ID: 1190769985

View in Genome Browser
Species Human (GRCh38)
Location X:53506143-53506165
Sequence CTACCTTGCCTGGCAAGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 221}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190769985_1190769987 4 Left 1190769985 X:53506143-53506165 CCTATTCTTGCCAGGCAAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 221
Right 1190769987 X:53506170-53506192 CACCTGTAATCCCAGCATTTTGG 0: 3865
1: 80658
2: 217963
3: 284981
4: 250431
1190769985_1190769988 5 Left 1190769985 X:53506143-53506165 CCTATTCTTGCCAGGCAAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 221
Right 1190769988 X:53506171-53506193 ACCTGTAATCCCAGCATTTTGGG 0: 3931
1: 88811
2: 317136
3: 261500
4: 233797
1190769985_1190769996 18 Left 1190769985 X:53506143-53506165 CCTATTCTTGCCAGGCAAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 221
Right 1190769996 X:53506184-53506206 GCATTTTGGGGGGCCGAGGCAGG 0: 27
1: 3802
2: 99154
3: 236045
4: 243297
1190769985_1190769997 21 Left 1190769985 X:53506143-53506165 CCTATTCTTGCCAGGCAAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 221
Right 1190769997 X:53506187-53506209 TTTTGGGGGGCCGAGGCAGGTGG 0: 11
1: 1558
2: 35223
3: 129093
4: 175376
1190769985_1190769994 14 Left 1190769985 X:53506143-53506165 CCTATTCTTGCCAGGCAAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 221
Right 1190769994 X:53506180-53506202 CCCAGCATTTTGGGGGGCCGAGG 0: 41
1: 5355
2: 133046
3: 275940
4: 217974
1190769985_1190769990 6 Left 1190769985 X:53506143-53506165 CCTATTCTTGCCAGGCAAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 221
Right 1190769990 X:53506172-53506194 CCTGTAATCCCAGCATTTTGGGG 0: 198
1: 4328
2: 5683
3: 5728
4: 8382
1190769985_1190769991 7 Left 1190769985 X:53506143-53506165 CCTATTCTTGCCAGGCAAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 221
Right 1190769991 X:53506173-53506195 CTGTAATCCCAGCATTTTGGGGG 0: 225
1: 4403
2: 6925
3: 6991
4: 9554
1190769985_1190769992 8 Left 1190769985 X:53506143-53506165 CCTATTCTTGCCAGGCAAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 221
Right 1190769992 X:53506174-53506196 TGTAATCCCAGCATTTTGGGGGG 0: 13476
1: 310447
2: 266634
3: 201224
4: 222235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190769985 Original CRISPR CTACCTTGCCTGGCAAGAAT AGG (reversed) Intergenic
900347950 1:2219879-2219901 CCACCTCGCCTGGCCAGATTTGG - Intergenic
901312340 1:8279014-8279036 CCTCCTTGCCTGCCAAGAACTGG + Intergenic
901551606 1:9999257-9999279 CCACCGAGCCTGGCAAGAGTGGG - Intronic
901882993 1:12204885-12204907 CCACCTTGCCTGGCCAGACCAGG - Intronic
902152310 1:14453240-14453262 CCACCGTGCCTGGCCAAAATAGG + Intergenic
902895358 1:19476033-19476055 CCACCATGCCTGGCCAAAATTGG - Intronic
903809012 1:26024266-26024288 CTAGCTGGGCAGGCAAGAATGGG + Intronic
904112249 1:28135255-28135277 CCACCGTGCCTGGCCAGAAAAGG - Intergenic
904361361 1:29974678-29974700 CTCCCTTGCCCAGCAAGACTGGG + Intergenic
906151365 1:43589567-43589589 CCACCGTGCCTGGCCAGAATCGG - Intronic
906260546 1:44385370-44385392 CCACTGTGCCTGGCAAGAAGAGG - Intergenic
907195488 1:52683216-52683238 CCACCATGCCTGGCCAAAATGGG - Intergenic
907382288 1:54101252-54101274 CTCCCTTCCCTTGCAATAATGGG - Intronic
911456612 1:98132235-98132257 CTCACATGCATGGCAAGAATGGG + Intergenic
918655931 1:187026779-187026801 GTACCTTGCCTGAAAAGTATAGG + Intergenic
919201060 1:194356119-194356141 CCACCATGCCTGGCAATAATTGG + Intergenic
921533597 1:216316443-216316465 CTACCTGGCCTTGAAAGACTCGG - Intronic
922773606 1:228204504-228204526 CTACTGTGCCTGGCCAGAAATGG - Intronic
923734026 1:236583772-236583794 CTACCGTGCCTGGCCAAAATAGG + Intronic
1064525053 10:16246432-16246454 CAACCGTGCCTGGCCAAAATAGG + Intergenic
1064751647 10:18536547-18536569 CTGCCATGCCTGGCCAGAACTGG + Intronic
1064885996 10:20113282-20113304 CTAGCTTGCTTGCCAAGATTGGG + Intronic
1065359683 10:24877906-24877928 CCACTGTGCCTGGCCAGAATAGG + Intronic
1066361578 10:34736962-34736984 CCACCATGCCTGGCCAAAATAGG + Intronic
1070366436 10:75741700-75741722 CAACCTGGCCTGGAAAGAAGAGG + Intronic
1070471159 10:76781117-76781139 CTACATTGCCTTGCAAGATCTGG + Intergenic
1070678772 10:78434306-78434328 CTTCCTTCCCTGGCAGGACTGGG + Intergenic
1072487483 10:95869535-95869557 CCACCATGCCTGGCCAGAAGTGG + Exonic
1073033503 10:100547025-100547047 TCACCGTGCCCGGCAAGAATTGG + Intronic
1073329148 10:102659602-102659624 CCACCGCGCCTGGCAGGAATGGG - Intergenic
1074059939 10:109955879-109955901 ATACATTCCCTGGCAATAATTGG - Intergenic
1075994808 10:126868750-126868772 CCACCTCGCCCGGCAAGGATAGG - Intergenic
1081616738 11:44595780-44595802 CTACCATGTCTGGCCAGAAGGGG - Intronic
1084378032 11:68791822-68791844 CCACCGCGCCTGGCCAGAATGGG + Intronic
1085013472 11:73157493-73157515 CTCCTTTGCCTTGCAAGGATTGG + Intergenic
1085212394 11:74792686-74792708 CCACCATGCCTGGCAAGAGTAGG + Intronic
1085232767 11:74987524-74987546 CCACCGCGCCTGGCAATAATGGG - Intergenic
1085419532 11:76343609-76343631 CTACCTTTCCTGGAAATAATGGG - Intergenic
1087003942 11:93450333-93450355 CTCCCTTGCCTGCCAAGGAAAGG + Intergenic
1088146100 11:106680838-106680860 TTACCTTGCAGGGCAATAATAGG + Intronic
1089481018 11:118805122-118805144 CCACCGTGCCTGGCCAGAACTGG + Intergenic
1090754628 11:129779085-129779107 CGATCTTGCCTGGGAAGCATGGG + Intergenic
1092780168 12:11978860-11978882 CTACATTTCCTGCCAAGCATGGG + Intergenic
1093508060 12:19892457-19892479 CTTCCCTGCCAGGCAATAATTGG + Intergenic
1094608807 12:31973458-31973480 CTACCTTGTCTGGCTACACTTGG + Intronic
1096479712 12:51930979-51931001 CCACCGTGCCTGGCCAGAAGAGG - Intergenic
1097037388 12:56132831-56132853 CCACCGTGCCTGGCCAGCATGGG - Intronic
1097470685 12:59987092-59987114 CTACCTTTCTTGGGAAGATTTGG + Intergenic
1097704194 12:62850882-62850904 CTCCCCTGCCAGGTAAGAATGGG + Intronic
1099961079 12:89397489-89397511 CCACCGTGCCTGGCCAGAAGAGG + Intergenic
1100508549 12:95244943-95244965 CCACCTTGCCTGGCCAAAAGTGG - Intronic
1100595346 12:96066817-96066839 CTACTTTGCCTGAAAAAAATGGG - Intergenic
1103025526 12:117570968-117570990 CCACCGTGCCTGGCTGGAATAGG - Intronic
1103547205 12:121710783-121710805 CCACCATGCCTGGCCAGAAAGGG + Intergenic
1107963444 13:45578763-45578785 CCACCGTGCCTGGCCAGATTTGG - Intronic
1110527047 13:76550436-76550458 CCACCGTGCCTGGCCAGTATAGG - Intergenic
1110779757 13:79451282-79451304 ATACCTTCCCTGGAACGAATAGG - Intergenic
1111762542 13:92483838-92483860 CCACAGTGCCTGGCAAGACTAGG - Intronic
1113382580 13:109817416-109817438 CTACTTTGCTTGGTAAGAGTCGG - Intergenic
1113818289 13:113191145-113191167 CTACCATGCCTGGCTAGTTTTGG + Intronic
1114060127 14:19010461-19010483 CGGCCTTGCCTGGCATGCATAGG - Intergenic
1114060422 14:19012232-19012254 CGGCCTTGCCTGGCATGCATAGG - Intergenic
1114101832 14:19387746-19387768 CGGCCTTGCCTGGCATGCATAGG + Intergenic
1114101931 14:19388374-19388396 CGGCCTTGCCTGGCATGCATAGG + Intergenic
1114102420 14:19391310-19391332 CGGCCTTGCCTGGCATGCATAGG + Intergenic
1115766185 14:36625718-36625740 CATCCTTGCCTGGCAACAATTGG - Intergenic
1116201921 14:41808295-41808317 CTTCCTTGTCTGGCCACAATTGG - Intronic
1116201964 14:41808483-41808505 CTTCCTTGTCTGGCCACAATTGG - Intronic
1116429540 14:44830015-44830037 CTAAAATGCCTGGCAAAAATAGG - Intergenic
1117718063 14:58600918-58600940 CTGGATTGCCTGGCAAGAACTGG + Intergenic
1118928785 14:70220290-70220312 CTACCTCACCTGGCCAGATTTGG - Intergenic
1120998994 14:90437793-90437815 CTGCCTTGTCTGGGAAGAAGAGG + Intergenic
1121033764 14:90682348-90682370 CCACCTTGCCTGCCACAAATAGG - Intronic
1126908104 15:53389272-53389294 CGGCCTGGCCTGGCAAGGATGGG + Intergenic
1128888182 15:71307482-71307504 CCACCGTGCCTGGCCTGAATGGG - Intronic
1128947576 15:71839695-71839717 CTACTGTGCCTGGCCTGAATCGG + Intronic
1129788742 15:78326605-78326627 CCACCATGCCTGGCCTGAATTGG - Intergenic
1131956688 15:97743379-97743401 CTACCTTTCGTGTCCAGAATTGG - Intergenic
1133983728 16:10652347-10652369 CTACCTGGCCTGGAGAGAGTGGG - Intronic
1134607864 16:15585195-15585217 CTACCTTGCCTTTCATGAAAGGG - Intronic
1135196777 16:20401547-20401569 ATCCCTTGCCTGGCAGGAAAGGG + Intronic
1136235039 16:28908542-28908564 CTGCCCTGCCTGGGAAGAAGGGG + Intronic
1136521297 16:30797868-30797890 CCACCTTGCCTGGCCAGTAATGG - Intergenic
1137764652 16:50968560-50968582 CCACCGTGCCTGGCCTGAATGGG - Intergenic
1145075847 17:19854009-19854031 CCACTGTGCCTGGCCAGAATTGG - Intronic
1146075404 17:29724239-29724261 CCACCCTGCCCGGCTAGAATAGG - Intronic
1147766301 17:42838603-42838625 CCACCATGCCTGGCCAGACTAGG + Intronic
1148737064 17:49870894-49870916 CTCCCTTTGCTGGCAAGAAGGGG + Intergenic
1154064603 18:11095306-11095328 CTTCCTGGCATGGCAAGAAAGGG - Intronic
1155230371 18:23767858-23767880 CCACCGTGCCTGGCAAGGAAAGG + Intronic
1155456144 18:26016433-26016455 CCACCGTGCCTGGCCAGAATAGG - Exonic
1155613076 18:27690791-27690813 CCACCATGCCTGGCCAGAAATGG + Intergenic
1156160636 18:34354164-34354186 CTAGCTTGCAGAGCAAGAATGGG - Intergenic
1156242120 18:35264857-35264879 CCACCGTGCCTGGCAAAAATGGG - Intronic
1156474338 18:37396043-37396065 TTACCTAGACAGGCAAGAATGGG - Intronic
1157535619 18:48455407-48455429 CTGCCTGGCCTGGGAAGCATCGG + Intergenic
1158580428 18:58676240-58676262 CTACCACGCCTGGCCACAATAGG - Intronic
1161192107 19:2963514-2963536 CCACCGTGCCTGGCCAGAGTGGG - Intergenic
1164874417 19:31673232-31673254 CTACCTGGCCTTCCAAGGATTGG + Intergenic
1165583862 19:36895140-36895162 CTTCCATGCCAGGAAAGAATGGG + Intronic
1165761472 19:38323879-38323901 CCACCTTGCCTGGCCAGGAAGGG + Intronic
1166586967 19:43957923-43957945 CAACCTTGCCTGGATAGAACAGG - Intronic
1166971327 19:46570290-46570312 CCACCATGCCTGGCCACAATGGG + Intronic
1167032879 19:46975155-46975177 CCACCATGCCTGGCCAGAAGGGG + Intronic
1167326190 19:48827328-48827350 CCACCGTGCCTGGCAAGGACAGG + Intronic
1168663681 19:58186262-58186284 CTACCGTGCCTGGCAGGGACAGG - Intronic
930832900 2:55764181-55764203 ATACCTTGCCTGGCCAAAAGTGG - Intergenic
931025574 2:58110582-58110604 TTACCTTGTTTGCCAAGAATGGG + Intronic
931264769 2:60650844-60650866 CTACATTGCCTGGCATGAACAGG + Intergenic
932655858 2:73610679-73610701 TTACCTTGCCCAGCAAGAAAGGG - Intronic
934568626 2:95354298-95354320 CAACACTGCCTGGCAAGCATCGG + Intronic
934684969 2:96314340-96314362 CCACCATGCCTGGCCTGAATGGG + Intergenic
935359354 2:102234504-102234526 CCACCTTGCCTGGCCAAAAATGG - Intronic
936156459 2:110050349-110050371 TTTCCTTGCCTGGCAAGCAGCGG + Intergenic
936167792 2:110138830-110138852 CTGCTTTGCCTGGCAGGCATTGG + Intronic
936188231 2:110321095-110321117 TTTCCTTGCCTGGCAAGCAGCGG - Intergenic
936979265 2:118249356-118249378 GTTCCTTGGTTGGCAAGAATGGG - Intergenic
937125036 2:119469395-119469417 CTACCTTACAAGGCAAGAACGGG - Intronic
937364450 2:121250890-121250912 CCACCATGCCTGGCCAGTATTGG + Intronic
937402735 2:121599200-121599222 CTACCTTCCCTGTTAAGAAAAGG + Intronic
937579447 2:123465898-123465920 CTACATTCCCTGGAAACAATTGG + Intergenic
944874133 2:203944262-203944284 CTGTGGTGCCTGGCAAGAATGGG + Intronic
945577136 2:211545730-211545752 GTACTTTCCCTGGCAAGAACTGG - Intronic
947180668 2:227408526-227408548 CCACCGTGCCTAGCAAAAATAGG - Intergenic
948193685 2:236079230-236079252 CCACCGTGCCTGGCCAGCATGGG - Intronic
1168957056 20:1841632-1841654 CAGCCTTGCCTGGCAGGAGTAGG + Intergenic
1171818393 20:29809710-29809732 CCACCGTACCTGGCAAGACTGGG + Intergenic
1172130251 20:32650494-32650516 GCAACTTGCCTGGCAAGGATGGG + Intergenic
1172357072 20:34287677-34287699 CCACCGTGCCTGGCCAGAAGGGG + Intronic
1173493388 20:43501416-43501438 CCATCGTGCCTGGCAAGACTGGG - Intergenic
1174508027 20:51029511-51029533 CTTTCCTGCCTGGCAAAAATTGG + Intergenic
1176082393 20:63280443-63280465 CCACCATGCCTGGCCAGAAAGGG + Intronic
1177856716 21:26407857-26407879 CAACCATGCCTGGCCAAAATAGG - Intergenic
1178011182 21:28289017-28289039 CCACCGTGCCTGGCCAGGATAGG + Intergenic
1178901084 21:36599268-36599290 CTACCATGAGTAGCAAGAATTGG - Intergenic
1179222258 21:39418785-39418807 CCACCATGCCTGGCCAGAAATGG + Intronic
1180478608 22:15733073-15733095 CGGCCTTGCCTGGCATGCATAGG - Intergenic
1180478903 22:15734844-15734866 CGGCCTTGCCTGGCATGCATAGG - Intergenic
1180621242 22:17163746-17163768 CTACCTTTCCTGAAAAGAACTGG - Intronic
1182018125 22:27058154-27058176 CCACCTTGCATGGCAAGCAAAGG + Intergenic
1182888547 22:33797049-33797071 CCACCATGCCTGGCCAGACTTGG + Intronic
1184849201 22:47110190-47110212 CCACCGTGCCTGGCCAGAAAAGG - Intronic
949509498 3:4755753-4755775 CTACCCTGCCAGGCAAGGGTGGG - Intronic
949540745 3:5030333-5030355 CTATCTTGCCTGGCCAAAGTGGG + Intergenic
950056956 3:10032591-10032613 CCACCTTGCCTGGCCAGAAATGG + Intronic
950933076 3:16810662-16810684 CTGCCATGCCTGGCAGGAAAGGG - Intronic
951868075 3:27329581-27329603 CTACCTTCCCAGGAAAGAACTGG - Intronic
953552204 3:43912305-43912327 CTGCCTTCCTTGGCAGGAATGGG + Intergenic
954804684 3:53210583-53210605 CCACCATGCCCGGCCAGAATGGG - Intergenic
955327225 3:58018485-58018507 CCACCTTGCCTGGCTAGTTTTGG + Intronic
958963925 3:100537208-100537230 CCACCATGCCTGGCCAGAATAGG + Intronic
959085164 3:101844978-101845000 CCACCGTGCCCGGCCAGAATTGG - Intronic
960119051 3:113927812-113927834 CCACCTTGCCAGACAAGACTTGG - Intronic
962160745 3:132997602-132997624 CTGGTTTTCCTGGCAAGAATAGG + Intergenic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
962779550 3:138699357-138699379 CCACCTTGCCTGGCCTGACTTGG - Intronic
965067539 3:163870837-163870859 GTAGCTTGTCTAGCAAGAATTGG - Intergenic
965579205 3:170249133-170249155 CTACCGCGCCCGGCCAGAATTGG + Intronic
967931332 3:194692662-194692684 CCACCATGCCTGGCAAGGCTGGG + Intergenic
968309520 3:197671959-197671981 CTGCCTTGACTGTCAAGAAATGG - Intronic
968817800 4:2830777-2830799 CTGCCTTGCCTGGCAGGCAAAGG + Intronic
970214724 4:13746620-13746642 CTCCCTTCCCGGGCAAGAAAAGG + Intergenic
971080050 4:23199585-23199607 CTGCCTTGCATGGCATGAATTGG + Intergenic
973323897 4:48837576-48837598 CCACTGTGCCTGGCCAGAATGGG + Intronic
978353353 4:107844033-107844055 CCACCGTGCCTGGCAAAAAGAGG - Intronic
978649319 4:110981308-110981330 CTAGCTTGGCTGGAAAGAAGAGG - Intergenic
982664610 4:158245990-158246012 CCACCATGCCTGGCTAGAAGGGG - Intronic
982764176 4:159324313-159324335 CCACCATGCCTGGCACCAATAGG + Intronic
983630081 4:169841265-169841287 CTGCCTTGCCAGCCAAGAAACGG + Intergenic
987120190 5:14760082-14760104 CTACCCTGCCTGGAAGGACTAGG - Intronic
987721230 5:21634918-21634940 CTACCTGCCCTTGTAAGAATAGG - Intergenic
990221897 5:53600664-53600686 CTACCTTAACTGTCCAGAATTGG + Intronic
990332906 5:54745160-54745182 CCACCATGCCTGGCCAGACTAGG + Intergenic
997313807 5:132915049-132915071 CCACCGTGCCTGGCCAGAAATGG - Intronic
999015863 5:148104606-148104628 CCACCGTGCCTGGCCAGAAATGG - Intronic
999640241 5:153665116-153665138 CTACCTGGCCTGGGAATAGTTGG - Intronic
1002515079 5:179751722-179751744 CTACTGTGCCTGGCCATAATCGG - Intronic
1002803932 6:553202-553224 CAACCGTGCCTGGCCAGAAAGGG + Intronic
1003244246 6:4370765-4370787 CCACCGTGCCTGGCCAGAAGAGG + Intergenic
1004083933 6:12425515-12425537 CTGCATTGCCTGGCAAGACCAGG + Intergenic
1004265867 6:14148151-14148173 TTACATTTCCTGGCAAGAAGTGG + Intergenic
1004660047 6:17702218-17702240 CTACCTCGCCCGGCCAGAAATGG - Intronic
1005393630 6:25359192-25359214 CTTCCTTTCCTGGCCAGAATGGG - Intronic
1008545583 6:52580331-52580353 CCACTGTGCCTGGCAAGAAATGG + Intergenic
1009790525 6:68395656-68395678 CTCCATTGCCTGGCAAAAATAGG + Intergenic
1009887539 6:69641561-69641583 CCACCGTTCCTGGCCAGAATGGG - Intergenic
1011987658 6:93470153-93470175 TTACTTTGCTTGGCAAGACTGGG - Intergenic
1012722274 6:102759657-102759679 CCACCTTGCCTGGCTAGTTTTGG + Intergenic
1013332912 6:109123779-109123801 CCACCATGCCTGGCCAGAAGTGG - Intronic
1015013814 6:128385308-128385330 CTTCCTTGCCTTGTAAGATTAGG + Intronic
1015540494 6:134308842-134308864 CTACCGTGCCCGGCAAGCCTAGG + Intronic
1016549542 6:145262309-145262331 CTATCTCTCCTGTCAAGAATGGG - Intergenic
1020222343 7:6249340-6249362 ATTCCTTGCCTGGGGAGAATTGG - Intronic
1020918774 7:14234035-14234057 CCCCCTTGCCTGGCAAGTACAGG + Intronic
1020954711 7:14726418-14726440 CCACCGTGCCCGGCCAGAATCGG + Intronic
1025188498 7:56879236-56879258 CCACCATGCCTGGCCAGAAAAGG + Intergenic
1025683431 7:63697684-63697706 CCACCATGCCTGGCCAGAAAAGG - Intergenic
1025790481 7:64683024-64683046 CTGCCTTGGCTGGCGAAAATTGG - Intronic
1026248895 7:68649282-68649304 CCACCGTGCCAGGCAACAATGGG + Intergenic
1026677112 7:72437240-72437262 CTACCTTGCCAGGAAATCATGGG + Intronic
1027112262 7:75449652-75449674 CTACCATGCCCGGCAACAGTAGG + Intronic
1027284495 7:76634194-76634216 CTACCATGCCCGGCAACAGTAGG + Intergenic
1030118696 7:106084693-106084715 CCAGCGTGCCTGGCCAGAATTGG - Intergenic
1030228547 7:107180138-107180160 CAACCTTGACTGGCTAGAAAGGG + Intronic
1030687857 7:112505036-112505058 TTACCCTGCCTGGCAAGTCTTGG + Intergenic
1033588359 7:142790921-142790943 CAACCCTGCCTGGCCAGGATTGG - Intergenic
1034336706 7:150328563-150328585 CTCCCTTGCTGGGCTAGAATGGG - Intronic
1034572473 7:151968006-151968028 CCACCATGCCTGGCAAAACTAGG - Intronic
1034620928 7:152456534-152456556 CCACCTCGCCTGGCCGGAATGGG - Intergenic
1035168317 7:157004340-157004362 CTTCCTTGGCTGGCCAGGATCGG - Intronic
1036837867 8:12090174-12090196 CTGCCGTGCCAGGCAGGAATGGG + Intergenic
1037257034 8:16966599-16966621 CTACCTTCCTTTGCAAGAAAGGG + Intergenic
1039368988 8:36965630-36965652 CTACCTGGCCTGGCACATATGGG + Intergenic
1040513815 8:48118253-48118275 CTACCATGCCTGGCCAGCACTGG + Intergenic
1042222526 8:66487401-66487423 CTACCGTGCCTGGCCACAGTGGG - Intronic
1042386353 8:68179604-68179626 CTTCTTTGCCTGGCAAGTGTTGG - Intronic
1043613287 8:82092569-82092591 CCACCATGCCTGGCCTGAATGGG - Intergenic
1045046269 8:98282019-98282041 TTACCTTGCCTGGCAGAAAGAGG - Intronic
1045361542 8:101437898-101437920 CTACTTTGGGTGGCATGAATAGG - Intergenic
1045546836 8:103137138-103137160 GTAGCTTGACTGGCATGAATTGG - Intronic
1045939778 8:107726348-107726370 CCACCGTGCCCGGCAAGAGTTGG - Intergenic
1050192201 9:3038319-3038341 CTACCTTATCTGGGAAGCATAGG + Intergenic
1051692274 9:19728031-19728053 CTTCCTTACCTGGCAAGCAGTGG - Intronic
1052352248 9:27469796-27469818 CTACCACGCCTGGCACGAAAAGG - Intronic
1054781780 9:69172858-69172880 CCACCGTGCCTGGCCAGATTTGG + Intronic
1054902497 9:70383804-70383826 CAACAGTGCCTGGCATGAATAGG + Intergenic
1054928236 9:70609858-70609880 CCACCGTGGCTGGAAAGAATTGG + Intronic
1056236747 9:84601984-84602006 CTTCCTTGCCTGAAAAGAAAAGG - Intergenic
1056805636 9:89726673-89726695 CCACCACGCCTGGCAAGAATAGG + Intergenic
1057995207 9:99816728-99816750 CCACCATGCCTGGCTGGAATAGG - Intergenic
1058657722 9:107239317-107239339 CTACCTTGTCTGCTATGAATGGG - Intergenic
1061875431 9:133541170-133541192 CTCCGTTGGCTTGCAAGAATGGG + Intronic
1186647943 X:11527324-11527346 CCACTGTGCCTGGCAACAATTGG - Intronic
1186896746 X:14011367-14011389 CTACCTTTCCTGGAAAGCCTGGG - Intronic
1187163084 X:16782181-16782203 CCACCGTGCCTGGCCAGAAATGG + Intergenic
1190769985 X:53506143-53506165 CTACCTTGCCTGGCAAGAATAGG - Intergenic
1199182991 X:144879698-144879720 CTCCCTTAACTGGGAAGAATTGG + Intergenic