic
1057548285 9:96034170-96034192 AGTCAGGGTAGGGATAGGAGGGG + Intergenic
1057729483 9:97596324-97596346 AGTGAGGGTTCTAAGTGGAGGGG - Intronic
1058323062 9:103658409-103658431 AGCCAGGACTGGAACTGGAGTGG - Intergenic
1058385332 9:104429307-104429329 AGCCATGGCTGGAGCTGGAGTGG - Intergenic
1059917280 9:119117818-119117840 AGCCAAGGCTGGACCTGGAGTGG - Intergenic
1060316121 9:122512239-122512261 AGTCAGTGCTGAATCTGGAGTGG - Intergenic
1060342883 9:122792523-122792545 AGGTAGGGTTGGAGTTGGAGAGG + Intergenic
1060754956 9:126205973-126205995 TGCCAGGGTGGGAAATGGAGAGG - Intergenic
1060766272 9:126296807-126296829 AGAGAGGCTTAGAACTGGAGTGG - Intergenic
1062185251 9:135214798-135214820 AATCAGGGGTGGTATTGGAGAGG - Intergenic
1062409458 9:136415479-136415501 TGTCAGGGGTGGACCAGGAGAGG + Intronic
1203745200 Un_GL000218v1:37521-37543 AGTCGGGTTTGGAGCTGGGGAGG + Intergenic
1203564908 Un_KI270744v1:81963-81985 AGTCGGGTTTGGAGCTGGGGAGG - Intergenic
1187005644 X:15230535-15230557 AATCAGGGTGGGGAGTGGAGAGG - Intergenic
1188715804 X:33457519-33457541 AGCCACGGTTGGAGCTAGAGTGG + Intergenic
1189230099 X:39445416-39445438 AGGCTGGGTGGGAACCGGAGTGG - Intergenic
1189312441 X:40029200-40029222 AGGTAGGGTTGGAACTGAATTGG + Intergenic
1189431424 X:40950651-40950673 AGCCAAGGCTGGATCTGGAGTGG + Intergenic
1189553114 X:42113693-42113715 AGCCAAGGCTGGAGCTGGAGTGG + Intergenic
1189776003 X:44470619-44470641 GGCCAGGGTAGGAACTGCAGGGG + Intergenic
1190466133 X:50726572-50726594 AGCCATGGCTGGAGCTGGAGTGG - Intronic
1190765665 X:53473637-53473659 AGTCAGGGTTGGAACTGGAGAGG + Intergenic
1191734726 X:64376943-64376965 AGCCATGGCTGGAGCTGGAGTGG - Intronic
1192522948 X:71817077-71817099 AGTCTGAGATGGAACTGTAGGGG + Intergenic
1193236650 X:79114698-79114720 AGCCATGGCTGGAACTGGAGTGG + Intergenic
1193271523 X:79534858-79534880 AGTCACAGTTGGAGCTGGAGTGG + Intergenic
1193421849 X:81292375-81292397 AGCCATGGTTGTAGCTGGAGTGG + Intronic
1193850474 X:86531455-86531477 AGCCATGGCTGGAACTGGAGTGG - Intronic
1193872487 X:86817536-86817558 GGTCAGCTTTGGAACTGGAGAGG + Intronic
1194244413 X:91493543-91493565 AGCCAGGGCTGGAGCTTGAGGGG + Intergenic
1194666035 X:96678581-96678603 TGTGAGGATTGGAACTGGAGTGG - Intergenic
1195128891 X:101836028-101836050 AGTCTGGGATGAAACTAGAGTGG - Intronic
1195177390 X:102323822-102323844 AGTCTGGGATGAAACTGGAGTGG + Exonic
1195181474 X:102363271-102363293 AGTCTGGGATGAAACTGGAGTGG - Exonic
1195614720 X:106903237-106903259 AGCCAGGGCTGGAACAGGGGTGG + Exonic
1195983124 X:110601149-110601171 AGTCAGGGTTAGGCCTGAAGGGG - Intergenic
1196208695 X:112970666-112970688 AGACAATGTTGGAACTGGAAGGG + Intergenic
1196366784 X:114932649-114932671 AGCAAGGGCTGGAGCTGGAGTGG + Intergenic
1196524718 X:116718948-116718970 AGCCACGGCTGGAGCTGGAGTGG + Intergenic
1197046476 X:122004088-122004110 GGTCAGGGTTAGACCTGAAGAGG + Intergenic
1197719144 X:129733170-129733192 AGCCAAGGCTGGAGCTGGAGTGG - Intergenic
1198142148 X:133814921-133814943 TGTCAAGTTTGGAACAGGAGAGG - Intronic
1198142435 X:133818030-133818052 TGTCAAGTTTGGAACAGGAGAGG + Intronic
1198227554 X:134659458-134659480 TGGCAGGGTGGGAACGGGAGTGG + Intronic
1198799015 X:140431023-140431045 AGTCAGGCTTGGCATTGGAGGGG - Intergenic
1199117418 X:144008793-144008815 AGCCAGGGCTGGAGCTGGAGTGG + Intergenic
1199561968 X:149172637-149172659 AGCCATGGCTGGAGCTGGAGTGG + Intergenic
1199886394 X:152025660-152025682 AGTCAGGGTGGGAAATGGCCTGG + Intergenic
1200079977 X:153571510-153571532 AGGCTGGGCTGGACCTGGAGAGG - Intronic
1200356980 X:155562306-155562328 AGCCACAGTTGGAGCTGGAGTGG + Intronic
1200563391 Y:4734840-4734862 AGCCATGGCTGGAGCTGGAGGGG + Intergenic
1201908183 Y:19106245-19106267 AGACAGGGTAGAAAATGGAGCGG - Intergenic
1202583807 Y:26405184-26405206 GGTCAGGGTCAGAACAGGAGCGG + Intergenic