ID: 1190768113

View in Genome Browser
Species Human (GRCh38)
Location X:53492409-53492431
Sequence AGGGGAAAGCTGCTGGTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 395}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190768106_1190768113 20 Left 1190768106 X:53492366-53492388 CCAGAGGCACTCTGCTACAAAAC 0: 1
1: 2
2: 3
3: 16
4: 122
Right 1190768113 X:53492409-53492431 AGGGGAAAGCTGCTGGTCACTGG 0: 1
1: 0
2: 2
3: 50
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190768113 Original CRISPR AGGGGAAAGCTGCTGGTCAC TGG Intergenic
900433604 1:2615327-2615349 AGAGGAAGGCCGCAGGTCACAGG - Intronic
900472507 1:2861762-2861784 AGGGCAGAGATGCTGGTCTCTGG - Intergenic
903219175 1:21859565-21859587 CGGGCAGAGCTGCTGGTCACTGG - Exonic
903282801 1:22259612-22259634 AGGGGACATCTGCTGGGCTCTGG - Intergenic
903928421 1:26848522-26848544 AGGGGAAAGCTACTGCTGCCTGG - Intronic
906564076 1:46784066-46784088 GGGGGAAAGCTGGCAGTCACAGG + Intronic
906578904 1:46917980-46918002 GGGGGAAAGCTGGTAGTCAGAGG + Intergenic
906912527 1:49970162-49970184 AGGGAAAAGCTTCTTGCCACTGG + Intronic
907324621 1:53628852-53628874 CGGGGAAGGCTCCTGGGCACAGG + Intronic
907531920 1:55107905-55107927 AGGTGACAGCTGCTGCCCACAGG + Intronic
908476331 1:64492404-64492426 AGGCCAGAGCTGCTGGTCAACGG - Intronic
908646743 1:66286678-66286700 ATGGGAAAACTTGTGGTCACAGG + Intronic
909406732 1:75298663-75298685 AGTGGAAAGATTCTGGTCACAGG + Intronic
909673561 1:78214422-78214444 AGGGGAAAGCCGGCAGTCACAGG - Intergenic
910029753 1:82704639-82704661 AGCGGAAAGCTGCATGTAACTGG - Intergenic
910051457 1:82978853-82978875 AGGTGACAGCTTCTGGGCACTGG - Intergenic
910234485 1:85021465-85021487 AAGAGAAAGCTGCTTGTCTCAGG - Intronic
910573625 1:88734276-88734298 AGGGGAAAGCTCCATGTCACTGG - Intronic
910739010 1:90494799-90494821 GGGGGAAAGCTGGTGGTCCCAGG + Intergenic
910772902 1:90847594-90847616 AGGGAAAACCTGCTGGGCCCTGG - Intergenic
910785101 1:90988945-90988967 AGGGGAAGGCTTCGGGACACTGG + Intronic
911562006 1:99417906-99417928 GGGGGAAAGCTGGCAGTCACAGG - Intergenic
911806202 1:102211248-102211270 GGGGGAAAGCTGGCAGTCACAGG + Intergenic
914455568 1:147833426-147833448 TGGGGAAAGCTGGCAGTCACAGG + Intergenic
914857781 1:151364937-151364959 AGGGTAAAACTGCTTGTCCCAGG + Exonic
915065464 1:153220894-153220916 AGGGGAAATCTGCTGATTACAGG + Intergenic
915821717 1:159031111-159031133 TGGGGAAAGCTGGTAGTTACAGG + Intronic
916713139 1:167429825-167429847 AGGGGAATTCTGCTACTCACTGG - Intergenic
917037740 1:170767787-170767809 AGGGGACAGCTACTGGCCTCTGG + Intergenic
918699835 1:187594451-187594473 ATGGGAAAACAGCTGTTCACTGG + Intergenic
919202023 1:194367296-194367318 TGGGGAATGCTGCTGGTAAAAGG - Intergenic
920799920 1:209176923-209176945 GGGGGAAAGCTGGCAGTCACAGG - Intergenic
920989741 1:210925590-210925612 AGGGGAAAGCTGGCAGTCACAGG - Intronic
924502196 1:244648171-244648193 AGAGGAGAACTGCTGGTCTCTGG - Intergenic
1063266785 10:4459924-4459946 TGTGGATAGCTGATGGTCACAGG + Intergenic
1065045320 10:21742853-21742875 ATGGGAAGGCTGCAGGTGACGGG - Exonic
1066289370 10:33999750-33999772 ATTGGGAAGCTGCTGATCACCGG + Intergenic
1068712061 10:60146348-60146370 ATGGGAAAACTGCATGTCACAGG + Intronic
1069150533 10:64954015-64954037 TGGGGAAAGCTGGCAGTCACAGG + Intergenic
1069702633 10:70437892-70437914 TGGGGAAAGCTGCTAGTCAGGGG - Intronic
1070250093 10:74766011-74766033 AGGGGAGAGCAGGAGGTCACAGG + Intergenic
1070509542 10:77147778-77147800 AGGGGACAGATGGTGGTCCCTGG + Intronic
1070589554 10:77792043-77792065 AGGGGACAGGGGCTGGGCACCGG + Exonic
1073181878 10:101588328-101588350 AGGGGAAAGATGGCGGTGACGGG + Exonic
1073489222 10:103841638-103841660 AGGGGAGAGCAGCAGGTCATGGG - Intronic
1073900485 10:108215198-108215220 GGGGGAAAGCTGGCAGTCACAGG + Intergenic
1074753242 10:116606792-116606814 AGGTGACAGCTGATGGGCACAGG - Intronic
1075116463 10:119631055-119631077 AGGAGTGAGCTCCTGGTCACTGG - Intergenic
1075271347 10:121054458-121054480 AAGGCAAAGCTCCTGGCCACTGG + Intergenic
1075660647 10:124193360-124193382 CGGGGAAAGCTGGCAGTCACAGG + Intergenic
1075830008 10:125400541-125400563 GGGAGAGAGCTGCTGGCCACTGG - Intergenic
1076227468 10:128791863-128791885 AGGGAAAAGCGACTGGTCAATGG + Intergenic
1076585321 10:131543095-131543117 AGGGGAAAGCTCATGGACATGGG + Intergenic
1076778593 10:132711489-132711511 AGGGCAGAACTGCTGGTCTCAGG - Intronic
1077404128 11:2375236-2375258 AGGGGAAAGGGGCTGGACACAGG - Intergenic
1077854768 11:6112709-6112731 GGGGGGAAGCTGCTGGCCACTGG + Intergenic
1078125250 11:8555267-8555289 AATGGAAAGCTGCTGGTCAAAGG + Intronic
1078844957 11:15112401-15112423 AAGGGAAAGAAGCTGTTCACAGG + Intergenic
1079364985 11:19801288-19801310 AGGGGCAATCTGCTGCCCACAGG - Intronic
1079856651 11:25612850-25612872 AGGGGAAAGCTGGCAGCCACAGG + Intergenic
1080848440 11:36046695-36046717 TGGTGGTAGCTGCTGGTCACTGG - Intronic
1081821232 11:45997541-45997563 AGGAGAAATCTGATTGTCACTGG - Intronic
1082815258 11:57503759-57503781 TGGGGGCAACTGCTGGTCACCGG - Intronic
1083048592 11:59757136-59757158 ATGGGGAAACTGCTGCTCACGGG + Intronic
1083898300 11:65631300-65631322 AGGGGTAAGCTGAGGGACACAGG - Intronic
1084578521 11:70007073-70007095 AGGGGGAAGTTGCTGTTCAATGG - Intergenic
1084644334 11:70445892-70445914 AGGGGAAAGCTGGTGGGAGCAGG + Intergenic
1084690017 11:70719656-70719678 AGGGGGCTGCTGCTGCTCACTGG + Intronic
1084857426 11:71997974-71997996 AGGGGAATGGGGCTGGTCAGAGG + Intergenic
1084914689 11:72419761-72419783 AGGGGAAATCTGGCTGTCACAGG + Intronic
1086825445 11:91489970-91489992 GGGGGAAAGCTGACAGTCACAGG + Intergenic
1087817585 11:102676330-102676352 GGGGGAAAGCTGGCAGTCACAGG + Intergenic
1088137739 11:106578080-106578102 GGGGGAAAGCTGGCAGTCACAGG + Intergenic
1088206391 11:107397378-107397400 GGGGGAAAGCTGGCAGTCACAGG - Intronic
1088360011 11:108979713-108979735 AAGGTAAAGCTGCTTATCACAGG + Intergenic
1088864227 11:113831747-113831769 AGGGGAAAGCTGAAGGCGACAGG + Intronic
1089107368 11:116023999-116024021 GGGGGAAAGCTGGCAGTCACAGG - Intergenic
1089146708 11:116334759-116334781 GGTAGACAGCTGCTGGTCACTGG + Intergenic
1089633780 11:119799399-119799421 AGGGAAATGGTGCTGGGCACTGG - Intergenic
1089836931 11:121379037-121379059 AGGGGAAAGCTGGCAGTCACAGG - Intergenic
1090895042 11:130964489-130964511 ACGGGAAAGCTGGTAGTCACAGG + Intergenic
1091375543 12:22628-22650 AGGGGGAAGGTGCTGGGCAGTGG + Intergenic
1091814682 12:3428443-3428465 TGGGGCCAGCTGCGGGTCACTGG + Intronic
1092864579 12:12749018-12749040 AGTAGAAATCTCCTGGTCACAGG - Intronic
1093010505 12:14101875-14101897 GGGGGAAAGCTGGCAGTCACAGG - Intergenic
1093803743 12:23406994-23407016 AGGGGAAAGCTCCTTGATACTGG + Intergenic
1094355837 12:29576329-29576351 AGGGGAAAGCTCCTTGACATTGG - Intronic
1095665161 12:44788874-44788896 GGGGGAAAGCTGGCAGTCACAGG - Intronic
1096956335 12:55529864-55529886 AGGGGAAAGCTGGCAGTAACAGG - Intergenic
1097295467 12:57958096-57958118 AGGGGAAAGCCGGCAGTCACAGG - Intergenic
1100189064 12:92171218-92171240 AGGGGAAGGCTGCGGGTGACGGG - Intergenic
1100906964 12:99312563-99312585 ATAGGAAAGCTGCTTGGCACAGG - Intronic
1101290358 12:103361718-103361740 GGGGGAAAGCTGGCAGTCACAGG - Intronic
1101397177 12:104358579-104358601 AGTGGAAGCCTGCTGTTCACAGG - Intergenic
1102075447 12:110056382-110056404 AAGGCAAAGCTGCTGGTGCCTGG + Intronic
1102634925 12:114314664-114314686 ATGGGAGAGCTGATGTTCACTGG + Intergenic
1102916763 12:116760126-116760148 GGGGGAAAGCTGGCAGTCACAGG + Intronic
1103761131 12:123251114-123251136 GGGGGAAAGCTGGCAGTCACAGG + Intronic
1104504526 12:129318901-129318923 GGGGGAAAGCTGGCAGTCACAGG + Intronic
1104949924 12:132435081-132435103 ATGGGGAAGCTGCTGGTCGGTGG + Intergenic
1105314428 13:19244180-19244202 TGGGGAAAGCTGTCAGTCACAGG - Intergenic
1106232276 13:27830019-27830041 AGCGAAAGGCTGCTGGCCACGGG + Intergenic
1107001263 13:35547982-35548004 CTGAGAAAACTGCTGGTCACTGG + Intronic
1107181297 13:37462977-37462999 AGGGGAAAGCTTCAAGACACTGG - Intergenic
1107803493 13:44132277-44132299 AGGGGAAAGCTGGTTCTTACCGG + Intergenic
1108831642 13:54486902-54486924 GGGGGAAAGCTGGCAGTCACAGG - Intergenic
1109401164 13:61830438-61830460 AGGGGAAAGTTACAGGTAACTGG + Intergenic
1110181774 13:72626007-72626029 CGGGGAAAGCTGGCAGTCACAGG - Intergenic
1112738063 13:102443348-102443370 AGGGGAAAGCTGGCAGTCACAGG - Intergenic
1113130521 13:107031550-107031572 CTGGGAAAGCTGCTGGTAGCTGG - Intergenic
1113329930 13:109317820-109317842 GGGGGAAAGCTGGAAGTCACAGG - Intergenic
1113693193 13:112326513-112326535 AGGGCAAAGCTGCTGCTCCCAGG - Intergenic
1113961410 13:114128364-114128386 AGGTGGAGGCCGCTGGTCACAGG - Intronic
1115393250 14:32877506-32877528 GGGGGAAAGCTGGCAGTCACAGG + Intergenic
1115835511 14:37397750-37397772 TGGGGAAAGCTGGCAGTCACAGG + Intronic
1115969790 14:38932491-38932513 AGGGGAAAGCCGGCAGTCACAGG - Intergenic
1115996896 14:39204069-39204091 GGGGGAAAGCTGGCAGTCACAGG - Intergenic
1117253510 14:53956471-53956493 GGGGGGAAGAAGCTGGTCACAGG - Intronic
1118452523 14:65917030-65917052 AGGGTGAGGCCGCTGGTCACAGG + Intergenic
1118482432 14:66180666-66180688 AGGAGAAAGGTCCTGGTCAAGGG - Intergenic
1119772972 14:77232815-77232837 AGGGGAAAGCTGGTTGCCCCTGG - Intronic
1120450939 14:84666014-84666036 AGGGGAAAGCTGGCAGCCACAGG + Intergenic
1120702087 14:87709146-87709168 TGGGGAAAGATGGAGGTCACTGG + Intergenic
1121107466 14:91290488-91290510 TGGGGAGAGCTGCTGCTCTCTGG + Intronic
1121415829 14:93778867-93778889 AGGGGGCAGCTGCTGGGGACTGG - Intronic
1121431978 14:93894105-93894127 AGGGGAAAGGGGCTGGTCTCTGG - Intergenic
1121432001 14:93894177-93894199 AGGGGAAAGGGGCTGGTCTCTGG - Intergenic
1122633870 14:103121352-103121374 ATGGGACAGCCGCTGGCCACTGG + Intergenic
1124863361 15:33464869-33464891 AGTGGGAAGATGCTGGTCAAAGG - Intronic
1125055954 15:35359161-35359183 GGGGGAAAGCTGGCAGTCACAGG + Intronic
1125351026 15:38767694-38767716 AGGGGAAAGCTGGAGGACACTGG + Intergenic
1125710293 15:41779769-41779791 GGGGCATAGCTGCTGGCCACAGG - Intronic
1126443779 15:48719648-48719670 AGGTCAAAGCTACTGTTCACAGG - Intronic
1126924789 15:53572300-53572322 GGGGGAAAGCTGCATGTTACTGG - Intronic
1127259754 15:57319404-57319426 AGGGGAAAGCTCCTGGAGTCTGG + Intergenic
1127525270 15:59786606-59786628 GGGGGAAAGCTGGGAGTCACAGG + Intergenic
1129242668 15:74260785-74260807 ACGGCAAAGGGGCTGGTCACAGG + Intronic
1129673551 15:77620439-77620461 AGGGACAGGCTGCTGGCCACCGG + Intronic
1130221568 15:82023958-82023980 AGGGGATAGCAGAGGGTCACAGG + Intergenic
1130422659 15:83763888-83763910 GGGGGCAAGCTGTTGGTCTCTGG - Intronic
1132716257 16:1291571-1291593 ACCGGGAAGCTGCTGATCACCGG + Intergenic
1133942520 16:10322230-10322252 AGGGGCCAGCTGCTGTGCACAGG - Intergenic
1135883256 16:26279722-26279744 GGGGGAAAGCTGGCAGTCACAGG + Intergenic
1136687743 16:32005053-32005075 TGGGGAAAGTTGATGGTCCCTGG + Intergenic
1136788348 16:32948604-32948626 TGGGGAAAGTTGATGGTCCCTGG + Intergenic
1136881467 16:33905327-33905349 TGGGGAAAGTTGATGGTCCCTGG - Intergenic
1136909150 16:34132600-34132622 AGGGGAAAGGTGGTGGTAATGGG + Intergenic
1138054139 16:53814701-53814723 AGTGGAGAGCTGGAGGTCACAGG - Intronic
1138192032 16:55021662-55021684 AGGGGAAAGCCGGCAGTCACAGG - Intergenic
1138245298 16:55462828-55462850 AGGGGAGAGCTTCTGGACAGGGG + Intronic
1138704211 16:58897622-58897644 AGGGGAAAGCTTCTTGACATTGG - Intergenic
1139516773 16:67457041-67457063 AGGGGAAAGGTGCTTGGCAGTGG - Intronic
1140792487 16:78405445-78405467 AAGGAATAGCTGATGGTCACTGG + Intronic
1141448761 16:84082231-84082253 AGAGGAAGCCTGCTGGTCACAGG + Intronic
1203090547 16_KI270728v1_random:1210119-1210141 TGGGGAAAGTTGATGGTCCCTGG + Intergenic
1142500095 17:327475-327497 AAGGGCAAGCTGCCGGTCATTGG + Exonic
1143018521 17:3904407-3904429 AGGCAAAAGCTGCTGGTCCCAGG + Intronic
1143427884 17:6854341-6854363 AGGGGAAAGCCGGCAGTCACAGG - Intergenic
1146583371 17:34059706-34059728 AGGGGAAAGCCGGCAGTCACAGG - Intronic
1147148730 17:38500724-38500746 TGGGGAAAGTTGATGGTCCCTGG + Intronic
1147994361 17:44353021-44353043 AGGGAAAAGCACCTGGCCACAGG - Exonic
1148859121 17:50594950-50594972 AGGGGAGGGCTGCTGGTCACAGG - Intronic
1152038286 17:77886918-77886940 GGGAGGAAGCTGCAGGTCACAGG - Intergenic
1152330390 17:79669319-79669341 AGGGAAAAGCTTCTGGCCACTGG + Intergenic
1154267345 18:12890757-12890779 TGGGGGAGGCTGCTGGTCACTGG - Intronic
1156001129 18:32385445-32385467 AGGGGACAGCTGCTGGGCCTAGG - Intronic
1156352776 18:36315398-36315420 AGGGGAAAGACTTTGGTCACAGG - Intronic
1156766625 18:40664173-40664195 AGTTGAAAGCTGCTGATCAGTGG + Intergenic
1158331535 18:56368144-56368166 AGGGGAAAGCTAGCAGTCACAGG + Intergenic
1159919066 18:74211652-74211674 AGGGGAAAGGGGCTGGAAACAGG + Intergenic
1160725945 19:617899-617921 AGGGCCAGGATGCTGGTCACTGG - Intronic
1160935594 19:1592999-1593021 CGGGCACAGCTGCTGGGCACTGG - Intergenic
1161482676 19:4518620-4518642 AGGGGAAAGGTGCTGGGCCTGGG - Intergenic
1161586379 19:5107996-5108018 AGGACAAAGCTGCTGGTGCCAGG - Intronic
1163267970 19:16233079-16233101 AGGGGAGGGCTGCTGGGGACAGG - Intronic
1163733103 19:18961620-18961642 AGGGGAAAGCTGAGGTTCAGAGG + Intergenic
1164052205 19:21593027-21593049 AGAGGAGAGCTGCAAGTCACTGG + Intergenic
1164251708 19:23483019-23483041 GGGGGAAAGCTGGCAGTCACAGG - Intergenic
1164287988 19:23839384-23839406 GGGGGAAAGCTGGCAGTCACAGG + Intergenic
1165040281 19:33063978-33064000 AGGGGAGAGCTGCTGGTGGGAGG - Intronic
1165053098 19:33155698-33155720 AGGGAAAAGCAGCTGGTGTCAGG - Intronic
1166604278 19:44126818-44126840 AGGGGAAAGCTGGCAGTCATAGG + Intronic
1167069339 19:47211011-47211033 AGGGGAAAGCTGCCAGCCCCAGG + Intergenic
1167264471 19:48476903-48476925 ATGGGAAAGTTACTGCTCACAGG - Intronic
1167735657 19:51293199-51293221 AGGGGCCACCTGCTGGTCCCTGG - Intergenic
925139669 2:1541236-1541258 AGTGGGGAGGTGCTGGTCACAGG + Intronic
925907710 2:8549112-8549134 AGAGGAAAGCTGAAAGTCACAGG - Intergenic
926416846 2:12657751-12657773 ATGGGAAAACTGCCAGTCACTGG + Intergenic
926435351 2:12831991-12832013 AGGGAAAGGCAGCTTGTCACTGG - Intergenic
926916024 2:17893196-17893218 GGGGGAAAGCTGGCAGTCACTGG + Intronic
927803731 2:26125949-26125971 AGGGAAAAGCTTCAGGACACTGG - Intronic
928120415 2:28580037-28580059 AGGGCAAGGCTGCTGGAGACTGG - Intronic
928733721 2:34261602-34261624 TGGGGAAAGCTGGCAGTCACAGG - Intergenic
928772557 2:34719749-34719771 AGGGGAAAGCTGGCAGTCACAGG + Intergenic
929333590 2:40713091-40713113 AGAGGAAATCTCCTGGTCTCTGG + Intergenic
931525241 2:63145534-63145556 AGGGGAAAGCCGGCAGTCACTGG + Intronic
932481504 2:72042195-72042217 AGAGGAGAGGTGCTGGCCACTGG + Intergenic
933433485 2:82214806-82214828 CGGGGAAAGCTGGCAGTCACAGG + Intergenic
933447058 2:82394379-82394401 GGGGGCAAGCTCCAGGTCACTGG - Intergenic
935105363 2:100038568-100038590 AGGGGACAGAGGCTGGGCACGGG + Intronic
936229311 2:110686023-110686045 TTGGGAAAGCTGTTGGTCTCTGG - Intergenic
937057835 2:118954281-118954303 GGGGGAAAGCTGGCAGTCACAGG - Intronic
937069278 2:119050424-119050446 GGGGGAAAGCTGAAAGTCACAGG + Intergenic
937242609 2:120472025-120472047 AGAGGAAAGCAGGAGGTCACAGG + Intergenic
937337583 2:121071351-121071373 CGGGGAAAGCAGCTTGTCCCTGG + Intergenic
937981709 2:127619712-127619734 AGGGGAAAGATGCTGGCCTCTGG + Intronic
938038102 2:128053302-128053324 TGGGGAAAGCTGGCAGTCACAGG + Intergenic
938707519 2:133945289-133945311 CGGGGTAACCTGCTAGTCACTGG - Intergenic
938996361 2:136683136-136683158 GGGGGAAAGCTGGCAGTCACAGG - Intergenic
939822625 2:146976444-146976466 TGGGGAAAGCTGCTGGCCACTGG + Intergenic
940367716 2:152866998-152867020 GGGGCGAAGCTGCTGTTCACAGG + Intergenic
940618703 2:156083909-156083931 GGGGGAAAGCTGGCAGTCACAGG + Intergenic
940785001 2:157971772-157971794 GGGGGAAAGCTGTCAGTCACAGG + Intronic
941631644 2:167891229-167891251 AGGGGAAAGCCGGCAGTCACAGG + Intergenic
942190830 2:173468502-173468524 AGGGGAGAGCTGTTGGTCAGAGG - Intergenic
945482599 2:210360948-210360970 GGGGGAAAGCCGATGGTCACAGG + Intergenic
945802425 2:214450050-214450072 AGGGGCAAGATGCAGGGCACTGG + Intronic
945825621 2:214717052-214717074 GGGGGAAAGCTGGCAGTCACAGG - Intergenic
946147768 2:217743788-217743810 AGTGGAAAGCTGCAGATCACAGG + Intronic
947457100 2:230265244-230265266 GGGGGAAAGCTGGCAGTCACAGG + Intronic
948119498 2:235518528-235518550 GGGCGGAAGCTGCAGGTCACTGG + Intronic
948136879 2:235643045-235643067 AGGGGGAAGGAGCTGGTCCCTGG - Intronic
948788010 2:240363093-240363115 AGGTGAAAGCTGAGGGTCTCAGG + Intergenic
1168963617 20:1885682-1885704 AGGTTGAAGCTGCTGGTCCCTGG - Intergenic
1169263916 20:4156283-4156305 TGTGGAAAGATGCTGCTCACTGG + Intronic
1169687419 20:8290746-8290768 AGGGGCAAGCGGCTGGGAACTGG - Intronic
1170086237 20:12535467-12535489 AGGGAAAAGCTGGCAGTCACAGG - Intergenic
1170863179 20:20127968-20127990 TGGGGAAAGCTGGCAGTCACAGG + Intronic
1170988558 20:21280980-21281002 AGTGCAAAGCTGTTGGCCACAGG - Intergenic
1172857124 20:38013813-38013835 AGGGGAAGGCTGCTGCACAATGG - Exonic
1174961073 20:55157788-55157810 AGGGAAGAGCTGCTGGTGGCAGG + Intergenic
1175124534 20:56741415-56741437 ATGGGAAAGCTCCTGGTTCCAGG + Intergenic
1175543981 20:59766234-59766256 AGGAGGAAGCTCCTGGCCACGGG + Intronic
1175661044 20:60812773-60812795 AGGGGAAATGTGCAGCTCACTGG + Intergenic
1175853221 20:62104801-62104823 AGGGGAAAGCTGAAGTTCCCAGG + Intergenic
1175930735 20:62492690-62492712 AGGAGGGAGCTGCTGATCACAGG + Intergenic
1177140497 21:17352969-17352991 AGGGGAAAGCTGGCAGTCACAGG - Intergenic
1177195606 21:17900969-17900991 CGGGGAAAGCTGGCAGTCACAGG + Intergenic
1177615977 21:23520475-23520497 AGGGGAAAGCTCCAGGACATTGG - Intergenic
1180624959 22:17188275-17188297 ATGGGAGAGCTCCTGGCCACAGG - Intronic
1181454315 22:23047694-23047716 GGGGGAAAGCTGGAAGTCACAGG - Intergenic
1181581146 22:23828809-23828831 TGGGGCAAGCTGCTGGCCACAGG + Intronic
1181676236 22:24455301-24455323 AGGACAAAGCTGCTGGTTAATGG - Intergenic
1181987456 22:26810439-26810461 AGGGGAAAGCTGGCTGTCTCAGG - Intergenic
1182350086 22:29694517-29694539 AGGGGAAGGCTGGTGGGCAGAGG - Intronic
1183204310 22:36408082-36408104 AGGGGAGAGGAGATGGTCACTGG - Intergenic
1183622627 22:38983425-38983447 AGGAGAAAGCTGTTGGGGACTGG - Intronic
1183629037 22:39022173-39022195 AGGAGAAAGCTGTTGGGGACTGG - Intronic
951750103 3:26025448-26025470 GGGGGAAAGCTGGCAGTCACAGG + Intergenic
952082849 3:29781850-29781872 GGGGGAAAGCCGGTAGTCACAGG - Intronic
952732456 3:36653229-36653251 TGGAGAAAGCTGGTAGTCACAGG - Intergenic
953251678 3:41249757-41249779 AGGGGAAAGAGGCAGGACACTGG + Intronic
953436033 3:42878113-42878135 AGGGGAGAACAGCTGGTCAGTGG - Intronic
953912831 3:46901487-46901509 AGGGGTGGGCTGCTGGCCACAGG + Intronic
954002993 3:47572441-47572463 TTGGGAAAGCTGCTGGACAGTGG + Intronic
954988420 3:54816487-54816509 AGTTGAAAACTGCTGGTCAAAGG + Intronic
955241215 3:57180011-57180033 CAGGGGAAGCTGCTGGCCACGGG - Intergenic
956118488 3:65942122-65942144 GTGGTAAAGCTCCTGGTCACAGG - Intronic
957016414 3:75069580-75069602 AGGGGAAAGCTGGCAGTCACAGG + Intergenic
958787441 3:98613160-98613182 GGGGGAAAGCTAGTGGTTACAGG + Intergenic
959125934 3:102290500-102290522 GGGGGAAAGCTGGCAGTCACAGG + Intronic
959344361 3:105174166-105174188 AAGTGGAAGCTGCTGGCCACTGG + Intergenic
960064334 3:113354508-113354530 TGGGGAAAGCTGGTAGTCATAGG - Intronic
961786455 3:129349990-129350012 AGGGGAAAGCTGGTGGTGCCGGG - Intergenic
962066047 3:131981470-131981492 GGGGGAAAGCTGGCAGTCACAGG + Intronic
962341924 3:134593098-134593120 AGTGGAGAGCTCCTGGTCCCTGG + Intergenic
963832446 3:150022857-150022879 GGGGGAAAGCTGGCAGTCACAGG - Intronic
964098892 3:152964959-152964981 AGGGGAAGGGTGCTGCTGACTGG + Intergenic
964160622 3:153640948-153640970 AGAGGAAAGCTGGCAGTCACAGG - Intergenic
964188975 3:153980291-153980313 AGGGGAAAGCCGGCAGTCACAGG - Intergenic
965874402 3:173299565-173299587 AGGGGAAAGCTGGAAGTCACAGG + Intergenic
966148307 3:176837441-176837463 AGGGGAAAGCTTCTTGACATTGG + Intergenic
968633858 4:1667668-1667690 AAGGGAAAGCTGTGGGTCTCGGG - Intronic
968646965 4:1746024-1746046 AGCTGAGAGATGCTGGTCACTGG + Intergenic
969064358 4:4466630-4466652 ATGGGAATGGTGCTGCTCACAGG + Intronic
969315867 4:6381040-6381062 ACGGGAGAGCTGCTGGCCACAGG - Exonic
969470028 4:7382174-7382196 AGGGCAAAGCTGATGGTGCCTGG + Intronic
972048795 4:34702493-34702515 GGGGGAAAGCTGGCAGTCACAGG - Intergenic
972371112 4:38424319-38424341 CAGGGAAAGCTGCTGGGGACAGG + Intergenic
972764305 4:42137431-42137453 AGGGGAATGCTCCTGGACACTGG + Intronic
973070842 4:45856435-45856457 AGGGGAAAGCTGACAGTTACAGG + Intergenic
974204431 4:58682176-58682198 ATTGGGAAGCTGCTGATCACCGG + Intergenic
975718382 4:77227381-77227403 GGGGGAAAGCTGGTAGTGACAGG + Intronic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
975961115 4:79906607-79906629 AGGGGGAATCTACTAGTCACAGG + Intronic
976056634 4:81076996-81077018 AGGGGAAAACTGATGGGGACTGG - Intergenic
977292882 4:95182252-95182274 AAGGCAAAGCTGATGGCCACAGG + Intronic
977777510 4:100938835-100938857 GGGGGAAAGCTGTCAGTCACAGG - Intergenic
979637847 4:122977876-122977898 AGGGGGTAGCTGCTGTCCACAGG + Intronic
980761450 4:137239028-137239050 GGGGGAAAGCTGGCAGTCACAGG + Intergenic
981565198 4:146093882-146093904 TGGAGGAAGCTGCTGGCCACTGG + Intergenic
981773736 4:148340547-148340569 AGGGAAATGCTTCTGGACACTGG + Intronic
982074981 4:151730137-151730159 AGGGGAAAGCTGGCAGTCACAGG - Intronic
982867312 4:160531000-160531022 AGGACAAAGCTGCTGTTCACAGG + Intergenic
983433660 4:167683544-167683566 AGGGAGAGGCTGCTGGCCACTGG - Intergenic
983905219 4:173174590-173174612 AGGGGCAAGCAGGTGGTAACAGG - Intronic
984527574 4:180875535-180875557 GGGGGAAAGCTGACAGTCACAGG + Intergenic
984690600 4:182721092-182721114 AGGTGGCAGCTGCTGGGCACGGG - Intronic
985008651 4:185560038-185560060 GGGGGAAAGCTGGCAGTCACAGG + Intergenic
985298644 4:188462902-188462924 AGGGGAAAGCTTCATGTCACTGG + Intergenic
985355731 4:189116871-189116893 GGGGGAAAGCTGCCAGTGACAGG - Intergenic
985416692 4:189742410-189742432 GGGGGAAAGCTGCCAGTGACAGG - Intergenic
985658173 5:1142777-1142799 GGGGGGCAGCTGATGGTCACGGG - Intergenic
986258979 5:6126125-6126147 GGGGGAAAGCTGGCAGTCACAGG - Intergenic
986445780 5:7819997-7820019 AGGGGTCAGCCGCTGGACACTGG - Intronic
986633945 5:9801607-9801629 AGGGGGAAGCTGGTGGTCTGGGG + Intergenic
987440628 5:17951804-17951826 AGGGGAAAGCTGGCAGTTACAGG + Intergenic
987640111 5:20601682-20601704 AGGGGAAAGCCGGCAGTCACAGG - Intergenic
988692401 5:33585771-33585793 AGAGAAAAGGGGCTGGTCACAGG + Intronic
989345996 5:40430108-40430130 AGGTGAAAGATGATGGTAACAGG - Intergenic
989384343 5:40839406-40839428 AAGGGAAGGGTGCTGGTCAAAGG + Intergenic
989431575 5:41361179-41361201 GGGGGAAAGCTGGCAGTCACAGG + Intronic
989617357 5:43350159-43350181 AGGGGAGTGCTGCTGGCCTCTGG + Intergenic
990572760 5:57095299-57095321 TGGGGAAAGCTGGCAGTCACAGG - Intergenic
990712855 5:58604583-58604605 AGGGGAAAGCCGGTAGTCACAGG + Intronic
993920529 5:93795229-93795251 GGGGGAAAGCTGGCAGTCACAGG + Intronic
994296140 5:98090624-98090646 AGGGGAGAGATGCTGGTCAAAGG - Intergenic
994875286 5:105413861-105413883 AGGGGAAAGCCGGCAGTCACAGG - Intergenic
995248496 5:109962531-109962553 AAGGGAAAGGTTATGGTCACGGG + Intergenic
995817786 5:116191504-116191526 GGGGGAAAGCTGGCAGTCACAGG - Intronic
996020172 5:118582437-118582459 AGGTGAAAGCAGAAGGTCACTGG + Intergenic
996871771 5:128200436-128200458 GGGGGAAGGCTGCTGGTGACAGG + Intergenic
997798360 5:136834213-136834235 TGGGGAAAGCTGGCAGTCACAGG + Intergenic
1000157118 5:158562956-158562978 GAGGGAAAGCCGCTGGTAACTGG + Intergenic
1000757928 5:165184242-165184264 TGGGGAAAACTGGTAGTCACAGG + Intergenic
1001281451 5:170389173-170389195 AGGGGAAAGCAGCCTGCCACGGG - Intronic
1003029453 6:2589350-2589372 GGGGGAAAGCTGGCAGTCACAGG + Intergenic
1003711938 6:8602474-8602496 AGGGGAAAGCTGGCAGTCACTGG + Intergenic
1004401596 6:15293896-15293918 AGGAGGGACCTGCTGGTCACAGG + Intronic
1004821869 6:19376028-19376050 AGGGAAAACCTGCTGGTGGCAGG + Intergenic
1005236479 6:23767879-23767901 AGGGGAGAGCTACTGGACACAGG - Intergenic
1005493974 6:26372868-26372890 AGGGGAGAGCTGTAGGTCATGGG - Intronic
1005503211 6:26448219-26448241 AGGGGAGAGCTGTGGGTCATGGG - Intronic
1007303932 6:40890056-40890078 TGGGGGAAGCTGCTGCTCAGTGG - Intergenic
1008121479 6:47622122-47622144 AGGGGAAAGCTGGCAGTCACAGG + Intronic
1008439420 6:51515701-51515723 AGGGGAACACAGCTGGTCAAGGG + Intergenic
1008572957 6:52832594-52832616 TGGGAAGAGCTGCTGGGCACTGG + Intronic
1008755269 6:54787656-54787678 AGGGAAAAGATGCTGGTCAAAGG + Intergenic
1009384148 6:63068750-63068772 AGGGGAAAGCTGGCAATCACAGG + Intergenic
1014304843 6:119727598-119727620 AGGGGAAAGCTGGCAGTCACAGG + Intergenic
1014482060 6:121951098-121951120 AGGGGAAAGCCGGCAGTCACAGG + Intergenic
1015666984 6:135642427-135642449 AGGGTAGAGGTGCTGATCACTGG + Intergenic
1016112379 6:140241498-140241520 AGGGGAAAGCTGTTTGCCATTGG - Intergenic
1016736922 6:147489254-147489276 AGAGGCAACCTGCTGTTCACGGG - Intergenic
1016896206 6:149055739-149055761 AGGGGAAGGCTGGTGGTTAATGG + Intronic
1018555108 6:165041154-165041176 AAGGGAAAGTTCCTGGACACTGG - Intergenic
1019739648 7:2666224-2666246 TGGGCAAAGCTGCTGGTGGCAGG - Intergenic
1020358584 7:7303560-7303582 GGGGGAAAGCTGGCAGTCACAGG + Intergenic
1020634883 7:10684907-10684929 CGGGGAAAGCTGGCAGTCACAGG - Intergenic
1021991075 7:26142267-26142289 ATTGGGAAGCTGCTGATCACCGG + Intergenic
1022894876 7:34740182-34740204 TGGGGAAAGCTGGCAGTCACAGG + Intronic
1023159509 7:37283799-37283821 AGAGGAAAGCAGCTGGCCGCTGG - Intronic
1023897422 7:44445485-44445507 AGGGGCAAGCACCTGGTCAGAGG - Intronic
1024751349 7:52469023-52469045 AGCAGAAAGCTGGTGGTCATGGG + Intergenic
1024831796 7:53468581-53468603 AGGGGAAAGCCGCTTATCATTGG - Intergenic
1024917917 7:54524725-54524747 GGGGGAAAGCTGGCAGTCACAGG + Intergenic
1025008186 7:55371611-55371633 GGGGAAAAGCTCCTGGACACCGG - Intronic
1027295356 7:76764107-76764129 GGGGGAAAGCTGGCAGTCACAGG - Intergenic
1028105600 7:86874319-86874341 ACGGGAAAGCTCCTTGACACTGG + Intergenic
1030483688 7:110138411-110138433 ATGGGGAAACTGCTGGTCAATGG - Intergenic
1031090443 7:117348020-117348042 GGGGGAAAGCTGGTAGTGACAGG + Intergenic
1031261346 7:119525015-119525037 AGGGGAAAGTTGGCAGTCACAGG - Intergenic
1031281757 7:119811735-119811757 ATGGGGAAACAGCTGGTCACTGG + Intergenic
1031655486 7:124349647-124349669 GCGGGAAAGCTGCCAGTCACAGG + Intergenic
1032222573 7:130005884-130005906 AGGGGAAAGCAGCTGGAGATTGG - Intergenic
1032330723 7:130976507-130976529 AGGGGAAAGCTTCCTGACACTGG + Intergenic
1032398507 7:131607806-131607828 AGAGGAAAGCTGCTGGGTGCAGG - Intergenic
1032784470 7:135189373-135189395 AACGGGAACCTGCTGGTCACAGG - Exonic
1033060027 7:138097223-138097245 AGGGGAGAGCTGATGGTGTCTGG - Intronic
1033570833 7:142626905-142626927 AGGTGAAAGCCGCCGGTCAGAGG + Intergenic
1034679842 7:152920326-152920348 GAGGCAAAACTGCTGGTCACAGG + Intergenic
1034944061 7:155250656-155250678 AGGGGAGAGCAGCTGGTGACAGG - Intergenic
1035458020 7:159022285-159022307 AGCGGAGACCTGCTGGGCACTGG + Intergenic
1035912493 8:3583064-3583086 AGGTCAAAGCTGCTGTCCACAGG - Intronic
1037710709 8:21353305-21353327 ATGGGAAAGTTGCTGGAGACAGG - Intergenic
1038021851 8:23557678-23557700 ATGGGAGAGCTGCTGGCCAGGGG + Intronic
1038478019 8:27882449-27882471 CAGGCAAGGCTGCTGGTCACCGG - Intronic
1039571808 8:38592917-38592939 GGGGGAAAGCTGGCAGTCACAGG - Intergenic
1040635696 8:49270569-49270591 GGGGGAAAGCTGGCAGTCACAGG + Intergenic
1041293773 8:56333553-56333575 GGGGGAAAGCTGGCAGTCACAGG + Intergenic
1041570570 8:59333200-59333222 GGGGGAAAGCTGGCAGTCACAGG + Intergenic
1041637075 8:60156396-60156418 GGGGGAAAGCTGGCAGTCACAGG - Intergenic
1042042162 8:64604140-64604162 ATTGTAAAGCTGCTGCTCACGGG - Intronic
1043160416 8:76840092-76840114 AGGGGAAAGCTGTTTATTACAGG - Intronic
1044227590 8:89736883-89736905 GGGGGAAAGCTGGCAGTCACAGG - Intergenic
1044711289 8:95060908-95060930 AGGTGTTAGGTGCTGGTCACTGG + Intronic
1044907232 8:97017621-97017643 AGGGGAAAGCCGGCAGTCACAGG - Intronic
1044947922 8:97408184-97408206 TGGGGAAAGCTGGCAGTCACAGG + Intergenic
1045889910 8:107143378-107143400 ACAGGAATGCTGCTGGTCTCAGG - Intergenic
1046064953 8:109185416-109185438 AGAGTAGATCTGCTGGTCACGGG - Intergenic
1047890455 8:129303023-129303045 GGGGGAAAGCTGGCAGTCACAGG + Intergenic
1049392471 8:142379337-142379359 AGTGCAGAGCTGCTGCTCACTGG - Intronic
1052146953 9:25061470-25061492 AGGGGAAATCTCCTGGTCTGTGG + Intergenic
1052218317 9:25992570-25992592 AGGGGAAAGCTGGAAGCCACAGG - Intergenic
1052247588 9:26355338-26355360 AATGGAAAGATGTTGGTCACAGG + Intergenic
1052264407 9:26554640-26554662 ATGGGAAAGATGTTGGTGACTGG - Intergenic
1052537119 9:29761498-29761520 GGGGGAAAGCTGGCAGTCACAGG - Intergenic
1052550174 9:29938073-29938095 GGGGGAAAGCTGGCAGTCACAGG + Intergenic
1053413537 9:37931173-37931195 GGGGAAAAGCTCCTGGACACTGG + Intronic
1055245956 9:74242726-74242748 GGGGAAAAGCTTCTGGACACTGG - Intergenic
1055912040 9:81364122-81364144 GGGGGAAAGCTGGCAGTCACAGG - Intergenic
1056948046 9:91017556-91017578 AGGGGAAAGCTGGCAGCCACAGG - Intergenic
1057211892 9:93204989-93205011 AGGGGACAGCTTCAGGTCAGGGG + Intronic
1057230126 9:93316990-93317012 AAGGCAAGGCTGCTGGCCACGGG - Intronic
1057556938 9:96095495-96095517 AGGAGAGAGATGATGGTCACTGG - Intergenic
1058085056 9:100739847-100739869 AGGGGAAAGCCAGTAGTCACAGG + Intergenic
1058233576 9:102461592-102461614 GGGGGAAAGCTGGCAGTCACAGG - Intergenic
1061307308 9:129739595-129739617 AGGCATCAGCTGCTGGTCACAGG + Exonic
1061948835 9:133924636-133924658 AGGGAAGAGCTGGTGGTGACTGG - Intronic
1186709013 X:12173395-12173417 AGGGAAAAGCTGGTGATCCCTGG - Intronic
1187633388 X:21200234-21200256 AGGGGAAAGCTTCATGTCATTGG + Intergenic
1187752228 X:22479011-22479033 GGGGGAAAGCTGGCAGTCACAGG + Intergenic
1188045923 X:25426222-25426244 GGGGGAAAGCTGGCAGTCACAGG + Intergenic
1189879206 X:45471490-45471512 GGGGGAAAGCTGGCAGTCACAGG + Intergenic
1190443756 X:50502347-50502369 AGGAGAAAGTGGCTGGTCAATGG + Intergenic
1190768113 X:53492409-53492431 AGGGGAAAGCTGCTGGTCACTGG + Intergenic
1191080628 X:56505981-56506003 GGGGGAAAGCTGGCAGTCACAGG - Intergenic
1191148804 X:57198350-57198372 AGGGGAAAGCTGGATGTTACAGG + Intergenic
1191805148 X:65127799-65127821 AGGGGAAAGCTGGCAGTCACAGG + Intergenic
1192483364 X:71504102-71504124 ATGCTAAAGCTGCTGTTCACAGG - Intronic
1192771587 X:74197594-74197616 AGGGAAAAGCTCCTTGACACTGG - Intergenic
1192950858 X:76014701-76014723 CGGGGAAAGCTGTCCGTCACAGG - Intergenic
1192979066 X:76319228-76319250 GGGGGAAAGCCGGTAGTCACAGG + Intergenic
1192981960 X:76353746-76353768 AGGGGAAAGCTGGCAGTCACAGG - Intergenic
1193423775 X:81316249-81316271 GGGGGAAAGCTGTCAGTCACAGG + Intergenic
1193870248 X:86788262-86788284 ACTGGGAAGCTGCTGATCACCGG + Intronic
1193936879 X:87634133-87634155 AGGTGGATGCTGCTGGTCCCAGG - Intronic
1194237182 X:91399145-91399167 GGGGGAAAGCCGGTAGTCACAGG - Intergenic
1194926938 X:99836630-99836652 GGGGGAAAGCCAGTGGTCACAGG + Intergenic
1195231992 X:102859522-102859544 AGGAGAAAGCTGACAGTCACAGG + Intergenic
1196675766 X:118418962-118418984 GGGGGAAAGCTGGCAGTCACAGG + Intronic
1196766607 X:119251563-119251585 AGGTGAAAGGTGCTGCCCACAGG + Intergenic
1197132382 X:123020030-123020052 TGGGGAAAGCTGGCAGTCACAGG - Intergenic
1197476325 X:126929720-126929742 GGGGGAAAGCCGGTAGTCACAGG + Intergenic
1198022838 X:132676032-132676054 ATGGGAAAGGTGATGGCCACAGG - Intronic
1198508200 X:137322469-137322491 AGTGGAGAGATGCTGGTCAAAGG + Intergenic
1199521532 X:148741415-148741437 GGGGGAAAGCTGGCAGTCACAGG + Intronic
1199586811 X:149423539-149423561 AGGGGAAAGCTGGCAGTGACAGG - Intergenic
1199767196 X:150949908-150949930 ATGGGAAAACTGCTGGAAACAGG - Intergenic
1199844430 X:151680500-151680522 AGGGGAGATCTGGTGGTCAAGGG + Intergenic
1200256789 X:154586573-154586595 CAGGGAAAGCTGCTGGAGACAGG - Exonic
1200260980 X:154617830-154617852 CAGGGAAAGCTGCTGGAGACAGG + Exonic
1200267022 X:154652198-154652220 CAGGGAAAGCTGCTGGAGACAGG + Exonic
1200332658 X:155313901-155313923 AGGGGAAAGCTGGCAGTCACAGG - Intronic
1200463691 Y:3489900-3489922 AGGGGGAAGCTCCTAGTCAGTGG + Intergenic
1201315784 Y:12644081-12644103 GGGGGAAAGCTGGTAGTCACAGG - Intergenic
1202161598 Y:21940747-21940769 GGGGTAAGCCTGCTGGTCACAGG - Intergenic
1202229758 Y:22645626-22645648 GGGGTAAGCCTGCTGGTCACAGG + Intergenic