ID: 1190776961

View in Genome Browser
Species Human (GRCh38)
Location X:53560384-53560406
Sequence TAGGGATATTTCCTGGGGAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190776948_1190776961 28 Left 1190776948 X:53560333-53560355 CCAGTGTCAGAGAACTGTGGTCT 0: 1
1: 0
2: 3
3: 14
4: 167
Right 1190776961 X:53560384-53560406 TAGGGATATTTCCTGGGGATGGG 0: 1
1: 0
2: 0
3: 18
4: 166
1190776947_1190776961 29 Left 1190776947 X:53560332-53560354 CCCAGTGTCAGAGAACTGTGGTC 0: 1
1: 0
2: 0
3: 18
4: 177
Right 1190776961 X:53560384-53560406 TAGGGATATTTCCTGGGGATGGG 0: 1
1: 0
2: 0
3: 18
4: 166
1190776955_1190776961 -5 Left 1190776955 X:53560366-53560388 CCATCAGTGGATGGGTGGTAGGG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1190776961 X:53560384-53560406 TAGGGATATTTCCTGGGGATGGG 0: 1
1: 0
2: 0
3: 18
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190776961 Original CRISPR TAGGGATATTTCCTGGGGAT GGG Exonic
900792608 1:4690143-4690165 TAGGGACATTTCCTGGCCCTGGG - Intronic
902825800 1:18973382-18973404 TAGTGATATTACTTGGGGACGGG - Intergenic
904936800 1:34136576-34136598 TAGAGAAACTTCCTTGGGATAGG + Intronic
906024318 1:42659925-42659947 TAATCATATTTCCTGGGGAGTGG + Intronic
906610345 1:47197346-47197368 TAGTGAAATATCTTGGGGATGGG + Intergenic
909364275 1:74801167-74801189 TAAAGATATTTCCTGTGGAATGG - Intergenic
910506697 1:87957572-87957594 TAGGGAGAGTTGCTGGGGAGAGG - Intergenic
914694737 1:150067131-150067153 TAGGGATGTTTCTGGGGGAAAGG - Intergenic
915264693 1:154708409-154708431 CAGGCTTCTTTCCTGGGGATGGG + Intronic
916161251 1:161917319-161917341 TAAGGAGATATCCTGGGGATGGG + Intronic
916733517 1:167587144-167587166 GAGGGACATTTCCAGGGCATGGG - Intergenic
917015712 1:170529270-170529292 TAGATATAGGTCCTGGGGATTGG + Intergenic
917493356 1:175517452-175517474 AAGGCATATTTCCTGGGAGTAGG - Intronic
918012180 1:180597281-180597303 TTGGCATATTTTGTGGGGATGGG + Intergenic
918278233 1:182975532-182975554 AAGGGCTATTACCTGGGTATGGG + Intergenic
919428844 1:197468300-197468322 TAGTGATAGTGCCTGGGGGTGGG - Intronic
920240074 1:204540313-204540335 TAATGAGATATCCTGGGGATGGG - Intronic
922732204 1:227954776-227954798 TGGGCATATTTCCTAGAGATAGG - Intergenic
922941256 1:229468904-229468926 TTGGGTTAGTTCCTGGGGAATGG - Intronic
923151333 1:231235919-231235941 TAGGGTAATTTCCTGGGTCTAGG + Intronic
923211529 1:231808188-231808210 TAGGGATTTTTCCTGAATATAGG + Intronic
923840717 1:237668745-237668767 TGGGGATATTTCATGGTGAAAGG + Intronic
1065210850 10:23401646-23401668 TAGGGTTATTATCTGTGGATGGG + Intergenic
1067681776 10:48446120-48446142 GAAGGATATTTCCTGGGTAAGGG + Intronic
1068449030 10:57163036-57163058 CAAGGATATTGCCTGGAGATTGG + Intergenic
1069813839 10:71181009-71181031 TAGGGTTGATTCCTTGGGATTGG + Intergenic
1070128317 10:73639524-73639546 CAGGCATGTTTCCTGGGGGTGGG - Intronic
1070606722 10:77903717-77903739 TAATGAGATATCCTGGGGATGGG - Intronic
1072021977 10:91410825-91410847 TTGGGTTATTTTCTGGGGCTTGG + Intronic
1072034462 10:91551738-91551760 CAGGGACATTTCCTGGGGACAGG + Intergenic
1073552206 10:104414107-104414129 TAGGGATACTTCCTAGGACTGGG - Intronic
1073658179 10:105440684-105440706 TAGGGCTTTGTCATGGGGATTGG + Intergenic
1074386998 10:113024550-113024572 TAATGAGATATCCTGGGGATGGG + Intronic
1075536990 10:123279511-123279533 TGGGGACATTTCTTGGGGACAGG - Intergenic
1077661917 11:4076560-4076582 TAGGGAAATATCTTGGGGATAGG - Intronic
1078316432 11:10296730-10296752 TGGGGATATATTCTTGGGATTGG + Intergenic
1082881770 11:58045102-58045124 TAAGGAAATATCTTGGGGATAGG - Intronic
1083225317 11:61281116-61281138 GAGGGCTATGTCCTGGGGACAGG + Exonic
1083459885 11:62804117-62804139 GAGGGTTCTTTCCTGTGGATAGG - Intronic
1084758633 11:71254163-71254185 GAGGGAAATATCCTGAGGATAGG - Intergenic
1085462992 11:76706492-76706514 TTGGAATCTTTCCAGGGGATCGG - Intergenic
1085482138 11:76831384-76831406 TAGGAATCTTCCTTGGGGATGGG - Intergenic
1086256947 11:84888720-84888742 TAGTGATCTTTCTTGGAGATAGG - Intronic
1088434250 11:109793489-109793511 TAATGATATATCTTGGGGATTGG - Intergenic
1090051302 11:123382106-123382128 TAGGGGATTTTTCTGGGGATTGG + Intergenic
1095988215 12:48014909-48014931 TAGGCATTTTTCCTGGGCCTTGG - Intergenic
1096932595 12:55230060-55230082 TAGTGAGATATCCTGGGGACAGG - Intergenic
1100394224 12:94170836-94170858 TAGCTTTATTTCCTGGGGAAGGG + Intronic
1102832361 12:116015397-116015419 TAGTGTTATTGCCAGGGGATAGG - Intronic
1104377144 12:128274771-128274793 TTGGGATAAGGCCTGGGGATTGG - Intronic
1105284169 13:18991358-18991380 AAGGGATATAGCCTGGGGATGGG - Intergenic
1106398054 13:29400704-29400726 TAAGCGTATTTCCTGGGGAGAGG - Intronic
1106485711 13:30170899-30170921 CAGGGAAATTTCCTGCGGAGGGG - Intergenic
1106544121 13:30715602-30715624 TGGGGCCATTTCCTGGGGAATGG - Intronic
1108439590 13:50436984-50437006 TAAGGACATTTCTTGGGGAGGGG + Intronic
1109341034 13:61059187-61059209 TACGGATACATCCTGGGTATTGG + Intergenic
1113418832 13:110154188-110154210 TAGGGTCATTTACTGGGAATTGG + Intronic
1113784146 13:112993612-112993634 TAGGGATGTTTCTTGGAGAGAGG + Intronic
1117474072 14:56076433-56076455 TAGGAATATTTTCTGGACATGGG + Intergenic
1118803124 14:69209204-69209226 CAGGGAGATTTCCTGGGGTGAGG + Intronic
1119689672 14:76661722-76661744 TAGGGATTTTGCTGGGGGATGGG + Intergenic
1120616935 14:86718354-86718376 TAGGTAGATATCCTGGGGCTGGG + Intergenic
1121224703 14:92312668-92312690 TGGGGATATTAACTGGTGATGGG + Intergenic
1121364183 14:93291542-93291564 TATGAATATTTCATGGGTATGGG + Intronic
1121403402 14:93702820-93702842 CAGGGACAGTTTCTGGGGATGGG - Intronic
1124104605 15:26725708-26725730 TAATGAGATATCCTGGGGATGGG + Intronic
1124440585 15:29682899-29682921 GAGGGATAATCCCTGGGGCTGGG - Intergenic
1125160673 15:36639908-36639930 TGGGGATATTTGCTGTGGTTAGG + Intronic
1125837966 15:42770704-42770726 TATGTATATTGACTGGGGATTGG - Intronic
1125869116 15:43081824-43081846 TAGGATTATTTCCTTAGGATAGG - Intronic
1131403902 15:92147754-92147776 TGGGGACCTGTCCTGGGGATAGG + Intronic
1137785198 16:51132694-51132716 TAGACATATTTCCTGGGGTCTGG + Intergenic
1139076395 16:63454623-63454645 TAATGAGATTTCATGGGGATTGG - Intergenic
1141682292 16:85551680-85551702 TAGTGACATTTCCTGGTGACAGG - Intergenic
1145863433 17:28226030-28226052 TGGGGACATTGCCTGGGGAGAGG + Intergenic
1147053232 17:37813888-37813910 CAGGCAGAGTTCCTGGGGATGGG + Intergenic
1149344666 17:55722750-55722772 TAGGGATCTCTTCTGGGGAAAGG + Intronic
1149441450 17:56678001-56678023 TAGGCATCTGTCCTGGGGATGGG - Intergenic
1150887004 17:69098783-69098805 GATGGTTATTTCCAGGGGATGGG + Intronic
1152375177 17:79915118-79915140 AAGGGAAAGTTCCTGGGGAGTGG - Intergenic
1156078898 18:33312031-33312053 TAGGGATATTGCATGGGGCTTGG - Intronic
1158231167 18:55257030-55257052 CAGGGATCTTTCCTAGAGATGGG + Intronic
1159963882 18:74577587-74577609 TAGGGCTGGTTCCTGGGGAAGGG + Intronic
1160907404 19:1457914-1457936 CTGGGACATTTCCTGGGAATGGG + Intronic
1165162334 19:33824251-33824273 TAATGAGATTTCTTGGGGATAGG + Intergenic
925518332 2:4710234-4710256 TAAGGATATTTTCAGGGGAAGGG - Intergenic
927365378 2:22289484-22289506 TATGGATACTTCTTGGGGAGTGG - Intergenic
927367068 2:22309525-22309547 TAGTGAGATATCTTGGGGATGGG - Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
927959424 2:27231591-27231613 TAGGGGTATTGCCAGGGGAGGGG - Intronic
928271495 2:29859189-29859211 AAGGGTTATGTACTGGGGATAGG + Intronic
928306369 2:30173145-30173167 CAGGGATCATTCCTGGGGCTGGG - Intergenic
928496279 2:31835797-31835819 TAATGAGATATCCTGGGGATGGG + Intergenic
933918417 2:87019778-87019800 TTGGGATATTTCCTAGGGACAGG - Intronic
934004579 2:87750135-87750157 TTGGGATATTTCCTAGGGACAGG + Intronic
935553918 2:104486221-104486243 TAGGGATATTTCCAGGTTTTTGG - Intergenic
935767533 2:106384156-106384178 TTGGGATATTTCCTAGGGACAGG + Intergenic
938074218 2:128323189-128323211 TGGGGATGTTCCCTGGGGGTGGG + Intergenic
940251891 2:151687560-151687582 TGGGGACATTTCCTGGTGAGTGG - Intronic
943040650 2:182800731-182800753 TAATGATATGTCTTGGGGATGGG + Intergenic
943201238 2:184827545-184827567 TGGGTATATTTCCTGGGTAGAGG - Intronic
944631049 2:201625049-201625071 TATGGATATTTTCTGGGTCTTGG - Intronic
944811320 2:203329259-203329281 TAGGCAGTTTTCCTGGGGGTGGG + Intronic
946740502 2:222796472-222796494 GAGGGATATTTTCTGGAGACAGG - Intergenic
1168926358 20:1583459-1583481 TTGGCAGATTTCCTGAGGATTGG + Intronic
1170653646 20:18265928-18265950 AAGGCCTGTTTCCTGGGGATAGG - Intergenic
1176521572 21:7828741-7828763 GAGGGATTTTTCCTGGTGATTGG + Intronic
1177775395 21:25561410-25561432 CAGGAATATGTCCTGGAGATGGG + Intergenic
1178655592 21:34458753-34458775 GAGGGATTTTTCCTGGTGATTGG + Intergenic
1179070226 21:38064327-38064349 TAAGGTTATTTTCTGGGCATTGG + Intronic
1181362614 22:22349715-22349737 TAGGAATTCTTCCTGAGGATGGG + Intergenic
1181981180 22:26767789-26767811 GCAGGATATTTGCTGGGGATGGG + Intergenic
1182002309 22:26929934-26929956 TGGGAATATGTCCTGGGGAATGG - Intergenic
1183092049 22:35529100-35529122 TAAGGATACTTCCTGGAAATTGG - Intergenic
1185226758 22:49657810-49657832 GAGGGATATAACCTGTGGATGGG - Intergenic
949312339 3:2713854-2713876 TAGGCATATTGCCTTGGGAAAGG + Intronic
952116135 3:30183837-30183859 TAGGATTACTTCTTGGGGATGGG + Intergenic
953025272 3:39141556-39141578 TGGGGCTATCTGCTGGGGATGGG - Intergenic
956124940 3:66002412-66002434 TAGGGACATTTCATGGGGTGGGG + Intronic
959159554 3:102706792-102706814 TAAGGAGATATCTTGGGGATGGG + Intergenic
960347767 3:116556087-116556109 TAATGAGATTTCTTGGGGATGGG - Intronic
962496050 3:135939870-135939892 CAAGAATATTTACTGGGGATGGG - Intergenic
963688915 3:148473725-148473747 TAGGGATATTTACTGGAGAAAGG - Intergenic
969270527 4:6096773-6096795 TAGTGAGATATCTTGGGGATGGG + Intronic
972454331 4:39238550-39238572 TAGGGATTTTTCCTGAGAATAGG - Intronic
972719415 4:41681245-41681267 TAGAGTCATTTCCTGGGGAGTGG + Intronic
973291752 4:48477814-48477836 TAGGGATGCTGTCTGGGGATTGG - Intergenic
974189578 4:58487314-58487336 TAGAGACAGTTCCTGGGGAAGGG + Intergenic
978182265 4:105813520-105813542 TAAGGAGATATCTTGGGGATGGG - Intronic
981741559 4:148007492-148007514 TGAGGATATCTTCTGGGGATGGG + Intronic
984256235 4:177393002-177393024 TAGAGATATTTGATTGGGATGGG - Intergenic
984761812 4:183368874-183368896 TAATGAGATATCCTGGGGATGGG - Intergenic
988461347 5:31440926-31440948 TAGTGAGATATCTTGGGGATAGG - Intronic
989658432 5:43771018-43771040 TATGGATATTTCTAAGGGATAGG + Intergenic
991220063 5:64203481-64203503 TTGGTATGTTGCCTGGGGATGGG - Intronic
994131311 5:96231499-96231521 AAGTGATTTTTCATGGGGATGGG + Intergenic
997272885 5:132556804-132556826 TCCGGATCTTTGCTGGGGATGGG - Intronic
998234053 5:140382589-140382611 AAGGGATTTTCCCTGGGGCTTGG - Intergenic
998338494 5:141395068-141395090 GAGGGAGACTTCCTGGGAATAGG - Exonic
999199128 5:149803717-149803739 TAGGGATGTGTCCTGGGGTGGGG - Intronic
999915541 5:156255131-156255153 TAATGATATATCTTGGGGATGGG - Intronic
1000120755 5:158195591-158195613 GAGGGGTATTATCTGGGGATTGG + Intergenic
1002526372 5:179818056-179818078 TGGGGATTTTTCCTAGGGAGTGG + Intronic
1004028722 6:11845217-11845239 TAGTGAGATATCTTGGGGATAGG + Intergenic
1005007462 6:21302604-21302626 TAATGAGATATCCTGGGGATGGG + Intergenic
1006077833 6:31545704-31545726 TTGGGATATTTCTGTGGGATGGG - Intronic
1006121422 6:31808701-31808723 TAGAAATATTTTCTGGGGCTGGG + Intergenic
1006381058 6:33697426-33697448 TAGGGAAATCTCCTGGGGAGAGG - Exonic
1008303999 6:49878378-49878400 TAATGAGATATCCTGGGGATGGG + Intergenic
1009924160 6:70099502-70099524 TAATGATATATCTTGGGGATGGG - Intronic
1011359829 6:86511430-86511452 TAGGGCTGCTGCCTGGGGATTGG + Intergenic
1014456311 6:121638541-121638563 TAGTGAGATATCTTGGGGATGGG + Intergenic
1015141772 6:129942183-129942205 AAGGGACATGGCCTGGGGATTGG + Intergenic
1015939319 6:138432368-138432390 TAGGGATTTATCCTGGTAATTGG + Exonic
1016022462 6:139250464-139250486 TAGGGTTAGCTCCTGGGGACTGG + Intronic
1016891345 6:149010423-149010445 CAGGGATATTTCTGGGGGAGAGG + Intronic
1021570909 7:22064368-22064390 TATGTACATTTGCTGGGGATGGG + Intergenic
1028658763 7:93242184-93242206 TAGAGATACTTTCTAGGGATTGG + Intronic
1029494080 7:100887955-100887977 TAGGGCTATGGCCTGAGGATGGG - Intronic
1029743179 7:102502858-102502880 TCTGGACATTTCCTGGGGGTGGG + Intronic
1029761168 7:102602019-102602041 TCTGGACATTTCCTGGGGGTGGG + Intronic
1030583677 7:111390341-111390363 TAGGGATCATCCCTGGGGAAAGG - Intronic
1032183686 7:129704625-129704647 TAGTGAGATATCTTGGGGATAGG + Intronic
1034392513 7:150798164-150798186 TGGGGGTATTTTCTGGGGAGGGG - Intronic
1034418410 7:150977044-150977066 TAGGCAAATGTCCTGGGGGTGGG - Intronic
1047113514 8:121816822-121816844 TAGGTATATTTTCAGGGGACAGG + Intergenic
1048694302 8:137007593-137007615 TACAGAGAATTCCTGGGGATAGG + Intergenic
1050081481 9:1920366-1920388 GAGGGACATTTCCTGAGGAATGG - Intergenic
1051576502 9:18622156-18622178 GAGGGTTATTTCATGGTGATTGG + Intronic
1052827712 9:33189047-33189069 AAGGAAGGTTTCCTGGGGATGGG + Intergenic
1053950882 9:43382977-43382999 TAGGGAGATTTCCTTGGAAACGG + Intergenic
1054029981 9:44753091-44753113 TAGGAAGATTTCCTTGGGAACGG + Intergenic
1054081385 9:60619075-60619097 TAGGAAGATTTCCTTGGGAACGG - Intergenic
1054083870 9:60662278-60662300 TAGGGAGATTTCCTTGGAAACGG - Intergenic
1059671919 9:116500032-116500054 TAGGGAGATTTCCTGGGGTGTGG - Intronic
1060119728 9:120977335-120977357 TAATGATATATCTTGGGGATGGG - Intronic
1062115576 9:134806387-134806409 CAGGGGTATTTCCTTGGGATTGG + Intronic
1062440378 9:136566951-136566973 CAGGGAGATCTCCTGGGGAGAGG + Intergenic
1185620275 X:1449827-1449849 TGGGGATAGTTACTGGTGATGGG - Intronic
1188194101 X:27209310-27209332 TAGGAATAATTCCTGGGCCTGGG - Intergenic
1188327136 X:28819105-28819127 CAGGTATATTTCCTGGGGAGTGG - Intronic
1189758052 X:44292331-44292353 TAATGAGATATCCTGGGGATGGG + Intronic
1190776961 X:53560384-53560406 TAGGGATATTTCCTGGGGATGGG + Exonic
1195718018 X:107836999-107837021 TATGCATTTTTCCTGGGGAAAGG - Intronic
1199331230 X:146562105-146562127 AAGGGATATTTCCTGTGGCTTGG + Intergenic