ID: 1190765967

View in Genome Browser
Species Human (GRCh38)
Location X:53475872-53475894
Sequence AGGGAGTATGGAATGGCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 6, 3: 27, 4: 232}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190765958_1190765967 20 Left 1190765958 X:53475829-53475851 CCAGGTAAGAACCATAGCCAGCT 0: 1
1: 0
2: 0
3: 8
4: 94
Right 1190765967 X:53475872-53475894 AGGGAGTATGGAATGGCTAGTGG 0: 1
1: 0
2: 6
3: 27
4: 232
1190765956_1190765967 24 Left 1190765956 X:53475825-53475847 CCCACCAGGTAAGAACCATAGCC 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1190765967 X:53475872-53475894 AGGGAGTATGGAATGGCTAGTGG 0: 1
1: 0
2: 6
3: 27
4: 232
1190765957_1190765967 23 Left 1190765957 X:53475826-53475848 CCACCAGGTAAGAACCATAGCCA 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1190765967 X:53475872-53475894 AGGGAGTATGGAATGGCTAGTGG 0: 1
1: 0
2: 6
3: 27
4: 232
1190765960_1190765967 9 Left 1190765960 X:53475840-53475862 CCATAGCCAGCTGAGGTGCTTGC 0: 1
1: 7
2: 43
3: 172
4: 383
Right 1190765967 X:53475872-53475894 AGGGAGTATGGAATGGCTAGTGG 0: 1
1: 0
2: 6
3: 27
4: 232
1190765961_1190765967 3 Left 1190765961 X:53475846-53475868 CCAGCTGAGGTGCTTGCTGAAGG 0: 215
1: 274
2: 201
3: 142
4: 321
Right 1190765967 X:53475872-53475894 AGGGAGTATGGAATGGCTAGTGG 0: 1
1: 0
2: 6
3: 27
4: 232
1190765955_1190765967 25 Left 1190765955 X:53475824-53475846 CCCCACCAGGTAAGAACCATAGC 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1190765967 X:53475872-53475894 AGGGAGTATGGAATGGCTAGTGG 0: 1
1: 0
2: 6
3: 27
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190765967 Original CRISPR AGGGAGTATGGAATGGCTAG TGG Intergenic
900997859 1:6132078-6132100 AGGTAGTTTGGAATGGCTGGGGG - Intronic
902562184 1:17284478-17284500 AGTGAGCATGGCAAGGCTAGGGG + Intergenic
907550419 1:55300236-55300258 AAGGAGTCTGGTATGGCTACTGG - Intergenic
908157834 1:61374326-61374348 TGGGGGGATGGGATGGCTAGGGG + Intronic
909233515 1:73121339-73121361 AGGGAATATGAAATGGATAGTGG + Intergenic
909341615 1:74538341-74538363 GGGGAGTATTGAATGACTGGGGG + Intronic
910493647 1:87801430-87801452 AGGGAATACGGAGTGCCTAGTGG - Intergenic
910530201 1:88227155-88227177 AGGGATAATGGAATGGATACTGG + Intergenic
910537522 1:88315590-88315612 AGAGAGTAATGAAAGGCTAGTGG - Intergenic
912088168 1:106036125-106036147 GAAGAATATGGAATGGCTAGTGG + Intergenic
912687971 1:111781905-111781927 AGGGAGAAGGGACTGGGTAGAGG + Intronic
912799064 1:112710120-112710142 AGTAAGTATGGAGAGGCTAGTGG + Exonic
917623604 1:176823354-176823376 AGGAAGTATGGAATGACTCAAGG + Intronic
918184818 1:182117531-182117553 AGGCAGTCTGGAATGGCAATGGG + Intergenic
919424522 1:197413086-197413108 AGGGAGTATGGTAGTTCTAGGGG + Intronic
920391205 1:205603673-205603695 AGGGAGTATGGAATGGGAATAGG + Intronic
922956383 1:229604734-229604756 AGGGAATACAGAATGGGTAGTGG + Intronic
924432651 1:244009909-244009931 GGGGAATATGGAATGGGTAGAGG + Intergenic
924619967 1:245651824-245651846 TGGGAGTAGGGAATGGTTTGGGG - Intronic
1063939006 10:11108010-11108032 AGGGAGTAAGGAGTGGGGAGAGG - Intronic
1064445758 10:15391494-15391516 AGGGAACGTGGAATGGGTAGTGG - Intergenic
1064753573 10:18555678-18555700 ATGGAGAATGGAATGGACAGTGG + Intronic
1064753781 10:18557024-18557046 ATGGAGAATGGAATGGAAAGTGG + Intronic
1064753855 10:18557551-18557573 ATGGAGAATGGAATGGACAGTGG + Intronic
1064755548 10:18569380-18569402 AGGGAGAATGGAATGGAAAATGG - Intronic
1064755934 10:18571920-18571942 ATGGAGAATGGAATGGAAAGGGG - Intronic
1065453760 10:25884704-25884726 AGGGAATACAGAATGGGTAGTGG + Intergenic
1065607263 10:27430646-27430668 AGAAACTATGGAATGGGTAGTGG + Intergenic
1066137869 10:32469063-32469085 AAAGAGTATGGAATAGATAGTGG - Intronic
1067368666 10:45661405-45661427 GGGGAGGATGGAGGGGCTAGTGG - Intronic
1069729814 10:70603289-70603311 AGGGAGGAGGGAATGGCCACAGG - Intergenic
1070499300 10:77055463-77055485 AGGGAGGAAGGAATGGATGGAGG - Intronic
1070828865 10:79406651-79406673 AGGGAGGATGAAATGGCTGGTGG - Intronic
1073027270 10:100497182-100497204 AGGGAGTGTGGAGCGGCTGGTGG - Exonic
1074235409 10:111580121-111580143 AGGGAATATGGAATGGGTAGTGG - Intergenic
1074399897 10:113133399-113133421 AAGGAGGATGGAAGGGCTGGGGG - Intronic
1074653154 10:115548001-115548023 AGTGATTATGGGATGGATAGTGG + Intronic
1075748002 10:124741623-124741645 AGAGAGGATGGAGAGGCTAGCGG + Intronic
1077434476 11:2532197-2532219 AGGGAGTGTGGAATGGCCTGAGG - Intronic
1077793619 11:5467858-5467880 AGAGAGGATTGAATGACTAGAGG - Intronic
1077812179 11:5649268-5649290 AGAGAATATGGAATGGTTAGTGG - Intergenic
1078822067 11:14892258-14892280 TGGGAGTATGGCAGGGCTGGAGG - Intergenic
1080285772 11:30609575-30609597 AGGGAGTAGGGATTGGATGGAGG - Intergenic
1081821787 11:46004435-46004457 GGGGAGTAGGGAAGGGGTAGAGG + Intronic
1082221659 11:49646075-49646097 ACTGATTATGGATTGGCTAGTGG - Intergenic
1082885652 11:58079322-58079344 AGGAGTTATGGAATGGCTTGAGG + Intronic
1083134241 11:60656439-60656461 AGGAAATATGGAATGGGTAGTGG + Intergenic
1083261028 11:61523282-61523304 AGGGAGTGGGGAAGGGTTAGAGG + Intronic
1085419619 11:76344404-76344426 AATGAGTATGGAAAGACTAGGGG - Intergenic
1086079847 11:82891613-82891635 AGGGAGGATGGTATGTCTGGAGG - Intronic
1086627374 11:88973083-88973105 ACTGATTATGGATTGGCTAGTGG + Intronic
1087247500 11:95856220-95856242 AGGGGAACTGGAATGGCTAGGGG + Intronic
1088037099 11:105330309-105330331 TGGAAATATGGAATGGGTAGTGG + Intergenic
1088088633 11:106011277-106011299 AGGGAGTCAGGAATGAATAGTGG - Intronic
1088308518 11:108435621-108435643 AGAGAATATGAAATAGCTAGTGG + Intronic
1088684942 11:112276804-112276826 GGGCAGTAGGGAGTGGCTAGGGG + Intergenic
1089070089 11:115693080-115693102 GGAGAGTCTGGAATGGCAAGAGG + Intergenic
1091640673 12:2234804-2234826 AGGCAGTATAGATTGGCAAGAGG + Intronic
1091669843 12:2445142-2445164 AGGGAGTAGGGAATGTGGAGGGG - Intronic
1092267367 12:6992673-6992695 AGGGAGAAAGGAAAGACTAGTGG - Intronic
1093943848 12:25085339-25085361 AGGTGGTATGGAATGGGAAGGGG + Intronic
1094182541 12:27607340-27607362 AGGGAGAATGGCATTACTAGGGG + Intronic
1094327115 12:29252382-29252404 AGGGAACATGGAATGAATAGTGG + Intronic
1094841261 12:34343574-34343596 AGGGAGTCTTGAAAGGCCAGGGG + Intergenic
1095390477 12:41700049-41700071 AGGGGGTATGGTATGGGGAGGGG + Intergenic
1097040593 12:56153836-56153858 AGGGAGTCTGGGATGTCAAGGGG - Intronic
1099994939 12:89768443-89768465 AGGGAATACAGAATGGGTAGTGG - Intergenic
1101156575 12:101933305-101933327 AGGGAGAATGTAATGGGAAGAGG - Intronic
1104600079 12:130147261-130147283 AGGGAGCACTGAGTGGCTAGTGG - Intergenic
1105974033 13:25457191-25457213 TGTGAGTCTGGAATGGCTACTGG + Intronic
1106844504 13:33723601-33723623 AGGGAGTATTGATTTGCTGGGGG + Intergenic
1107732749 13:43365137-43365159 AAGGAGCAAGGCATGGCTAGCGG - Intronic
1108575084 13:51783657-51783679 CGGGATTAGGGAGTGGCTAGGGG - Intronic
1108856924 13:54804146-54804168 ACGGAGAGTGGAATGGCGAGAGG + Intergenic
1109392578 13:61711286-61711308 AGGGAATATGGGGTGGATAGTGG + Intergenic
1109955293 13:69557718-69557740 AGGGATTATAGAATGGGTAGTGG + Intergenic
1110949479 13:81466774-81466796 AGGGAGAATCATATGGCTAGGGG + Intergenic
1110968815 13:81735093-81735115 AGTGAGTATGGAAAGGCAAAGGG - Intergenic
1111439236 13:88257708-88257730 AGGGAGTAGGGAATGCATATTGG + Intergenic
1112191229 13:97179784-97179806 AAGGAGCATGGAATGTCAAGGGG + Intergenic
1112194716 13:97213926-97213948 AGGGAGTATGGAATGGACGTGGG - Intergenic
1114483020 14:23047153-23047175 AGGGAGTAGGGAAAGGAAAGGGG - Exonic
1115000568 14:28416231-28416253 AGGGAGTATGGCAGGGCAAAAGG - Intergenic
1115478624 14:33840220-33840242 AGGGAGTTTGGAATGGGCATAGG + Intergenic
1116664408 14:47756804-47756826 AGGGAGTAACGAATGGCAAGGGG - Intergenic
1117342724 14:54805726-54805748 AGGGTGTGTGGTGTGGCTAGAGG - Intergenic
1117962735 14:61178963-61178985 AGGGAAAATGGCATGGATAGTGG + Intergenic
1118312771 14:64705414-64705436 GGGGAGAATGGAATGGTTGGAGG + Intronic
1118329248 14:64802948-64802970 GGGGAGAATGGAAAGGCAAGAGG - Intronic
1118689909 14:68328447-68328469 ATGGAGTATGGAATCACTAAAGG - Intronic
1119236333 14:73022810-73022832 TGGGAGTACAGAATGACTAGGGG - Intronic
1119460117 14:74794890-74794912 AGGGAATATGGAATGAGTAGTGG - Intronic
1120063617 14:80014120-80014142 AGAGAATATAGAATGGATAGTGG + Intergenic
1122304121 14:100750730-100750752 AGGGAATATGAAATGGCCATTGG + Intergenic
1126117492 15:45221880-45221902 AGGGAATGTGAAATGGATAGGGG - Intergenic
1126172921 15:45709053-45709075 AAGGAGGATGCAATGGCCAGTGG + Intergenic
1126838874 15:52696248-52696270 TGGGAGAGAGGAATGGCTAGAGG - Intronic
1129675211 15:77629651-77629673 AGGGAGTAGCTATTGGCTAGCGG - Intronic
1130017155 15:80196427-80196449 AGGGGCTATGGAATGGGTGGTGG + Intergenic
1130377185 15:83339663-83339685 AGGGAATATGGAATGAGTAGTGG + Intergenic
1136246017 16:28976301-28976323 AGGGTGTCTGGAATGGGGAGAGG + Intronic
1143055194 17:4157050-4157072 AAGGAGCATGTGATGGCTAGCGG - Exonic
1143709017 17:8720954-8720976 ACGGAGAATGGACTGGATAGGGG - Intergenic
1143825778 17:9605855-9605877 AGAGAGTATGCAATGCCAAGAGG + Intronic
1145894880 17:28449952-28449974 AGAGAGCATGGAATGAGTAGTGG + Intergenic
1146585098 17:34075568-34075590 AGGGAGTCAGGAAAGGCTAATGG - Intronic
1147167011 17:38598894-38598916 ATGGAGAAGGGAGTGGCTAGAGG - Intronic
1150645737 17:66976483-66976505 AGGGAGGATGGAGAGGATAGAGG - Intronic
1150718794 17:67596836-67596858 AGGGAGTATAGAAAAGCAAGGGG - Intronic
1152860994 17:82697245-82697267 AGGGAGTGTGGCACGGCTGGAGG - Intronic
1154272972 18:12935976-12935998 AGGGAATCTGGAATGGGTAGTGG - Intergenic
1155283070 18:24260661-24260683 AGGGAGTATTTAATGGGTACAGG + Intronic
1156722570 18:40088181-40088203 AGGGAGCATGGAAAGGAAAGTGG + Intergenic
1157018851 18:43754222-43754244 TGGGAGTAAACAATGGCTAGGGG + Intergenic
1157672034 18:49538821-49538843 ATGGAACATGGAATGACTAGTGG + Intergenic
1158492309 18:57921182-57921204 AGGAAGTAGGGAAAGGATAGAGG - Intergenic
1163353807 19:16796603-16796625 AGGGAGAAAGGAAGGGATAGCGG - Intronic
1166912800 19:46172464-46172486 AGGGATTATGGAATGGATAGTGG + Intergenic
1168461331 19:56561141-56561163 AAGGAATATGGAAAGGCTATTGG - Intergenic
926213883 2:10891568-10891590 AGGGAGCATGGCTTGGCAAGGGG + Intergenic
926619976 2:15038792-15038814 AGGCAGCATGGAGTGGCTACGGG - Intergenic
926840174 2:17071222-17071244 AGGGTGTATGGAAATGCCAGAGG + Intergenic
927286204 2:21359705-21359727 AGGAAATATGGAATGAGTAGGGG - Intergenic
931835432 2:66093997-66094019 AGGGAGTGAGGAATGGTGAGGGG + Intergenic
933458650 2:82549951-82549973 AGGCAGTATAGAAAGGGTAGGGG - Intergenic
933796813 2:85926633-85926655 AGGGAGATTGGCATGGGTAGGGG + Intergenic
934094092 2:88582480-88582502 AGGGAATATGGGATGGATAGAGG + Intronic
935712593 2:105912541-105912563 AGGGAGTGTGCCATGGCAAGGGG + Intergenic
938204152 2:129402878-129402900 AGGGAATAGAGAATGGGTAGTGG + Intergenic
941387056 2:164866539-164866561 AGGGAATACAGAATGGGTAGTGG + Intergenic
941584784 2:167344004-167344026 AGGGAGTATTGGGTGGCTATGGG + Intergenic
943507738 2:188782950-188782972 AGGAAGGATGGAATTTCTAGTGG - Intronic
944580070 2:201124704-201124726 AGGGGGAACAGAATGGCTAGGGG + Intronic
945465328 2:210162916-210162938 AGGTAGGATAGAATGGCTAGAGG - Intronic
946973703 2:225123511-225123533 AGGGAGGAAGGAAAGGATAGAGG - Intergenic
948926984 2:241105554-241105576 AGAGAGGAGGGAATAGCTAGAGG - Intergenic
1174865361 20:54130582-54130604 AGGGATTGGGCAATGGCTAGTGG + Intergenic
1177855008 21:26390908-26390930 AGGCAGTAAGGTATGGCTAATGG + Intergenic
1181471477 22:23142895-23142917 AGAGAGTCTGGCATGGCTGGAGG - Intronic
1185398339 22:50603768-50603790 AGGGAGGATGGACTGGCTGCTGG + Intronic
950625010 3:14238858-14238880 AGGGACTATGGAATGGTTAGTGG + Intergenic
951510975 3:23501626-23501648 AGGGACTATGGTGTGGGTAGGGG + Intronic
952418654 3:33112037-33112059 AGGGAGGAATGAATGGGTAGAGG - Intergenic
952441213 3:33331357-33331379 AGGCTGTCTGTAATGGCTAGTGG + Intronic
953009783 3:39014019-39014041 AGGTATTATGGAATGGGTAATGG - Intergenic
953700935 3:45195264-45195286 AGGGACTTTGGAATCACTAGTGG - Intergenic
954927468 3:54248853-54248875 AGGGAATACAGAATGGGTAGTGG + Intronic
958952216 3:100428950-100428972 AGGGAGTATGGATTGGAAGGGGG + Intronic
959121835 3:102241957-102241979 AGGGAGTGTGGCTTGGCTATAGG + Intronic
959180899 3:102979254-102979276 AGGGTCTTTGGAATAGCTAGTGG + Intergenic
961964544 3:130888635-130888657 AGGGAGAGTGCAGTGGCTAGTGG - Intronic
965768331 3:172154661-172154683 CGGGAGTGTGGAATGGTCAGGGG - Intronic
966068225 3:175842283-175842305 AAGTAGTATGGAGTGGCTGGAGG - Intergenic
966601762 3:181782370-181782392 AGGGAGTGTGGTATGGACAGGGG - Intergenic
970389993 4:15599213-15599235 AGGGAGTACTGAATGACTTGGGG - Intronic
971162186 4:24144676-24144698 AGGGAGAAGGGCAAGGCTAGTGG - Intergenic
978172331 4:105688245-105688267 AAAGACTATGGAATGGCTGGCGG - Intronic
979905309 4:126281750-126281772 AGGGAGCATGGAAGGGATAGGGG + Intergenic
980705214 4:136484487-136484509 AGGTAATATGGAATGGGTAGTGG - Intergenic
982301445 4:153882887-153882909 AAGGAATATGGAATGGATAATGG + Intergenic
982623063 4:157730925-157730947 AGGGAATACAGAATGGGTAGTGG - Intergenic
982772233 4:159407206-159407228 AGGGAATATAGAATGGTTAGTGG + Intergenic
982860946 4:160448142-160448164 AAGGACTATGGAATGGATAGTGG + Intergenic
982897854 4:160956946-160956968 AGACAGTATGGAATGCCCAGTGG + Intergenic
983352159 4:166603450-166603472 AGGAAGGACAGAATGGCTAGAGG - Intergenic
983685887 4:170408624-170408646 ATGCAGTAGGGAATGACTAGAGG - Intergenic
983756160 4:171339685-171339707 AGAGAGCATGGAAAGTCTAGTGG + Intergenic
984301356 4:177922950-177922972 AGGGAATATTGAATGGATAATGG - Intronic
986206403 5:5628840-5628862 GGGGAGAATGGAAAGGCAAGAGG - Intergenic
987124855 5:14802690-14802712 AGGGAGAATGGGATGGCTGAGGG - Intronic
987296308 5:16555014-16555036 AGGGAGTAGGGAGTGGTGAGGGG - Intronic
989306717 5:39966346-39966368 AATGAGTATGGAATGACTGGAGG - Intergenic
990320737 5:54627766-54627788 AGGGAGCATGGCTTGGCCAGTGG - Intergenic
991427472 5:66506481-66506503 AGGGAACATGGAATAGGTAGTGG - Intergenic
992099913 5:73396984-73397006 AGGGAATATGGAATGGGTAGTGG + Intergenic
996258601 5:121437681-121437703 AGGGAATAGGGAATGGTTAGTGG - Intergenic
996381463 5:122866469-122866491 ATGGAATATGGAATGGGTAGAGG - Intronic
996775793 5:127131066-127131088 AGGGAGAATGGAGAGGCAAGAGG + Intergenic
997234597 5:132265515-132265537 AGGGACTAAGGAATGGGCAGAGG + Intronic
997361585 5:133298776-133298798 AGGGAGAATGGCCTGGCAAGTGG - Intronic
998504975 5:142665298-142665320 ACGGAGGATGGAAGGGCAAGGGG - Intronic
998865382 5:146494883-146494905 AGGAAGTAGGTAATGGCTGGTGG - Intronic
999047486 5:148484883-148484905 AGGGAGTATGTAAAGGCCTGAGG - Intronic
999142664 5:149372644-149372666 GGGGAGGATTGAATTGCTAGGGG + Intronic
1000063200 5:157674177-157674199 AGGAGGTATGGGGTGGCTAGGGG - Intronic
1000150583 5:158496747-158496769 AGGGAATATGGAATGGGTTTGGG + Intergenic
1000266399 5:159641874-159641896 AGGGTGAGTGGAATGGCGAGGGG - Intergenic
1000484798 5:161828280-161828302 AGGGAATTTGTAGTGGCTAGTGG - Intergenic
1000497623 5:162004691-162004713 AGGGAGAATGTAATTGCTATAGG - Intergenic
1001181372 5:169523718-169523740 AGGAAGAATGGAATAGCAAGAGG + Intergenic
1001814104 5:174653419-174653441 AGGGAGTTAGGGATGGTTAGTGG + Intergenic
1002403349 5:179007328-179007350 CAGGAATATGGAATGGGTAGTGG - Intergenic
1003023358 6:2530957-2530979 AGGGAATTTAGAATGGATAGAGG + Intergenic
1005225530 6:23638018-23638040 AGGGAATAAGGAATGGGTATTGG - Intergenic
1006805422 6:36785495-36785517 AGGGAGTAAGCAATGGCTTTTGG + Intronic
1006875972 6:37296661-37296683 AGGGAGTAGAGAATGGAGAGAGG - Intronic
1006902243 6:37510739-37510761 AGGGAGGAGGGAATGGAGAGAGG + Intergenic
1006994480 6:38245521-38245543 AGGGAGTATGGAGAGGCAGGGGG + Intronic
1009336077 6:62492403-62492425 AGGAAGTTTGGACTGGGTAGAGG + Intergenic
1009589746 6:65652119-65652141 AGGGAAGCTGGAATGGCTTGAGG + Intronic
1010025776 6:71214685-71214707 AGGAAGTATGGAATTGGTATAGG + Intergenic
1010073461 6:71772057-71772079 CTGGAGTATGGAAAGACTAGAGG + Intergenic
1010291872 6:74147079-74147101 AGGGAATACAGAATGGGTAGTGG - Intergenic
1010372988 6:75133598-75133620 GGGGAGTATTGGATGGCTGGAGG - Intronic
1011050938 6:83149134-83149156 GGAGAGTATGGAATGGAAAGGGG + Intronic
1011462464 6:87619076-87619098 AGGGAGTAAGGAAAGGCTAAGGG + Intronic
1012790160 6:103683120-103683142 ATGAAATATGGAATGGGTAGTGG - Intergenic
1016666230 6:146644042-146644064 ATGGAGTATGGGATGGGGAGTGG + Intronic
1017278302 6:152595600-152595622 AGGCAGTTTGGAATAGCTAGTGG - Intronic
1017814819 6:158009171-158009193 AGGGAGTAGGGTATGAATAGTGG - Intronic
1018604737 6:165584878-165584900 AGGGAATATGGAATGAGTAATGG + Intronic
1020035389 7:4960230-4960252 AGGGAGTAGGAAGTGGATAGGGG + Intergenic
1023101407 7:36722021-36722043 AGGGGTGAGGGAATGGCTAGAGG - Intronic
1023454643 7:40324761-40324783 AGGTGGTATGCAATAGCTAGGGG + Intronic
1024158940 7:46654793-46654815 AGGGAATACAGAATGGATAGTGG - Intergenic
1025969070 7:66305299-66305321 AAGGAACATGGAATGGCTAGAGG - Intronic
1026634684 7:72071141-72071163 TGGGAGTAGGGGATGGGTAGCGG - Intronic
1028299001 7:89172956-89172978 AAGGAGTATAGTATGTCTAGTGG + Intronic
1030165254 7:106548201-106548223 AAAGAATATGGAATGGGTAGTGG - Intergenic
1030401998 7:109063370-109063392 AGGACGTATGGAATGGTTAGTGG + Intergenic
1030995606 7:116355230-116355252 AAGGAGTTTGGAATGGCTGTGGG + Intronic
1031310935 7:120196040-120196062 AGGGAGTATAGAGAGGCAAGGGG - Intergenic
1034814773 7:154162485-154162507 AGGGAATATGGAATGGATCCTGG - Intronic
1037383033 8:18308683-18308705 AGGCAGAATGGCAGGGCTAGGGG + Intergenic
1037680432 8:21092787-21092809 AGGGAGGGTGGAAGGGATAGAGG - Intergenic
1038848780 8:31254486-31254508 AGGGAGTGGGGAATGGGCAGGGG - Intergenic
1040726086 8:50383584-50383606 AAGGAATAAGGAATGGGTAGTGG - Intronic
1041274190 8:56141286-56141308 AGGGAATACAGAATGGGTAGCGG - Intergenic
1042313979 8:67406037-67406059 AGGGAGTATTGACTGGAAAGAGG + Intergenic
1042998850 8:74732744-74732766 AGGGAGGAGGGAATAGGTAGAGG + Intronic
1043140756 8:76586987-76587009 AAGGATTTTGGAATGTCTAGGGG - Intergenic
1043546746 8:81324058-81324080 AGGGTGACTAGAATGGCTAGGGG - Intergenic
1044535589 8:93353367-93353389 AAGGGATATGGAATGGCTACTGG + Intergenic
1045436066 8:102165984-102166006 AAGGAATATGGAATGGGCAGTGG - Intergenic
1045574854 8:103409623-103409645 AGGGATGCTGGTATGGCTAGTGG - Intronic
1047002559 8:120587405-120587427 AAGGAGTGGGGAATGGGTAGTGG - Intronic
1048896216 8:138994817-138994839 AGGGAATATAGAATGGGAAGTGG - Intergenic
1049045108 8:140143810-140143832 ATGGAATATGGAATGGCATGGGG - Intronic
1049242578 8:141545697-141545719 AGGGGGTATGGAAGGGGCAGGGG - Intergenic
1050780874 9:9333383-9333405 AGAGAGTATGGATTGTTTAGGGG + Intronic
1051708910 9:19909964-19909986 AGTGAATATGGAAGGGCCAGTGG - Intergenic
1055067583 9:72134089-72134111 AGGGAGTAGGGAAAGGGAAGGGG + Intronic
1055902763 9:81260096-81260118 AGGGAGTAGGGAAGGGGAAGTGG - Intergenic
1056667978 9:88597168-88597190 AGGGAGGAAGGAAAGGCTGGAGG - Intergenic
1060690952 9:125659733-125659755 AGGGAGTATGGGATAGAGAGAGG - Intronic
1060759731 9:126237111-126237133 GGGAAGAATGGAATGGCTGGAGG - Intergenic
1061133940 9:128722890-128722912 AGGGAGGAAGGAATGGACAGGGG + Intronic
1062743765 9:138197351-138197373 AGGGAGTAAGGAAAAGCAAGTGG - Intergenic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1187138294 X:16569668-16569690 AGGCAGTGTGGTAGGGCTAGGGG + Intergenic
1189963955 X:46352844-46352866 AGAGAATATGGAATAGGTAGTGG - Intergenic
1190721378 X:53151728-53151750 ACAGAATATGGAATGGGTAGTGG - Intergenic
1190765967 X:53475872-53475894 AGGGAGTATGGAATGGCTAGTGG + Intergenic
1192045623 X:67670742-67670764 AGGGAGTGGGGTAGGGCTAGGGG - Intronic
1192824749 X:74683308-74683330 AGGGAATATGGAATGGGTAATGG + Intergenic
1192896553 X:75448319-75448341 AGGGAGTACAGAATGGATGGTGG + Intronic
1194235606 X:91379868-91379890 AGGGAGTACAAAATGGGTAGTGG + Intergenic
1194369529 X:93055361-93055383 AGGTGGAATAGAATGGCTAGGGG + Intergenic
1194649687 X:96499974-96499996 AGGGAATACAGAATGGGTAGTGG + Intergenic
1195064398 X:101227014-101227036 ACGGAGTATCACATGGCTAGAGG + Intronic
1198327905 X:135592694-135592716 AGGGAGTATGAAATGGGTAGTGG - Intergenic
1198340053 X:135705135-135705157 AGGGAGTATGAAATGGGTAGTGG - Intergenic
1198343529 X:135737916-135737938 AGGGAGTATAAAATGGGTAGTGG - Intergenic
1199760495 X:150900468-150900490 AGGGCCTATGGAATGGCTCAGGG - Intergenic
1200677720 Y:6171573-6171595 AGGTGGAATAGAATGGCTAGGGG + Intergenic
1201193464 Y:11469499-11469521 AGGGAATACAGAATGGATAGTGG - Intergenic