ID: 1190773428

View in Genome Browser
Species Human (GRCh38)
Location X:53533819-53533841
Sequence TGCTAGACACAGTGGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 205}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190773428 Original CRISPR TGCTAGACACAGTGGGGGCT GGG (reversed) Intronic
903694315 1:25196018-25196040 TCCTAGGGACAGTGGGGGCAGGG + Intergenic
904348681 1:29890924-29890946 TGGTTGACACAGTCAGGGCTGGG + Intergenic
904493908 1:30876421-30876443 AGCCAGACAAAGTGGGGGCGAGG - Intronic
905140343 1:35838663-35838685 TGATAGACAAAGTGCTGGCTGGG + Intronic
906296762 1:44653496-44653518 TGCCAGAGACAGTGGGGGGCAGG - Exonic
907515972 1:54993666-54993688 TGGGAGCCACAGTGGGGGGTGGG - Intergenic
907529656 1:55081959-55081981 TGCTAGTGACAATGGGGCCTTGG + Intronic
908034350 1:60035805-60035827 TGCTAGACACAGAGTTGGCCAGG + Intronic
908091115 1:60686361-60686383 TCCTAGATACAATGGGGGCATGG - Intergenic
909340315 1:74524320-74524342 TGCCAGAAACAGAGGGGGCTTGG + Intronic
910719718 1:90272671-90272693 TGCTAGACACTGGGGGGAGTAGG + Intergenic
910888417 1:91991090-91991112 TTAGAAACACAGTGGGGGCTGGG - Intronic
912472993 1:109918486-109918508 GGCTAGACACATTGGCGGCTTGG + Intronic
914912894 1:151801363-151801385 TCCAGGAGACAGTGGGGGCTGGG + Exonic
915323480 1:155068924-155068946 AGCAAGAGACAGAGGGGGCTGGG - Intronic
915589476 1:156862457-156862479 TGCTGGACCCACTTGGGGCTTGG - Intronic
915664865 1:157435144-157435166 AGCTTGACACAGTGAGGGATGGG - Intergenic
915885351 1:159715844-159715866 TGCAAGCTACAGTGGGGGCTGGG - Intergenic
918568160 1:185954900-185954922 TGCTTGAATCAGTGGGTGCTTGG + Intronic
919854067 1:201693910-201693932 TTTTAGACACCTTGGGGGCTGGG + Intronic
920054647 1:203183309-203183331 TGCTGGACACAGTGCATGCTGGG + Intronic
922642210 1:227245584-227245606 TGCAAGACAATGTCGGGGCTGGG - Intronic
924931094 1:248733074-248733096 TTTTAGCCACAGTGGGGACTTGG - Intronic
1063339910 10:5253319-5253341 GGAGAGACACAGTGGGGACTGGG + Intergenic
1063343829 10:5293331-5293353 GGAGAGACACAGTGGGGACTGGG - Intergenic
1063556628 10:7086416-7086438 TGCTAGGCACGGTGGGTGCTAGG + Intergenic
1064117462 10:12591137-12591159 TGTTAGACACAGAGGGGTCAGGG + Intronic
1066478251 10:35769430-35769452 TGGTAGAAACAGTGGGCCCTTGG + Intergenic
1068400222 10:56518647-56518669 TCCTAGACACAATGGGGGTATGG + Intergenic
1070807605 10:79279549-79279571 TCCTAGACAGGGTGGCGGCTGGG + Intronic
1072028570 10:91492186-91492208 TGCCAGACACTGTGTGAGCTAGG - Intronic
1075650617 10:124126383-124126405 GGCAAGACACAATGGGTGCTGGG - Intergenic
1075834746 10:125444000-125444022 TGCTAGACACACTGGGTGACTGG + Intergenic
1076525935 10:131112400-131112422 TGGGAGGCACAGTGGGGGCCTGG - Intronic
1076584053 10:131533332-131533354 TGAGAGACACAGAGGAGGCTCGG + Intergenic
1076729222 10:132429912-132429934 TGAGAGGCACAGTGGGGGCAGGG - Intergenic
1077407505 11:2389194-2389216 TGCTAGACAGGGTGGGGGCTGGG - Intronic
1077979470 11:7285727-7285749 TGCTAGATACAATGGGGTCCAGG + Intronic
1078013078 11:7588753-7588775 TGATAGACACAAAGGTGGCTTGG + Intronic
1078446835 11:11410946-11410968 TGTTAGAGACAGTGGGGTCCTGG + Intronic
1079362137 11:19777889-19777911 ATCAAGACACAATGGGGGCTCGG - Intronic
1080937891 11:36882565-36882587 TGATAGAAGCAGTGGTGGCTGGG + Intergenic
1081264204 11:40999241-40999263 GGCTAGACACAGTGTGAGCGAGG - Intronic
1081647877 11:44802559-44802581 TGCTCCATCCAGTGGGGGCTGGG - Intronic
1084857874 11:72000480-72000502 TGCTGGGAACACTGGGGGCTGGG - Exonic
1086620732 11:88884383-88884405 TCCTAGACACAGTGGGGTACAGG - Intronic
1088855802 11:113752362-113752384 ATCTAGTCACATTGGGGGCTAGG - Intronic
1090511891 11:127384267-127384289 TGCTAGCCCTAGTGAGGGCTTGG + Intergenic
1090795900 11:130135464-130135486 TGGGAGCCACAGTGGGGTCTTGG + Intronic
1091164717 11:133464963-133464985 GGCTAGACACAGTAAAGGCTGGG + Intronic
1091361090 11:134978807-134978829 TGCTAGTCACAGTGGGCCCCTGG - Intergenic
1093011946 12:14116432-14116454 GGCTGGCCACAGTGGTGGCTGGG + Intergenic
1093917415 12:24821016-24821038 TGCTGGAAACAGAAGGGGCTGGG + Intronic
1096392008 12:51237083-51237105 TGCTTGTCACAGTGGGACCTGGG - Intergenic
1096627648 12:52905138-52905160 GGCTAGGCCCAGAGGGGGCTGGG + Intronic
1097089393 12:56493946-56493968 TCCTAGACAGGGTGGCGGCTGGG + Intergenic
1099078931 12:78150395-78150417 TGCTAGACATAGTGGAAGATGGG + Intronic
1101430260 12:104621142-104621164 AGCTTGACACAGTGGGATCTTGG + Intronic
1101559550 12:105843338-105843360 TTCTATAAACACTGGGGGCTCGG + Intergenic
1102006159 12:109590492-109590514 TGCTAGGCACAGCGTGGCCTTGG - Intronic
1102131650 12:110535200-110535222 TGGTAGACGCGGTGGGGGCGGGG - Exonic
1102965766 12:117124383-117124405 GGCAAGAGACAGTGGTGGCTTGG + Intergenic
1103037806 12:117670691-117670713 TGCTAGACACAGGGGGGCAAAGG - Intronic
1106582755 13:31032016-31032038 TGGTAGGCACAGCGGGGGGTGGG - Intergenic
1107210602 13:37849539-37849561 TTCTAGACTCAGTGGCTGCTTGG - Intronic
1107456158 13:40556676-40556698 TTCAACACACAATGGGGGCTTGG + Exonic
1107684965 13:42887532-42887554 TGCTATACAATGTGGTGGCTGGG + Exonic
1110046659 13:70841301-70841323 GGCTGGACACAGTGGAGGCAGGG - Intergenic
1110565390 13:76952577-76952599 TTCTAGACACTCTGGGTGCTGGG + Exonic
1111888167 13:94049303-94049325 TGCTAGGATCAGTGGGGGGTTGG - Intronic
1113758496 13:112831268-112831290 TTCAAGTCACAGTGGGAGCTGGG + Intronic
1114684844 14:24518956-24518978 TGCTTCTCACAGTAGGGGCTGGG - Intergenic
1115271642 14:31560048-31560070 TCCTAGACAGGGTGGCGGCTGGG + Intronic
1115311684 14:31984789-31984811 GACTAGGCACAGTGGGGGCAGGG + Intergenic
1118151789 14:63197370-63197392 TGGAAGAAACAGTCGGGGCTGGG - Intergenic
1119172662 14:72546704-72546726 TGCTTGGCACATTGGGGTCTGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119514454 14:75237024-75237046 TTCCAGACAAAGTGGGGGCCCGG + Intergenic
1121006214 14:90492131-90492153 TCCCAGACACAGTGGTGGGTGGG + Intergenic
1122218231 14:100218440-100218462 TGCTAGAATCAGCCGGGGCTAGG - Intergenic
1122847280 14:104506784-104506806 TGCAAGCCACACTGGGCGCTTGG + Intronic
1125967430 15:43885718-43885740 TGCTGGACACTGTGCGGACTTGG + Exonic
1127065348 15:55231650-55231672 TGCTGTCCACAGTGGTGGCTAGG - Intronic
1127842812 15:62845588-62845610 TCCTACACACAGCAGGGGCTGGG - Intergenic
1128349488 15:66879648-66879670 CCCTAGACACAGTGAGGGGTGGG + Intergenic
1131507953 15:93032912-93032934 TTCCAGACACACAGGGGGCTGGG + Intergenic
1134307421 16:13045751-13045773 TGGGGGACACAGTGGGGGCAGGG - Intronic
1134343405 16:13366523-13366545 TGCTACTCACAGTGTGGTCTAGG - Intergenic
1138417381 16:56879249-56879271 CACCAGACACAGTGGGGGCTGGG + Intronic
1142112948 16:88341791-88341813 TGCCATGCCCAGTGGGGGCTGGG + Intergenic
1143226886 17:5312682-5312704 TGCAAGACACTGTGGAGGTTGGG + Intronic
1143639614 17:8188673-8188695 GGATAGCCACAGTGGGGGCTGGG + Exonic
1143766599 17:9141764-9141786 TCCAAAACACAGTTGGGGCTGGG + Intronic
1145947392 17:28787217-28787239 TAGAAGATACAGTGGGGGCTGGG - Intronic
1145976758 17:28988369-28988391 TGCTAGGCATAGTGAAGGCTGGG + Intronic
1146267085 17:31459850-31459872 TTCTGGACACAGGGGTGGCTGGG + Intronic
1146717355 17:35097873-35097895 CACCAGACACAGTGGGAGCTGGG + Intronic
1147977145 17:44254472-44254494 TGAGAGACAGGGTGGGGGCTGGG - Intronic
1148778916 17:50110860-50110882 GTCTGGGCACAGTGGGGGCTGGG - Exonic
1151788651 17:76289640-76289662 TAAAAGACAAAGTGGGGGCTGGG + Intronic
1152414680 17:80151857-80151879 TCCTAGACACCTTGGGGGCCAGG - Intergenic
1152824235 17:82454017-82454039 TCCTAGACAGGGTGGCGGCTGGG + Intergenic
1152876476 17:82789413-82789435 TGCTAGACGGGGAGGGGGCTTGG + Intronic
1152892744 17:82891753-82891775 TGGGGGACACAGAGGGGGCTGGG + Intronic
1153282628 18:3428151-3428173 TGCCACACACTCTGGGGGCTGGG + Intronic
1154003606 18:10506842-10506864 TCCTAGACAGGGTGGCGGCTGGG + Intergenic
1155441590 18:25868049-25868071 TGCTCCACACAGTGTTGGCTGGG - Intergenic
1157862031 18:51150510-51150532 TGATAGACACAGTGAGCTCTCGG + Intergenic
1160622052 18:80178614-80178636 TGCTAGGGAGACTGGGGGCTGGG - Intronic
1160695709 19:483380-483402 TGCTAGACGCAGTGGCAGCCAGG - Intergenic
1161069398 19:2252798-2252820 TGCAAGACAGAGTGGGGTCCTGG + Intronic
1161698496 19:5783097-5783119 TGCCAGACAGAATGGGGGCCGGG + Exonic
1163647173 19:18495980-18496002 TGCTCCACACAGTGGGCGTTTGG + Intronic
1164823672 19:31268535-31268557 TGATTGACACAGTGGGGCCCAGG + Intergenic
1167094838 19:47369635-47369657 CGGTGGGCACAGTGGGGGCTGGG + Intronic
925969635 2:9097216-9097238 TGGCAGACTCAGTGGGGACTGGG + Intergenic
925970655 2:9104559-9104581 TGCTGGAAACGGTGAGGGCTTGG - Intergenic
926777149 2:16433887-16433909 CCCTAGTCACTGTGGGGGCTAGG + Intergenic
928084529 2:28337466-28337488 TGCCTGACACAGTGTGGGCTCGG + Intronic
928330371 2:30353199-30353221 TGCAAGTAACAGTGGGGGCAGGG + Intergenic
929591552 2:43150796-43150818 TTCAAGACACAGTTGTGGCTGGG + Intergenic
930432995 2:51304495-51304517 TGCTTGGCACAGTGAGGGCTGGG - Intergenic
931575666 2:63715853-63715875 ACCTAGACCCAGTGAGGGCTAGG + Intronic
932182412 2:69659856-69659878 TGCTGGTGGCAGTGGGGGCTGGG + Intronic
932998222 2:76883644-76883666 TGCGAGAAACAGTGGGGGTCAGG - Intronic
933700884 2:85254746-85254768 TGCCAGACAGGGTGGGGGCAGGG - Intronic
936486418 2:112929586-112929608 TGCTAGTCAAAGTGTGGTCTGGG + Intergenic
936505337 2:113101239-113101261 TGGTAGACGCAGTGGGGGTGAGG + Intergenic
936941742 2:117890861-117890883 AGCTAGACACAGTCGTTGCTGGG + Intergenic
938075180 2:128328453-128328475 TGCTGGACCAAATGGGGGCTGGG + Intergenic
939858515 2:147390014-147390036 TAACAGACACTGTGGGGGCTGGG - Intergenic
946409289 2:219508392-219508414 TCCTAGACCCAGTGGGGGTGGGG + Intergenic
947852525 2:233299858-233299880 AGCAATCCACAGTGGGGGCTGGG - Intergenic
948777218 2:240296055-240296077 TGCTGGCCACTGTGGGGGCTGGG - Intergenic
1168839920 20:903414-903436 TGCTAGAGACAATGGGGGCTGGG - Intronic
1169249694 20:4050910-4050932 TAAGAGACACAGTGGGGCCTAGG + Intergenic
1170591769 20:17776885-17776907 TGAGAGAGACAGTGGGGGCAGGG + Intergenic
1171462686 20:25307719-25307741 AGCTGGACACAGTGGAGGCCGGG - Intronic
1172656936 20:36543193-36543215 TGCAAGAAACACTGAGGGCTGGG + Intronic
1172884878 20:38224211-38224233 TGATAAACACAGTATGGGCTGGG - Intronic
1173802807 20:45905198-45905220 TGCTAGGCACTGTGGGGGGATGG + Intronic
1173903659 20:46609968-46609990 TGCTAGAAAGAGTGTGGACTGGG - Intronic
1176146164 20:63566482-63566504 TGCTGGACGCAGTGAGGACTCGG + Intronic
1178411074 21:32364249-32364271 TGCTAGTCACAGTGTGTTCTGGG + Intronic
1179622499 21:42626512-42626534 ACCCAGACACACTGGGGGCTAGG - Intergenic
1180036439 21:45252686-45252708 TGCTTGCCACACTGGGGGCTGGG + Intergenic
1180966282 22:19789479-19789501 AGCAAGACCCAGTGGGGGGTTGG + Intronic
1181103554 22:20557809-20557831 TGAAAGTTACAGTGGGGGCTGGG + Intronic
1182035272 22:27193416-27193438 TGCCAGACACAGTGGTGCTTGGG - Intergenic
1184111759 22:42399636-42399658 CGCTGGTCACAGTGGAGGCTGGG + Intronic
1185346567 22:50313206-50313228 TGCCAGGCAGGGTGGGGGCTGGG - Intronic
952191482 3:31027387-31027409 TGGTAGACACAGGCAGGGCTTGG + Intergenic
953961970 3:47273452-47273474 TACTAGAGACAGTGGGGACCAGG - Intronic
959276494 3:104283301-104283323 TGCTAGATTCAGTGGTGTCTGGG + Intergenic
959555497 3:107712626-107712648 TGCTAGAAATGGTGGTGGCTTGG - Intronic
961651457 3:128418597-128418619 TGCTGGGCAGAGTGGGGGCAGGG - Intergenic
962535650 3:136326916-136326938 TTTTTGACAGAGTGGGGGCTAGG + Intronic
963007263 3:140737858-140737880 TGCAAGGAACAGTGGGGACTGGG - Intergenic
967113963 3:186319762-186319784 TGCAAGACACAGTGGTGGTAGGG - Intronic
967957237 3:194886663-194886685 TCCTAGATACAGTGGGGGTATGG + Intergenic
969365879 4:6694088-6694110 TGCTGGACTCAGCGGGGGCTGGG + Intronic
969389626 4:6881657-6881679 TGCGAGACACAGTGGGGTAAGGG + Exonic
969638075 4:8380884-8380906 CCCTAGACAGGGTGGGGGCTGGG + Intronic
971170167 4:24225652-24225674 TGCTAGAAAGAGTGGGGTCCAGG + Intergenic
973714419 4:53661050-53661072 TGCTAGATACGGTGTTGGCTAGG - Intronic
973941204 4:55912248-55912270 TGCTAGACACTGTGGGCTGTGGG + Intergenic
975871816 4:78787475-78787497 CGTTAGACAGAGTGGGAGCTGGG + Intronic
978661865 4:111137011-111137033 TTCTGGACACAGCTGGGGCTTGG - Intergenic
986363797 5:7008890-7008912 TGCTAGGCACTTTGGGGGATGGG + Intergenic
986982871 5:13469193-13469215 TCCTAGACTCATTGGGGGTTGGG + Intergenic
987484104 5:18502056-18502078 TAAAAGACACAGTGGGGGCCAGG - Intergenic
991034243 5:62112291-62112313 AGCTATAGACAGTGGTGGCTTGG - Intergenic
997236516 5:132275125-132275147 TCCTAGACACAGTGCTGGGTAGG - Intronic
999201762 5:149821708-149821730 TGCCTGACACATAGGGGGCTTGG - Intronic
1002204304 5:177552678-177552700 AGCTAGACCCAGTAGGGGTTGGG + Intronic
1005892026 6:30147882-30147904 GGGTAGACCCAGTGGGGGCCTGG - Exonic
1005983686 6:30856755-30856777 TGGTAGAGGCAGAGGGGGCTGGG - Intergenic
1006723605 6:36178449-36178471 ACCTATACACCGTGGGGGCTGGG + Intergenic
1006905925 6:37533553-37533575 TGCCAGACTCAGGTGGGGCTGGG + Intergenic
1008115411 6:47543751-47543773 TGCCAGACACATTGGGTGTTAGG + Intronic
1009775021 6:68195063-68195085 GGCTAGGCACAGTGGGGGATGGG - Intergenic
1012101704 6:95097010-95097032 TGCTAGGCAAAGTGGTGGGTAGG - Intergenic
1013592427 6:111630657-111630679 TACCTGACAGAGTGGGGGCTGGG - Intergenic
1014052530 6:116971862-116971884 TGCTAGATACTCTGGGGACTGGG + Intergenic
1014721181 6:124920277-124920299 TCCTAGATACAGTGGGGGTAGGG + Intergenic
1017856025 6:158350196-158350218 TCCTAGACAGGGTGGGGGCCAGG + Intronic
1018000306 6:159572808-159572830 AGCAAGACACAGTAGGGACTCGG + Intergenic
1020556229 7:9673760-9673782 TGCAAGTCCCAGTGTGGGCTTGG - Intergenic
1021995774 7:26177184-26177206 TCCTAGACAGGGTGGCGGCTGGG + Intronic
1022508615 7:30921807-30921829 TTCTAGGCAGAGTGGGGCCTGGG + Intronic
1027550993 7:79594868-79594890 TGCTTGACACAGTGGCAGCAAGG - Intergenic
1028912664 7:96225627-96225649 TGCCACAAACAGTGGAGGCTGGG - Intronic
1029363546 7:100103186-100103208 AGCTAGGCACAGGGGAGGCTGGG - Intronic
1029927331 7:104330724-104330746 TGCTAGAAAAAGTTGGGGATGGG - Intronic
1032483398 7:132264551-132264573 TGCTATACACAGGGCGAGCTGGG + Intronic
1033256154 7:139803659-139803681 GGCTGCACACAGTGGGGGCCTGG - Intronic
1034285385 7:149880332-149880354 TGCTAACCACACTGGGAGCTCGG - Exonic
1035075478 7:156174725-156174747 TCCTGGAGGCAGTGGGGGCTGGG + Intergenic
1040517758 8:48148423-48148445 TGCTAGACGGGGTGGTGGCTGGG - Intergenic
1041382162 8:57261368-57261390 TGCTGGTCAGGGTGGGGGCTGGG + Intergenic
1042810585 8:72821671-72821693 TTCCACACACTGTGGGGGCTTGG - Intronic
1048150727 8:131891002-131891024 TCCTAGACACAGTTGGGGCTGGG - Intergenic
1052447910 9:28588173-28588195 TGCTAGAAACAGAGGGGGAATGG - Intronic
1053040137 9:34863171-34863193 CTCTAGACTCACTGGGGGCTTGG + Intergenic
1056684758 9:88750493-88750515 TTCTTCACACAGTGGTGGCTGGG - Intergenic
1056766343 9:89446854-89446876 AGCTGGACACAGTGTGGGCAGGG - Intronic
1056867470 9:90242001-90242023 TGCCAGTCACAGTGAGGGCATGG - Intergenic
1057071882 9:92105995-92106017 TGCCAGACAGGGTGGCGGCTGGG - Intronic
1057214446 9:93220199-93220221 GGCTGGACACTGTGGGGGATGGG + Intronic
1061857343 9:133449521-133449543 TCCCAGAGACAGTGGGGGCAGGG - Intronic
1062338780 9:136084288-136084310 GGCTGGACACAGGAGGGGCTGGG - Intronic
1062388378 9:136324249-136324271 TGTAGGACCCAGTGGGGGCTAGG - Intergenic
1188701167 X:33265998-33266020 TTCTAGACATAGTGGGGCTTCGG - Intronic
1189620879 X:42835911-42835933 CCCTAGACACAGAGGTGGCTGGG + Intergenic
1190773428 X:53533819-53533841 TGCTAGACACAGTGGGGGCTGGG - Intronic
1192663639 X:73068087-73068109 TCCTAGACAGGGTGGCGGCTGGG - Intergenic
1194310939 X:92305584-92305606 TGCAAGTCACATTGGGGGTTGGG + Intronic
1194751417 X:97688663-97688685 TGCCAGTCACAGTGGAGGGTTGG + Intergenic
1195461937 X:105137407-105137429 TATTTGACACACTGGGGGCTGGG + Intronic
1198272024 X:135064129-135064151 AGCTAGACCAAGTGGTGGCTGGG + Intergenic
1200619214 Y:5419859-5419881 TGCAAGTCACATTGGGGGTTGGG + Intronic