ID: 1190777899

View in Genome Browser
Species Human (GRCh38)
Location X:53568806-53568828
Sequence CTGTAGAAGCTGGAGGTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 610
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 560}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190777890_1190777899 26 Left 1190777890 X:53568757-53568779 CCGAATGATGTTGTTCATGCCAT 0: 1
1: 0
2: 1
3: 15
4: 155
Right 1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG 0: 1
1: 0
2: 2
3: 47
4: 560
1190777893_1190777899 7 Left 1190777893 X:53568776-53568798 CCATTGTGCTGGGTCTTCGCTGT 0: 1
1: 0
2: 0
3: 7
4: 146
Right 1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG 0: 1
1: 0
2: 2
3: 47
4: 560

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190777899 Original CRISPR CTGTAGAAGCTGGAGGTGGA GGG Exonic
900522170 1:3111069-3111091 ATGGGGAAGCTGGAGGTGGGAGG + Intronic
900703335 1:4061275-4061297 CTCTAGAAGCTGGAAGAGGCAGG + Intergenic
900772679 1:4558298-4558320 CTGTGGAAGATAGAGCTGGAAGG + Intergenic
900982778 1:6056006-6056028 CTGTAGCTGATGGAGGTGGACGG + Intronic
901236446 1:7669964-7669986 CTGCAGAAAGTGGAGGAGGAGGG - Intronic
901241075 1:7693821-7693843 CTGGAGGAGCTGGAGAGGGAGGG - Intronic
901918695 1:12520185-12520207 CTTTGGAAGATGGAGGCGGAAGG + Intergenic
902609347 1:17588156-17588178 CTGGAGCAGCTGGGGGTGGAGGG + Intronic
903028093 1:20443663-20443685 CTCAAGGAGCTGGAGGTGGGTGG - Intergenic
903320693 1:22541506-22541528 GGGCAGAAGCTGGAGGAGGAGGG - Intergenic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903506775 1:23841751-23841773 CTTTGGAAGGTGGAGGTGGGAGG + Intergenic
903687486 1:25142537-25142559 CTGGAAAGGCTGGAGGAGGAAGG + Intergenic
903727122 1:25457353-25457375 CTTCAGAAGGTGGAGGTGGGAGG - Intronic
904120764 1:28196241-28196263 CTGTAGGAGGTTGAGGTGGGAGG + Intergenic
904274046 1:29368962-29368984 CTGTCAAAGCTGGATGGGGAGGG + Intergenic
905079281 1:35302895-35302917 CTCTGGAGGCTGGAGGTGGGAGG + Intronic
905132326 1:35770148-35770170 CTGGGGGAGCTGGAGGTGCACGG + Intergenic
906098362 1:43239442-43239464 CTGTAGAGGGTGGAGGGGGTGGG + Intronic
906727492 1:48054729-48054751 CTGTGGGAGCTGGGGGTCGAGGG + Intergenic
907102493 1:51849571-51849593 CTTTGGAAGGTGGAGGTGGATGG + Intronic
907418575 1:54331281-54331303 CTGTAGCATCTGGAAGTGGTTGG - Intronic
908242195 1:62196833-62196855 CTTTAGGAGATGGAGGTGGAAGG - Intronic
910746472 1:90580319-90580341 CTGCAGCAGCTGCAGGGGGAGGG - Intergenic
912283446 1:108342292-108342314 CTTTAGAAGGTTGAGGTGGGCGG + Intergenic
912702433 1:111888225-111888247 GAGAAGAAGCTGGAGGTGGTGGG + Intronic
912708717 1:111934165-111934187 CTGTAAAAGTGGGAGGTGGGAGG + Intronic
913162832 1:116160930-116160952 CTTTAGAAGCCTGAGGTGGGTGG + Intergenic
913356892 1:117931671-117931693 CTGTAGAAGGAGGTGGTAGATGG + Intronic
913380302 1:118203085-118203107 CAGGAGAAGCTGGAGGAGAAAGG - Intergenic
914415579 1:147478451-147478473 CTGTAGAAGCTCCGGGAGGAGGG - Intergenic
916055886 1:161068831-161068853 GGCTTGAAGCTGGAGGTGGAGGG - Intronic
916126216 1:161573752-161573774 CTCTAGAATGTGAAGGTGGAAGG - Intergenic
916136134 1:161655592-161655614 CTCTAGAATGTGAAGGTGGAAGG - Intronic
916719780 1:167475651-167475673 CTGTTGAATCTGGAGGTTGATGG - Intronic
917800995 1:178570607-178570629 CTTTGGGAGCTGGAGGTGGGAGG - Intergenic
917943410 1:179945956-179945978 CTATCGAAGGTGGAGGTGGAAGG + Intergenic
918705203 1:187651958-187651980 CAGTAGAAGCTGAGTGTGGAGGG + Intergenic
919540486 1:198839328-198839350 CCATAGAAGATGAAGGTGGAGGG + Intergenic
919738168 1:200966486-200966508 CTGCAGAAGCAGGAGGTTGGGGG - Intergenic
920291487 1:204926655-204926677 CTTTAGGAGGTGGAGGTGGGTGG - Intronic
920302920 1:205000403-205000425 CTTTTGAAGCTGGAGGAGAATGG - Intronic
921227358 1:213033535-213033557 CTTTAGGAGGTTGAGGTGGAAGG - Intergenic
921498025 1:215864680-215864702 GTATGGAAGCTGGAGGAGGAAGG + Intronic
922189676 1:223306976-223306998 CTGTAGAATTTAGAAGTGGAAGG - Intronic
922414059 1:225403973-225403995 CTGTGGGAGCTGGAGGTGCTTGG - Intronic
924695243 1:246392689-246392711 CTTTTGAAGGTGGAGGTGGGAGG - Intronic
1062977584 10:1696841-1696863 CTCTAGAAGCTGGTGGAGGCTGG - Intronic
1063042901 10:2360814-2360836 CTGTGGTAGGTGGAGGTGGGTGG + Intergenic
1063057211 10:2518909-2518931 AAGTAGAAGCTGGAGATGTAAGG - Intergenic
1063243614 10:4195537-4195559 CTTTGGAAGGTGGAGGTGGGCGG + Intergenic
1063385201 10:5612195-5612217 CAGTAGAAGCTGGATGGGGAAGG - Intergenic
1064279473 10:13938484-13938506 CTTTAGGAGGTTGAGGTGGATGG - Intronic
1064500192 10:15963133-15963155 CAGTAGACACTGGGGGTGGAGGG + Intergenic
1065328665 10:24571636-24571658 CTGCAGAAGGTGGAGGTGGAAGG - Intergenic
1065416442 10:25492369-25492391 CTGAAGAAGCTAGAGATGGTGGG - Intronic
1065655178 10:27941238-27941260 CTTTAGGAGCTCGAGGTGGGAGG + Intronic
1065659436 10:27990417-27990439 CTTTGGAAGGTGGAGATGGAAGG - Intronic
1065973107 10:30820625-30820647 CTTTCGAGGCTGGAGGTTGAAGG - Intronic
1066097728 10:32088175-32088197 CTTTGGAAGCCGGAGGTGGGTGG + Intergenic
1066214748 10:33275323-33275345 CTTTAGAAGGCGGAGGTGGGTGG + Intronic
1066564392 10:36705745-36705767 CTGTACAATCTGGTGGTGGGAGG + Intergenic
1067025650 10:42841546-42841568 CTTTAGAAGGTCGAGGTGGGAGG + Intergenic
1068117314 10:52749447-52749469 ATGCAGAAGCTGGAGCTGAATGG - Intergenic
1069028614 10:63571399-63571421 CTGTAGAAGCTGGAGTAGACAGG - Intronic
1069623138 10:69850080-69850102 CTGGGTGAGCTGGAGGTGGAGGG + Intronic
1070122295 10:73589841-73589863 CTGTAGGGGCAGGAGGTGAAGGG + Intronic
1070352955 10:75611055-75611077 CTGCAGAGGCTGGAGCTGGTGGG + Intronic
1071255658 10:83869626-83869648 CTCTAGAGGATGGAGGGGGATGG - Intergenic
1071515470 10:86294081-86294103 GTGTAGAAGCTGGAGGAGTATGG + Intronic
1072982922 10:100114914-100114936 CTGCAGAAGCTAGAGGAGGGGGG - Intergenic
1072984485 10:100128006-100128028 CTGAAGGAGCTGGAGCTGCAGGG + Intergenic
1073066904 10:100766495-100766517 CTGTTGGAGCTGGAGGAGGATGG - Intronic
1073124673 10:101141911-101141933 CTGTAGGGGCTGGGGGAGGAGGG - Intergenic
1074160432 10:110832451-110832473 TAGTAGAATTTGGAGGTGGAAGG + Intronic
1074457377 10:113606957-113606979 CTGTAGGAGGCTGAGGTGGATGG + Intronic
1074592403 10:114825267-114825289 CTTTAGGAGATGGAGGTGGGAGG - Intronic
1075015942 10:118910070-118910092 CTCTAGAAGCTGGAAGAGGCAGG + Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1075648178 10:124110019-124110041 CTGCAGATGGTGGAGGTGGGTGG - Intergenic
1076312260 10:129517057-129517079 CTGGAGAAGCTGGAGTGGGAGGG - Intronic
1076806789 10:132862791-132862813 CAGGAGAGGCTGGAGGGGGACGG + Intronic
1077141297 11:1026073-1026095 CCGTAGAGGGTGCAGGTGGATGG + Exonic
1077257038 11:1590281-1590303 CTGTGGAAGCTGGAGCTGCCTGG + Intergenic
1081677638 11:44980284-44980306 CTGGAGAAGCTGTAGTTGGCAGG - Intergenic
1082132114 11:48503604-48503626 CTGAAAAAGCTGGGGGTAGAAGG + Intergenic
1083233721 11:61339052-61339074 CTATGAAACCTGGAGGTGGAAGG - Exonic
1083551403 11:63592846-63592868 CTGTAGAAATTAGAGCTGGAAGG - Intronic
1083713057 11:64560443-64560465 CTGGTGGAGCTGGGGGTGGATGG - Intronic
1083886763 11:65576872-65576894 CTGAAGAGGCGGGAGTTGGAGGG - Intronic
1084057693 11:66647170-66647192 CTGTAGAAACTGGAGCAAGAAGG - Intronic
1084295501 11:68211245-68211267 GTGGGGAAGGTGGAGGTGGATGG - Intronic
1084415144 11:69027745-69027767 ATCTAGAAGCTGGAGGTGGTAGG + Intergenic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1084792598 11:71484059-71484081 CTGTCAGAGCTGGAGGAGGAGGG + Intronic
1085014606 11:73165051-73165073 CTGTAGATAAGGGAGGTGGAGGG - Intergenic
1085136718 11:74096899-74096921 CTCTAGGAGGTGGAGGTGGGTGG + Intronic
1085586691 11:77714878-77714900 CTTTAGAAGGTTGAGGTGGGAGG + Intronic
1086106974 11:83157219-83157241 CTGTGGCGGCTGGAAGTGGACGG + Exonic
1086217015 11:84395523-84395545 CTCAAGAGGCTGGAGGTGGGAGG - Intronic
1087213099 11:95463031-95463053 GTGTAGAAGGAAGAGGTGGAGGG + Intergenic
1087529041 11:99355558-99355580 CTGTGGATGATGGTGGTGGAGGG + Intronic
1087642579 11:100771365-100771387 CTTTAAAAGGTGGGGGTGGAGGG - Intronic
1088255159 11:107896635-107896657 CTTTGGAAGCCTGAGGTGGATGG + Intronic
1088594795 11:111432933-111432955 CTTTGGGAGGTGGAGGTGGAAGG - Intronic
1089361367 11:117889424-117889446 CTTTTGGAGGTGGAGGTGGAAGG - Intergenic
1089496663 11:118911495-118911517 ATGGAGAAGCTGGGGGTGGCGGG - Intronic
1090435743 11:126685045-126685067 CTGTAGATGCTGGAGTGGAAAGG + Intronic
1090662889 11:128894350-128894372 CTATTTAGGCTGGAGGTGGAAGG + Intronic
1091045184 11:132318837-132318859 CTGTAGACTTTGGAGGTGGAGGG + Intronic
1091406483 12:212806-212828 CAGCCGAAGCTGGAGGTGGAAGG - Intronic
1091690247 12:2591337-2591359 CTGTATAAGATGAAGGTGAAGGG - Intronic
1092040251 12:5378045-5378067 CTAGAGAAGGTGGAGGTGGGTGG - Intergenic
1092697884 12:11193642-11193664 CAGAAGCAGATGGAGGTGGAAGG - Intergenic
1093047171 12:14460711-14460733 CTGTAGAAGCTGAGGCTGGGAGG - Exonic
1094646418 12:32328870-32328892 CTGTGGAAACAGGAGATGGAGGG + Intronic
1095559340 12:43547338-43547360 CAGTAGATACTGGAGGGGGAGGG + Intronic
1096571111 12:52523869-52523891 CTGAACAAGCGTGAGGTGGAAGG - Intergenic
1097544246 12:60978940-60978962 CTGCGGAAGCTCGAGGAGGATGG - Intergenic
1098264709 12:68706686-68706708 CTGTCCAAGCTGGAGGTGGGCGG + Intronic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099170087 12:79353589-79353611 CTGAAGAAGATGGATGTGGGTGG + Exonic
1099390708 12:82075218-82075240 CTTTGGGAGGTGGAGGTGGAAGG + Intergenic
1099411824 12:82339360-82339382 CTTTGGGAGCTGGAGGTGGGAGG - Intronic
1099924083 12:88996245-88996267 GTATAGAAGATGGAGCTGGAGGG + Intergenic
1100176728 12:92039048-92039070 CTGTAGAAGTTGGAAGGGTAAGG - Intronic
1100440068 12:94608820-94608842 GAGTAGATGGTGGAGGTGGAAGG - Intronic
1100825138 12:98467958-98467980 CTTTAGAAGGCGGAGGTGGGAGG - Intergenic
1101038885 12:100733903-100733925 CTGGAAAAGCTGGAGGTCAAGGG + Intronic
1101841649 12:108331800-108331822 CTCTAGAAGCTGGAAAAGGAGGG + Intronic
1102124189 12:110467231-110467253 CTTTGGGAGATGGAGGTGGACGG - Intronic
1102383016 12:112483623-112483645 CTGTAGAGACTGGAGGGGGCAGG + Intronic
1102535742 12:113579519-113579541 TTTTAGAAAGTGGAGGTGGATGG + Intergenic
1102902494 12:116649077-116649099 CTTTGGAAGGTGGAGGTGGGAGG + Intergenic
1104011098 12:124930765-124930787 CACTAGAAGCTGGGGGTGGGAGG - Intergenic
1105108274 13:16571372-16571394 CTGTAGTATCTGGAAGTGAACGG + Intergenic
1105319185 13:19301006-19301028 CTGTAGAAGCTGCTGGTAGTGGG + Intergenic
1105521210 13:21132432-21132454 CTCAGGAAGCTGGAGGTGGGAGG - Intergenic
1105666853 13:22569160-22569182 CTTTGGAAGGTGGAGGCGGACGG - Intergenic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1105870970 13:24505991-24506013 CTGTAGGAGTGGGAGGTGAAAGG - Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106819700 13:33451121-33451143 CTTTAGGAGATAGAGGTGGAAGG - Intergenic
1107898286 13:44987904-44987926 TTGTAGAAGATGGGGGAGGAGGG - Intronic
1109133893 13:58624029-58624051 CTGAAGAAGATGGAGGTAAATGG - Intergenic
1110206816 13:72924476-72924498 CTGTAGGAGGCTGAGGTGGAAGG + Intronic
1110618379 13:77567208-77567230 CTTTAGGAGGTGGAGGCGGATGG + Intronic
1110633520 13:77737845-77737867 CTTTAGAAACTGGAGTGGGAAGG + Intronic
1111255469 13:85661922-85661944 CTGAAGGAGCTGAAGTTGGAAGG - Intergenic
1111855012 13:93626556-93626578 CTTTAGGAGGTGGAGGTGGGTGG + Intronic
1112809294 13:103199189-103199211 CTCACGAAGCTGCAGGTGGAGGG - Intergenic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1112927368 13:104693189-104693211 CTGAAGCAGCTGGAGGTGATTGG - Intergenic
1114456649 14:22859185-22859207 CTCTAGAAGGTCGAGGTGGGAGG + Intergenic
1115078121 14:29415635-29415657 CTGCAGAAGTGGGTGGTGGATGG + Intergenic
1116590799 14:46769851-46769873 CTGTAGAGGTTGGTGGGGGAAGG - Intergenic
1118038360 14:61892299-61892321 GAGTAGCAGCTAGAGGTGGAGGG - Intergenic
1118217311 14:63821508-63821530 CTTTAGGAGGTTGAGGTGGATGG + Intergenic
1118382774 14:65230964-65230986 CTTTGGAAGGTGGAGGTGGGCGG + Intergenic
1118594182 14:67423359-67423381 ATGAAGAAGCTGGCTGTGGAGGG - Intergenic
1119274141 14:73338111-73338133 CTGTAGAGGTTGGGGGTGGGGGG - Intronic
1119354381 14:73993227-73993249 CTTGGGAAGCTGGAGGTGGGAGG + Intronic
1120631991 14:86902818-86902840 CAGTAGAAGCGGGAGGGGGAGGG + Intergenic
1121246292 14:92463189-92463211 CTGAAGAAGATGGGGGTGGATGG - Intronic
1121329167 14:93039266-93039288 CTGTAGAACAAGGAGGTGGGGGG - Intronic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122785537 14:104161741-104161763 CTATAGAAGCAGGAGGCGCAGGG + Intronic
1122987316 14:105218457-105218479 CAGACGAAGCTGGAGGTGGCTGG - Intronic
1202839784 14_GL000009v2_random:111105-111127 CTTTAGAAGCTGTTGGTGGGAGG - Intergenic
1202909162 14_GL000194v1_random:101245-101267 CTTTAGAAGCTGTTGGTGGGAGG - Intergenic
1202884105 14_KI270722v1_random:87972-87994 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
1123426271 15:20172890-20172912 CTTTAGAAGGTCGAGGTGGGAGG + Intergenic
1123433356 15:20236872-20236894 CTTTGGGAGGTGGAGGTGGAAGG + Intergenic
1123535504 15:21179417-21179439 CTTTAGAAGGTCGAGGTGGGAGG + Intergenic
1125615441 15:41007928-41007950 CTGTGGAAGGTCGAGGTGGGTGG + Intronic
1126105444 15:45144138-45144160 CTGTGGAGGCTGCAGCTGGATGG - Exonic
1126706546 15:51411219-51411241 CTTTATAAGCTGGAGGTGTAAGG - Intergenic
1127887020 15:63210557-63210579 GTTGGGAAGCTGGAGGTGGAAGG - Intronic
1128177671 15:65570525-65570547 CTGAAGAAACAGGAGGTTGAAGG + Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128483007 15:68055217-68055239 CTGTAGCTGATGGAGGTGAATGG + Intronic
1128502546 15:68237377-68237399 CTGAGGAAGCTGAAGCTGGAGGG + Intronic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1130018646 15:80208394-80208416 CTGCACATGCTGGGGGTGGAAGG + Intergenic
1132283390 15:100640594-100640616 GGGTAGAAATTGGAGGTGGAGGG - Intronic
1132807088 16:1779856-1779878 CTGCAGGAGCTGGAGGCGGGCGG + Intronic
1134208119 16:12253956-12253978 ATGTGGATGCTGGAGCTGGAAGG + Intronic
1134559699 16:15197773-15197795 CATTAGAAGCTGGAGCTGTAAGG + Intergenic
1134920238 16:18109384-18109406 CATTAGAAGCTGGAGCTGTAAGG + Intergenic
1135434933 16:22420526-22420548 CTGTGGATGCAGGAGATGGACGG - Intronic
1135591299 16:23706765-23706787 ATGTAGAGGCGGGGGGTGGAGGG + Exonic
1136509066 16:30724680-30724702 CTGGAGAAGCTGGAGCCAGAGGG - Exonic
1136689465 16:32018586-32018608 CTTTGGAAGGTGGAAGTGGAAGG + Intergenic
1136790054 16:32962128-32962150 CTTTGGAAGGTGGAAGTGGAAGG + Intergenic
1136857977 16:33676607-33676629 CTTTAGAAGGTCGAGGTGGGAGG - Intergenic
1136879759 16:33891808-33891830 CTTTGGAAGGTGGAAGTGGAAGG - Intergenic
1137237428 16:46626969-46626991 TTGTAGAAGCTGGTGCTGGTGGG - Intergenic
1137789746 16:51165132-51165154 CTGTAAAAGTTGGGGGTGGGGGG - Intergenic
1137877858 16:52014343-52014365 CTTTAGGAGATGGAGGTGGGTGG + Intronic
1138271151 16:55696736-55696758 CTGTGGAAGGCTGAGGTGGAAGG + Intronic
1139604243 16:68006688-68006710 CTTTGGAAGCTTGAGGTGGGTGG + Intronic
1140070945 16:71649152-71649174 CCATAGAGGCAGGAGGTGGAGGG + Exonic
1140110341 16:71998692-71998714 CTTTGGAAGGTGGAGGTGGATGG - Intronic
1140162717 16:72515183-72515205 CTGTAGGGGGTGGAGCTGGAGGG - Intergenic
1140597294 16:76431434-76431456 CTTTGGAAGGTGGAGGTGGGGGG + Intronic
1141061207 16:80872764-80872786 CTCTGGAAGGTGGAGGTGGGAGG + Intergenic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141390820 16:83661919-83661941 CTGTAGAGCCAGGAGGTTGAGGG + Intronic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1142044116 16:87914302-87914324 CTGTGGATGCAGGAGATGGACGG - Intronic
1203092258 16_KI270728v1_random:1223591-1223613 CTTTGGAAGGTGGAAGTGGAAGG + Intergenic
1203119546 16_KI270728v1_random:1525082-1525104 CTTTAGAAGGTCGAGGTGGGAGG - Intergenic
1142631518 17:1229247-1229269 CTGCAGGAGCTGCCGGTGGACGG + Intergenic
1143001332 17:3796993-3797015 GTGTAGAAGATCGAGGTGGGGGG - Intronic
1143047220 17:4091531-4091553 CTTTAGGAGGTTGAGGTGGATGG + Intronic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143580770 17:7824386-7824408 CTGTAGAAGTGGGAGGTACAGGG - Intronic
1143993124 17:10983975-10983997 CTGTAGAAGTTGGAAGAAGAGGG - Intergenic
1145214441 17:21041978-21042000 CGCGAGGAGCTGGAGGTGGAGGG - Intronic
1145898246 17:28473370-28473392 CTGGAGGAGCTGGAGAAGGAAGG - Exonic
1146016293 17:29236472-29236494 CTTTAGAAGGCTGAGGTGGACGG - Intergenic
1146023719 17:29301297-29301319 CTTTGGGAGGTGGAGGTGGATGG - Intergenic
1146564493 17:33900731-33900753 TTGAAGAAGTTGGAGGTGGGAGG + Intronic
1146718607 17:35107015-35107037 CTGAAGCAGCTGGAGGAGGCGGG + Exonic
1147363470 17:39945485-39945507 AGGAAGAAGCTGGTGGTGGACGG - Intergenic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1147631488 17:41935151-41935173 AGGTAGAAGCTGGAGTGGGAAGG - Intronic
1147683081 17:42266629-42266651 CTGTGGAAGGTTGAGGTGGGAGG + Intronic
1148214163 17:45825373-45825395 CAGTAGTAGCGGGAGGTGGTGGG - Intronic
1148342492 17:46881652-46881674 ATTGAGCAGCTGGAGGTGGAGGG - Intronic
1148750731 17:49944468-49944490 CTGAGGAGCCTGGAGGTGGAGGG - Intergenic
1149116639 17:53105234-53105256 CTGTAGAAGCTGGAAAAGGCAGG + Intergenic
1149200757 17:54183353-54183375 GTGCAGAAGCTGGAGTGGGATGG - Intergenic
1149399488 17:56280424-56280446 GTGTAAATCCTGGAGGTGGAAGG - Intronic
1149420851 17:56509955-56509977 CTTCAGAATATGGAGGTGGACGG + Intronic
1150266283 17:63834320-63834342 CTGGGGAGGCTGGAGTTGGATGG + Exonic
1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG + Intergenic
1150710740 17:67529041-67529063 CTGCAGACGCTGGGGGTGGCGGG - Intronic
1150801066 17:68283183-68283205 CTTTAGGAGGTCGAGGTGGATGG + Intronic
1151643211 17:75411683-75411705 CTTTAGGAGGTGGAGGTGGGTGG + Intergenic
1151717742 17:75840051-75840073 CTGCAGGAGGTGGAGGTGCACGG + Exonic
1152456278 17:80418298-80418320 CAGGAGAAGTTGGAGGGGGAAGG - Intronic
1153527944 18:6015353-6015375 TTGCAGAAGGTGGGGGTGGATGG + Intronic
1155186691 18:23393156-23393178 CTTTAGGAGCCTGAGGTGGATGG - Intronic
1156492551 18:37505007-37505029 CTGCAGTGGCTGGAGGAGGATGG - Intronic
1157278439 18:46329323-46329345 CTGGAAAAGGTGGAAGTGGAGGG - Intronic
1157648481 18:49302595-49302617 CTGTTGAAGGCGGAGGTGGGGGG + Intronic
1157671113 18:49529518-49529540 TTGAAGAAGCTGGTGGTGGGGGG - Intergenic
1158009008 18:52706993-52707015 AGGTAGAAGCTGGGGTTGGAGGG + Intronic
1158114571 18:53980309-53980331 ATGTAGAAGGTGTAAGTGGATGG - Intergenic
1159409700 18:68055233-68055255 CTGGTGATGCTGGAGGGGGAAGG - Intergenic
1159698434 18:71591282-71591304 TTGAAGATGCTTGAGGTGGAAGG + Intergenic
1160053721 18:75460242-75460264 CTCTAGAAGCTGGAAAAGGAAGG + Intergenic
1160427490 18:78788129-78788151 CTGCAGAGCCAGGAGGTGGATGG - Intergenic
1160837481 19:1131678-1131700 CTGGAGAAGCCTCAGGTGGAGGG - Intronic
1161124085 19:2546299-2546321 CTGGAGAGGCTGCAGGTGCAGGG - Intronic
1161473843 19:4473819-4473841 ATGTAGAAGCTGGTTTTGGAGGG + Intronic
1161772459 19:6238480-6238502 CTGTGGGAGCCGGAGGTGGGGGG + Intronic
1162706582 19:12559595-12559617 CTGGACAAGCTGGACGTGAAAGG + Intronic
1162849630 19:13420896-13420918 CTGTAGAAGATGGTGGGGGATGG - Intronic
1162861301 19:13507316-13507338 CTAGAGAAGGAGGAGGTGGAGGG - Intronic
1162928827 19:13945409-13945431 CTTTGGGAGGTGGAGGTGGAAGG + Intronic
1162945587 19:14041442-14041464 CTTTAGGAGGTGGAGGTGGGTGG - Intronic
1162981104 19:14240563-14240585 CTTTAGGAGGTGGAGGTGGGAGG - Intergenic
1163314011 19:16530666-16530688 CTGCAGGAGCTGGCGGTGGGAGG + Exonic
1163448676 19:17362604-17362626 CTCTGGTAGCTGGAGGTGGCTGG - Intronic
1164790572 19:30974242-30974264 GTGTGTAAGATGGAGGTGGAGGG - Intergenic
1165411696 19:35666241-35666263 GTGGAGGAGTTGGAGGTGGAGGG - Intergenic
1165910261 19:39221550-39221572 GAGTAGAAGCTGGAGGGGTAGGG + Intergenic
1166547700 19:43643606-43643628 CTGGAACAGCTGGAGATGGAGGG + Intergenic
1167019176 19:46861312-46861334 ATGGAGGAGCTGGAGGGGGAGGG + Intergenic
1167146103 19:47681375-47681397 CTGTGGCAGCTGGGGGGGGAAGG + Intronic
1167444158 19:49527740-49527762 CTAGAACAGCTGGAGGTGGACGG + Exonic
1167588308 19:50387646-50387668 GTGCTGAAGCTGGAGGAGGAAGG - Intronic
1167660924 19:50795584-50795606 CTGTAGAAGCTGAAACAGGAGGG - Intergenic
1168354704 19:55693970-55693992 CTTTGGAAGCTCGAGGTGGGTGG + Intronic
1168379076 19:55905113-55905135 CTGTGGAAGGTGCAGGTGCAAGG + Intronic
1168564014 19:57407658-57407680 CTTTGAAAGGTGGAGGTGGAAGG - Intronic
1202652609 1_KI270707v1_random:20577-20599 CTTTAGAAGCTGTTGGTGGGAGG - Intergenic
1202659523 1_KI270708v1_random:55106-55128 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
925459853 2:4051540-4051562 CTTTGGAAGGTGGAGGTGGAAGG + Intergenic
925674532 2:6346954-6346976 CTGAATTACCTGGAGGTGGAAGG + Intergenic
926111662 2:10187823-10187845 CTGCAGAAGCAGGAAGCGGATGG - Intronic
926429102 2:12767703-12767725 CTGAGGAAGATGGAGGTGGTAGG - Intergenic
927391461 2:22600133-22600155 CTGTGGAACTAGGAGGTGGAGGG + Intergenic
927713440 2:25339643-25339665 CGGTAGAACCTGGAGGCAGAGGG + Intronic
927839177 2:26427357-26427379 CTTTGGAAGGTGGAGGTGGGTGG - Intronic
927848717 2:26485682-26485704 CGGTAGAAGGTGGAAGAGGAGGG - Intronic
927927401 2:27023589-27023611 CTGGAGAGTCGGGAGGTGGAGGG - Intronic
927992445 2:27457739-27457761 CTGCAGGAGCTGGAGGCTGAAGG - Exonic
928066114 2:28166131-28166153 CTGTAGAGGCTGGAAGTCTAAGG - Intronic
928618263 2:33061020-33061042 TTGTAGAAACTGGAGTTGGTAGG + Intronic
928720041 2:34109937-34109959 CTGTAGATGCTGGGGGCGGGCGG - Intergenic
929388730 2:41442904-41442926 CTGGAGGGGCTGGAGGTGGAGGG - Intergenic
929904336 2:46033059-46033081 ATGTAGAAGCATGAGTTGGATGG + Intronic
929925199 2:46201816-46201838 CTGAAGAAGGTGGGGGTGGAGGG + Intergenic
930468473 2:51783167-51783189 CTGGAGCAGCTGGAGAGGGAGGG - Intergenic
930491848 2:52083688-52083710 CTGAAGAAGGTGGGGGTGGGAGG - Intergenic
931778028 2:65556677-65556699 TTGCGGAAGCAGGAGGTGGATGG + Intergenic
932296617 2:70629163-70629185 CTTTAGGAGGTGGAGGTGGGTGG + Intronic
932453920 2:71834251-71834273 CTGGAGCTGCTGGAGGAGGATGG + Intergenic
932570048 2:72933826-72933848 CGGCAGAAGCTGGAGGAGGAAGG + Exonic
932739185 2:74278908-74278930 CTGTAGGAGCTGCAGATGGCTGG - Intronic
932843278 2:75105365-75105387 TTCTAGGGGCTGGAGGTGGAGGG + Intronic
932912857 2:75822511-75822533 CTTTGGAAGGTGGAGGTGGGTGG - Intergenic
933510683 2:83237693-83237715 ATTTAGAAGCTGGAGATGAATGG + Intergenic
935679602 2:105624603-105624625 CTCTAGAAGCTGGAAAAGGAGGG - Intergenic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
937202244 2:120211297-120211319 GGGTAGAAGCTGGAGGAGGTTGG - Intergenic
937584186 2:123525968-123525990 CTTTGGAAGGTGGAGGTGGGAGG - Intergenic
938074893 2:128326535-128326557 CTGCAGAAGAGGGAGGTGGCAGG + Intergenic
939365831 2:141229994-141230016 CTGTAGAAAGTAGATGTGGAAGG - Intronic
939439352 2:142224235-142224257 TGGCAGAAGCTTGAGGTGGAGGG - Intergenic
939605610 2:144251950-144251972 CTTTGGGAGGTGGAGGTGGAAGG + Intronic
940255572 2:151724668-151724690 CTGTAGAACCTATGGGTGGATGG - Intronic
940426437 2:153536385-153536407 CTGTCCAATCTGGAGGAGGAGGG + Intergenic
940922433 2:159323557-159323579 CTTTAGGAGGTGGAGGTGGGCGG + Intronic
941126883 2:161594894-161594916 CTGTAGAAACTGTAGGTCCAGGG + Intronic
941666395 2:168247391-168247413 CTGGGGAAGCTGGACGTGCACGG + Exonic
941779306 2:169427001-169427023 CCGGAGAAAGTGGAGGTGGAGGG + Intergenic
941904478 2:170707621-170707643 CTTTGGGAGGTGGAGGTGGACGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942974278 2:181996270-181996292 CTGTGAAAGCCAGAGGTGGAGGG + Intronic
943220759 2:185102570-185102592 CTTTAGGAGGTGGAGGTGGATGG + Intergenic
944707327 2:202304178-202304200 CAGTAAAAGCTGTTGGTGGATGG + Intergenic
944925218 2:204457208-204457230 CTTTGGAAGGTTGAGGTGGAAGG - Intergenic
944932361 2:204532736-204532758 CTGTAGGAGATAGATGTGGAAGG + Intergenic
944965102 2:204922366-204922388 TTGTGGAAGCTGGTGGTAGAAGG + Intronic
946022495 2:216650642-216650664 CTGTGGTAGCTGCAGGTGGAGGG + Intronic
946771388 2:223092472-223092494 CTGAAGAAACTGGAGCTGAAGGG - Intronic
946951995 2:224886340-224886362 CTGTAGTAGCTGTTGGTGGTAGG - Intronic
1168856361 20:1011984-1012006 CTGTAGAACCTGGTGGTACAGGG + Intergenic
1169184533 20:3603188-3603210 CTGTGGTAGCTGGTGGTAGAAGG + Intronic
1170370627 20:15644253-15644275 GTTTAGATGCTGGAGGTGGTGGG - Intronic
1170960345 20:21020100-21020122 CTGTGGAAGCTGGCTGTGGGAGG - Intergenic
1171231052 20:23485485-23485507 CTCTAGAAACTGGAGGGGGAAGG + Intergenic
1171576971 20:26339867-26339889 TTGTAGAATCTGCAAGTGGATGG + Intergenic
1172012102 20:31851519-31851541 CTGAAGATGGTGGAGGTGAAGGG + Intronic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172699757 20:36845825-36845847 CTGAAGGAGCTGGGGGTGGGGGG + Intronic
1172734088 20:37112885-37112907 TTGGAGAAGTTGGAGGAGGAGGG - Intronic
1173674583 20:44822631-44822653 CTGTGGGAGCTCGAGGTGGGTGG - Intergenic
1173738543 20:45378986-45379008 CTGTGGGAGGTGGAGGTGGGCGG - Intronic
1173899969 20:46580580-46580602 CAGTAAAAGCCAGAGGTGGAAGG + Intronic
1174171110 20:48618749-48618771 CTGAAGGAGCTGAAGGGGGAAGG - Intergenic
1174372615 20:50102850-50102872 CTGGTGTAGCTGGAGGAGGATGG - Intronic
1174433530 20:50488930-50488952 CTTTAGAAGCTGGAAATGGCAGG - Intergenic
1174701724 20:52616267-52616289 AAGTAGAAGATAGAGGTGGAAGG + Intergenic
1174883327 20:54304490-54304512 CTTTGGAAGGTGGAGGTGGGTGG - Intergenic
1175340839 20:58228237-58228259 CTGGAGCCGCTGGAGGTTGAAGG + Exonic
1175503165 20:59464499-59464521 GTGAAGAAGCTGCAGGTGGCTGG - Intergenic
1175693074 20:61079966-61079988 GGAAAGAAGCTGGAGGTGGAAGG - Intergenic
1175726105 20:61319700-61319722 CTTTGGGAGGTGGAGGTGGATGG + Intronic
1175939942 20:62533291-62533313 CTGGACAGGCTGGACGTGGAGGG - Intergenic
1175992821 20:62797853-62797875 CTGTGGCAGCAGGAGGTGGTGGG + Intronic
1176020248 20:62959008-62959030 CTGCAGGAGCTGGAGGAGGAGGG + Intronic
1176218163 20:63957882-63957904 CTGGAGGAGCCGGAGGTGGAGGG - Exonic
1176599543 21:8779077-8779099 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
1176628516 21:9115958-9115980 CTTTAGAAGCTGTTGGTGGGAGG - Intergenic
1178750394 21:35297175-35297197 CAGCAGAAGCGGGAGATGGAGGG - Intronic
1178790411 21:35694460-35694482 TTGTAGAGGCTGCAGGTGGGAGG - Intronic
1179479929 21:41670532-41670554 CTGCAGCAACAGGAGGTGGAGGG + Intergenic
1179885426 21:44312273-44312295 CTGGAGGAGCTGGTGGCGGAAGG + Exonic
1180008569 21:45034770-45034792 GTGCAGAAGGTGGAGGTGGGAGG + Intergenic
1180255179 21:46622024-46622046 CTGCAGAACCTGGAGCTGGCAGG + Intergenic
1180326991 22:11438667-11438689 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
1180378628 22:12117488-12117510 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
1180418893 22:12795829-12795851 CTTTAGAAGCTGTTGGTGGGAGG - Intergenic
1180676021 22:17587165-17587187 GTGTAGGACCTGGAGGTGGAGGG - Exonic
1180692637 22:17730016-17730038 GGGTATAAGTTGGAGGTGGAAGG - Intronic
1180709725 22:17831612-17831634 GTTTAGAAACTGGAAGTGGAAGG - Intronic
1181733887 22:24867079-24867101 CAGTAGACGCTGGAAGCGGACGG - Exonic
1182144714 22:27990361-27990383 CTTTAGGACCTTGAGGTGGATGG + Intronic
1182560812 22:31157596-31157618 CTGTAGAAGCCCAAGGTGGGAGG + Intergenic
1182663030 22:31938444-31938466 CTGAACAAGCTGGAGGGGGGCGG + Intronic
1182848341 22:33450153-33450175 CTTTGGGAGGTGGAGGTGGATGG - Intronic
1182880710 22:33730936-33730958 CTTTAGGAGGTGGAGGTGGGTGG - Intronic
1182883804 22:33756291-33756313 CAGTAGGTGCTAGAGGTGGAAGG + Intronic
1182994325 22:34798856-34798878 CTGCAGTAGCTGGGGGAGGAGGG + Intergenic
1183063264 22:35348080-35348102 CTGTAGATGGTGCAGGCGGAAGG + Intergenic
1183934846 22:41256190-41256212 CTGGAGAAGCTGGACCTGAATGG - Exonic
1184198601 22:42949047-42949069 CTTTGGGAGGTGGAGGTGGAAGG + Intronic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184585841 22:45447616-45447638 ATGGAGAAGCTGGAGGAGAAGGG - Intergenic
950673747 3:14542040-14542062 CTGAAGAGGCTGTAGATGGAGGG - Exonic
950732837 3:14977165-14977187 AAGTAGAAGCTGGAGGCAGATGG - Intronic
952254486 3:31683729-31683751 CAGTAGAAGCAGGAGATGGGTGG + Exonic
953072860 3:39540031-39540053 CTTTAGAAGCGAGAGGTTGAGGG + Intergenic
953099905 3:39813631-39813653 CTGCAGTGGCCGGAGGTGGAGGG + Intronic
953287861 3:41630264-41630286 GTCTGGAGGCTGGAGGTGGAGGG + Intronic
953422373 3:42764511-42764533 CTGCAGCATCTGGAGGTGGCAGG - Intronic
954524381 3:51256836-51256858 CTTTGGAAGGTGGAGGTGGGTGG - Intronic
954620390 3:51992143-51992165 ATGTACAAGCTGGAGGCTGAGGG + Intergenic
955412565 3:58665272-58665294 GGGTAGTAGCTGGTGGTGGAAGG - Intronic
955560881 3:60189224-60189246 ATTTAGAAGCTGGGGGTGGGGGG + Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
956121978 3:65975510-65975532 CTTTGGAAGGTGGAGGTGGGCGG + Intronic
957187977 3:76967448-76967470 CTTTGGGAGGTGGAGGTGGATGG - Intronic
958461613 3:94405034-94405056 CTGTAGAAACTGGAGGTCCAGGG + Intergenic
959407431 3:105977373-105977395 TTGGAGAAGCAGGAGGTAGATGG - Intergenic
960065035 3:113362385-113362407 CTGCAGCAGCTTGATGTGGAGGG + Intronic
960726029 3:120671084-120671106 CTGAAGAAACTGGAGGACGAAGG - Intronic
961763543 3:129189874-129189896 CTTTGGAAGGTGGAGGAGGATGG - Intergenic
962967904 3:140371276-140371298 GGGTAGAGGCTGGAGCTGGAAGG + Intronic
964590768 3:158360550-158360572 CGGCTGAAGCTGAAGGTGGAGGG - Intronic
964881499 3:161428356-161428378 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
965242312 3:166217669-166217691 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
965266662 3:166552296-166552318 CTTTGGAAGGTGGAGGTGGGCGG + Intergenic
966855832 3:184193357-184193379 ATGTAGAAGTTGGGGCTGGAAGG - Exonic
967356873 3:188581660-188581682 CTGTAGAGGCTGCAGCTGAATGG - Intronic
968555031 4:1242552-1242574 CTCTGGAAGCTGGAGATGGTCGG - Intronic
968563424 4:1296647-1296669 GAGTAGTAGCTGGAGGAGGACGG - Intronic
968974407 4:3813609-3813631 CTGGAGAGGATGGAGGTGGCAGG + Intergenic
969099610 4:4759008-4759030 GTGAAGAAGCTGGAGGAGGTTGG + Intergenic
969565090 4:7972609-7972631 CAGTGGAAGCTGGAGGTGTTGGG - Intronic
972469457 4:39389713-39389735 CTTTAGGAGGTGGAGATGGAAGG - Intergenic
973024455 4:45249986-45250008 CTGTAAAAGATGGTGTTGGAAGG - Intergenic
973067100 4:45808709-45808731 CTTTACAAGCTCGAGGTGGTTGG + Intergenic
973362894 4:49181448-49181470 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
973398205 4:49615406-49615428 CTTTAGAAGCTGTTGGTGGGAGG - Intergenic
973571092 4:52240472-52240494 CTGAAAAAGAAGGAGGTGGAGGG - Intergenic
973804603 4:54513708-54513730 CTGGATAAGATGGAGGTGCATGG + Intergenic
974615526 4:64274336-64274358 AAGTAGAAACTGGAGGTAGAAGG + Intergenic
974769349 4:66390473-66390495 CTATAGAATATAGAGGTGGATGG + Intergenic
974794475 4:66730813-66730835 CTTTAGAAGCTGCAGATGAATGG + Intergenic
975395683 4:73870430-73870452 CTCTAGAGGCTGGAGGAGCAGGG + Intronic
977753277 4:100634840-100634862 CTCTAGATGCTGGAGGAGGGAGG + Intronic
977991471 4:103447535-103447557 CTGGAGAGGCTGGAGGAGGCAGG + Intergenic
978840702 4:113208744-113208766 CTTTGGGAGGTGGAGGTGGAAGG - Intronic
979533000 4:121789055-121789077 CTGCAAAAGATGGAGGTGGTAGG - Intergenic
980956273 4:139432187-139432209 CTTTAGGAGGTGGAGGTGGGTGG - Intergenic
981295430 4:143125856-143125878 CTCTGGAAGGTGGAGGAGGAAGG - Intergenic
981986418 4:150862731-150862753 CTTTAGGAGGTGGAGGTGGGTGG + Intronic
982175137 4:152699101-152699123 GTGTGGAAGTTTGAGGTGGATGG - Intronic
982329542 4:154165739-154165761 CTTTGGAAGGTGGAGGTGGGTGG + Intergenic
984345898 4:178524587-178524609 CTCTAGAAGCTGGAAAAGGAAGG + Intergenic
985046511 4:185946278-185946300 ATGTAGAAGTTGGAGGAGGCAGG + Intronic
1202760246 4_GL000008v2_random:102955-102977 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
985725692 5:1514803-1514825 CTGTTTTGGCTGGAGGTGGAAGG - Intronic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
985913510 5:2900766-2900788 CTGGAGAGGATGAAGGTGGAGGG - Intergenic
986130177 5:4922907-4922929 ACGTACAAGCTGCAGGTGGATGG + Intergenic
986320841 5:6631906-6631928 TTGGAGGACCTGGAGGTGGACGG - Exonic
988235237 5:28535378-28535400 TACTAGAAGCTGGAGGAGGAAGG + Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988836932 5:35042770-35042792 GTGTAAGAGATGGAGGTGGAGGG + Intronic
988980654 5:36564779-36564801 CTTTGGAAGGTGGAGGTGGGTGG + Intergenic
990414602 5:55574248-55574270 CTTTAGGAGGTGGAGGTGGGTGG - Intergenic
992666798 5:79018280-79018302 CTTTGGGAGGTGGAGGTGGAAGG - Intronic
993440302 5:87948785-87948807 CTGTAGAAGCTGAAGGCTTACGG - Intergenic
993877094 5:93320125-93320147 CTGTAGTAGCTGAATGTGGAAGG + Intergenic
996471919 5:123871260-123871282 TTGGAGAAGCTGGAGAAGGAAGG + Intergenic
997419087 5:133751644-133751666 CGGTAGCAGATGGAGGGGGAGGG + Intergenic
997719614 5:136067036-136067058 CTCCAGGACCTGGAGGTGGAAGG + Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
998499038 5:142616004-142616026 CTGGAGAAGGTGGAGATGCATGG - Intronic
999055177 5:148567166-148567188 TTGTAGCAGCTTCAGGTGGATGG - Intronic
999401288 5:151266233-151266255 CTTTGGGAGGTGGAGGTGGAAGG + Intronic
999817887 5:155196046-155196068 CTCTAGAAGCTTAAGTTGGAAGG - Intergenic
1000263745 5:159615314-159615336 CTCTAGAGGCGGGAGGGGGAGGG - Intergenic
1000614888 5:163415769-163415791 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1000727754 5:164792851-164792873 TTGTAGAGGTTGGGGGTGGAAGG - Intergenic
1001047093 5:168382550-168382572 CTGTGCCAGCTGGAGGTGTAGGG + Intronic
1001106535 5:168859157-168859179 CGGCAGAAGCAGGGGGTGGAGGG + Intronic
1001699076 5:173693813-173693835 CACCAGAAGCTGGAGGAGGAAGG + Intergenic
1002058475 5:176612142-176612164 CGGCACCAGCTGGAGGTGGATGG - Intergenic
1002078193 5:176722124-176722146 CTTTGGAAGCTGGAGGCGGGCGG - Intergenic
1003033242 6:2620840-2620862 GTGTAGAGGCCCGAGGTGGAGGG + Intergenic
1003091594 6:3108540-3108562 CAGTGTAAGCTGGAGGTGGTGGG + Intronic
1003226694 6:4212390-4212412 TTGCAGTAGCTGGAGGAGGAAGG - Intergenic
1004166131 6:13258112-13258134 CTTTGGAAGCCCGAGGTGGATGG + Intronic
1004455420 6:15787405-15787427 TTCTAGAGGCTGGGGGTGGAGGG + Intergenic
1005017489 6:21387880-21387902 CTGTTGAGGCTGCAGGTGAAAGG + Intergenic
1006133486 6:31882432-31882454 AGGTAGAGGGTGGAGGTGGAGGG + Intronic
1006648612 6:35532924-35532946 CTTTGGAAGGTGGAGGTGGGAGG - Intergenic
1006834740 6:36991001-36991023 CAGCAGAAGCTGGAGGTCCAGGG - Intergenic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007398299 6:41589684-41589706 CTGAAGAGCCTGGCGGTGGAGGG + Intronic
1007619254 6:43201981-43202003 AGGTAGAAGAAGGAGGTGGAAGG + Intronic
1009344833 6:62600562-62600584 ATGAAGAAGTTGGAGGAGGAAGG - Intergenic
1009960088 6:70509188-70509210 CTGTGGAAGGTGGAGGTGGGAGG + Intronic
1010806587 6:80244191-80244213 CTGGTGAAGCAGGAGATGGAAGG + Intronic
1010941562 6:81924802-81924824 GTGGAGAAGGAGGAGGTGGAAGG + Intergenic
1011634477 6:89358252-89358274 CTTTGGGAGGTGGAGGTGGAGGG + Intergenic
1012896311 6:104953657-104953679 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1013872683 6:114785812-114785834 ATGTAGAAGCTGGACATGGCAGG - Intergenic
1014602724 6:123434941-123434963 CTGGGGAAGTTGTAGGTGGATGG - Intronic
1014815253 6:125928226-125928248 CTTTAGAACTTGGTGGTGGAGGG + Exonic
1014822798 6:126011532-126011554 ATGAAGAAGCTGGGGGTAGATGG - Intronic
1015367201 6:132409451-132409473 CTTTAGAAGGTTGAGGTGGGAGG + Intergenic
1015389705 6:132667827-132667849 CTGAAGAAAGGGGAGGTGGAAGG - Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016425869 6:143935124-143935146 CTGCAGATGCTGGTGGTGGTGGG + Intronic
1016519855 6:144934840-144934862 CTTTAGAAGATTGAGGTGGGTGG + Intergenic
1016580353 6:145622756-145622778 GTGTAGAAGTTGGAGATGAAAGG - Intronic
1016838227 6:148501074-148501096 CTGTCGAAGCTGGAGGCAGGAGG - Intronic
1017025130 6:150174719-150174741 CTTTGGGAGGTGGAGGTGGACGG + Intronic
1017055060 6:150429389-150429411 GGGTAGAAGCTGGAGAGGGAGGG + Intergenic
1017446338 6:154510298-154510320 CTGTGGCAGCTGGAGGGAGAGGG - Exonic
1017652473 6:156596001-156596023 CTGGAGGAGCTGGAGGTTGTAGG + Intergenic
1017827894 6:158095901-158095923 CTGCAGGACCTGCAGGTGGAAGG - Exonic
1018101433 6:160444540-160444562 CTATGGAAGCTGGAGGTAGGAGG - Intronic
1018621084 6:165730506-165730528 CTTTGGGAGCTGGAGGTGGGTGG + Intronic
1019340036 7:504602-504624 CTGCAGAGGCTGGGGGTGGGTGG - Intronic
1019372663 7:671087-671109 CTGAGGAAGAAGGAGGTGGACGG - Intronic
1019985133 7:4650149-4650171 CTTTAGAAGGTTGAGGTGGGAGG - Intergenic
1019992153 7:4699609-4699631 CTGTGGAAGCCTGAGGTGGGTGG - Intronic
1020156310 7:5727481-5727503 CTTTAGGAGGTGGAGGTGGGAGG + Intronic
1020807382 7:12807511-12807533 CTGTGGGAGGTGGAGGTGGGAGG - Intergenic
1021237739 7:18163610-18163632 CTGTAGAGGCTGGTAGGGGATGG - Intronic
1021880454 7:25090425-25090447 CTGTCAAAGCTGGGGGTGAATGG - Intergenic
1022111348 7:27234304-27234326 CTGCAGGAGCTGGAGGAGGGTGG - Intergenic
1022274648 7:28843283-28843305 CTGTAGATGATGGAGGAAGATGG - Intergenic
1022481133 7:30743903-30743925 CTGCAGGGGCTGGAGGTGGCTGG - Intronic
1022788165 7:33659905-33659927 CTGTATAAGATGAAGGTGCAAGG - Intergenic
1023055578 7:36287299-36287321 CTATATAAGAAGGAGGTGGAAGG - Intronic
1023225144 7:37961293-37961315 CAGTAAAAGCAGGAGGTGGCTGG - Intronic
1024725389 7:52188994-52189016 GTGTAGAAGCTGGGGTGGGATGG - Intergenic
1024934381 7:54698111-54698133 CTGCAGAGGCTTGGGGTGGACGG + Intergenic
1025873717 7:65460469-65460491 CTTTGGGAGGTGGAGGTGGAAGG + Intergenic
1026321328 7:69269906-69269928 CCGGAGGAGGTGGAGGTGGAGGG + Intergenic
1026729014 7:72895069-72895091 CTTTGGAAGGTGGAGGTGGGAGG - Intronic
1026843698 7:73685061-73685083 CTGTGGGAGGCGGAGGTGGACGG + Intronic
1026925537 7:74190259-74190281 CTCGAGAATCTAGAGGTGGATGG + Exonic
1027131805 7:75596627-75596649 CTTTGGAAGGTGGAGGCGGATGG - Intronic
1028107640 7:86899054-86899076 CTGAAGATGATGGATGTGGATGG + Intronic
1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG + Intergenic
1030658088 7:112190446-112190468 GTAAAGAAGCAGGAGGTGGATGG + Intronic
1030679183 7:112416203-112416225 GTGAAGGAGCTGGAGATGGAAGG + Intergenic
1030727391 7:112941077-112941099 CAGGAGAAGCGGGAGGTGAAGGG + Intergenic
1032015265 7:128375958-128375980 CTTTGGGAGGTGGAGGTGGATGG + Intergenic
1032844673 7:135742210-135742232 CTGGAGAGGCTGGAGGTGGTGGG + Intronic
1033013794 7:137650967-137650989 ATGTGGGAGCTGGAGGTGGCTGG + Intronic
1033347203 7:140534698-140534720 CTGCAGAGTGTGGAGGTGGAGGG + Intronic
1035046845 7:155973471-155973493 CTGTGGAAGGTGGAGCTGGGAGG + Intergenic
1035237558 7:157508730-157508752 CTGTTAAAGCTGGAGTTGGCTGG + Intergenic
1035293896 7:157857117-157857139 CTGGGGATGCTGGAGGGGGAGGG + Intronic
1035444552 7:158931500-158931522 CTGTAGAGGCTGGAGGGGTCAGG - Intronic
1035591903 8:822703-822725 CTGTGGAAGCTGGTGGTGTGTGG + Intergenic
1035826379 8:2648481-2648503 CTTTAGGAGGTGGAAGTGGATGG - Intergenic
1036593192 8:10187412-10187434 CGGCAGAAGCTGGTGGTGGAAGG - Intronic
1036594568 8:10200402-10200424 CTCTCAAAGCTGGAGGTGAAGGG - Intronic
1036599769 8:10249622-10249644 GTGCAGAAGCTGGTGGTGGGTGG - Intronic
1036825349 8:11971530-11971552 CTTTGGAAGGTCGAGGTGGATGG + Intergenic
1038327219 8:26580165-26580187 CTGTGGAGGCAGGAGGTGAAGGG + Intronic
1038569127 8:28644588-28644610 CTTTGGAAGCTCGAGGTGGGAGG + Intronic
1039521099 8:38172563-38172585 CTTTGGGAGGTGGAGGTGGATGG - Intronic
1039616243 8:38957005-38957027 CTGTAGGAGATGGTGGTGGTGGG + Intronic
1039912305 8:41834943-41834965 CGGGAGAAGCTGGAGGGGCAGGG + Intronic
1040616561 8:49043494-49043516 CTGTAGGTGCTGGGGGTGCAAGG - Intergenic
1041057957 8:54007083-54007105 CTTTGGAAGCTGGAGGTGGGTGG - Intronic
1041311517 8:56522365-56522387 TTGTAGAAGATGGAGGCAGAAGG + Intergenic
1043172242 8:76979899-76979921 CTGCAGAAGCTGGCGTTGAAAGG - Intergenic
1043424181 8:80132449-80132471 CTTTGGAAGCCTGAGGTGGATGG - Intronic
1044707320 8:95021218-95021240 CTGTAGAGGCCGTAGGTGGCTGG + Intronic
1044755180 8:95454162-95454184 ATGTAGGAGTTGGGGGTGGAAGG - Intergenic
1044998908 8:97863187-97863209 CTTTGGAAGGTTGAGGTGGAAGG - Intergenic
1045807393 8:106180435-106180457 CAGTAGGAGGTGGAAGTGGATGG - Intergenic
1046315173 8:112491409-112491431 CTTTAGAAAGTGGAGGTGGATGG + Intronic
1048293388 8:133197233-133197255 CTCTAGAAACTGGAAGTGGCTGG - Intronic
1048335831 8:133501502-133501524 CTTTAGAAGGTCGAGGTGGGCGG + Intronic
1049724595 8:144139802-144139824 GTGCAGAAGGTGGAGGTGGCAGG + Exonic
1050111168 9:2217906-2217928 CTGTAGAGGCTTGAGGGGGTTGG - Intergenic
1051023930 9:12582668-12582690 CTGTAGATGGAGGAGGTGGGAGG - Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1052052717 9:23866454-23866476 CTGGAGATGCTGGAGCTTGATGG - Intergenic
1052223315 9:26054197-26054219 ATGGTGAAGATGGAGGTGGAGGG - Intergenic
1053146885 9:35718113-35718135 GTAAAGAAGCTGGGGGTGGAGGG - Intronic
1055238306 9:74151601-74151623 CTAGAGAAGTTGGAGGAGGAGGG + Intergenic
1055488240 9:76777971-76777993 CTATAGCAGTGGGAGGTGGAAGG + Intronic
1055503917 9:76929160-76929182 CTCTAGAAGGTGGAGGTGGGAGG + Intergenic
1055779139 9:79800354-79800376 CTGTGGAAGCTGATGGTGGTGGG + Intergenic
1055953336 9:81751152-81751174 CTGTGGGAGGCGGAGGTGGACGG - Intergenic
1056710706 9:88990543-88990565 CTGTAGAAGCTTGGGGAGAAAGG - Intergenic
1057130598 9:92651662-92651684 AGGGAGGAGCTGGAGGTGGAGGG - Intronic
1057363930 9:94400878-94400900 CAGTGGTAGCTGGAGTTGGAGGG - Intronic
1057505969 9:95633796-95633818 CGCTTGAACCTGGAGGTGGAAGG + Intergenic
1057659406 9:96987188-96987210 CAGTGGTAGCTGGAGTTGGAGGG + Intronic
1057676083 9:97137284-97137306 CAGTGGGAGCTGGGGGTGGAGGG - Intergenic
1057925106 9:99139476-99139498 CTGTTGAAGCTGGACGATGAGGG - Intronic
1058064498 9:100533958-100533980 CTTTAGAAGGTCGAGGTGGGTGG - Intronic
1059529924 9:115026551-115026573 CGCTACAAGCTGAAGGTGGAGGG - Exonic
1059937220 9:119323166-119323188 CTGTGGAAGCTTGAGGTGAGGGG - Intronic
1060936917 9:127521464-127521486 CTGGAGCAGCTGGGGGTGGCAGG - Intronic
1061203505 9:129150328-129150350 CTGAAGAGGATGGAGGTGGCGGG + Intergenic
1061278010 9:129580663-129580685 CTCTAGAAGCTGGAAGTGCAAGG - Intergenic
1062151264 9:135020375-135020397 CCATAGAAGCTGGAGGAGGCAGG + Intergenic
1062661364 9:137636161-137636183 CTCTGGGAGCTGGAGGTGGGTGG - Intronic
1203751361 Un_GL000218v1:83637-83659 CTGTAGAAGCTGTTGGTGGGAGG - Intergenic
1203482626 Un_GL000224v1:20717-20739 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
1203541022 Un_KI270743v1:87849-87871 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
1187203133 X:17155220-17155242 CTGTAGAATCTCAAGGTGGCAGG + Intergenic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1187920556 X:24197224-24197246 CTGTAGGAAATGGAAGTGGAAGG + Intronic
1189078278 X:37941252-37941274 CTGCACAAGCTGGATGTGGTGGG - Intronic
1189313156 X:40034064-40034086 CTTTAGGAGGCGGAGGTGGACGG + Intergenic
1189646402 X:43137513-43137535 CTGTTGAAGTTGGGGGTGGGGGG - Intergenic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1193350348 X:80456642-80456664 TTGTACAAATTGGAGGTGGATGG + Intergenic
1193446451 X:81610754-81610776 TTCCAGAAGCTAGAGGTGGAGGG - Intergenic
1195574200 X:106431534-106431556 CTGAAGGGGCTGGAGGAGGAAGG - Intergenic
1195728565 X:107941932-107941954 CTTTGGGAGCTGGAGGAGGAAGG - Intergenic
1195770934 X:108350475-108350497 CTGTAGAGCTTGGAGATGGAAGG - Intronic
1196065708 X:111462020-111462042 CTCTAGAAGCTGAAAATGGAAGG - Intergenic
1197934813 X:131729286-131729308 CTGTAGAACCTGGAGAGTGAAGG - Intergenic
1197941295 X:131793030-131793052 GTGTAGAACCTGGAGATTGAGGG - Intergenic
1198370152 X:135982372-135982394 CTGAAGATGGTGGAGGTGGAGGG + Intergenic
1199147981 X:144394270-144394292 CTTTAGGAGGTGGAGGTGGGTGG + Intergenic
1200060760 X:153482727-153482749 CTGTTGACGCTGGAGGTGGAAGG + Intronic
1200085142 X:153600398-153600420 CTGCAGAAGCTGGAAGAGCAAGG - Intergenic