ID: 1190778799

View in Genome Browser
Species Human (GRCh38)
Location X:53577542-53577564
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 4, 1: 89, 2: 14, 3: 27, 4: 216}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190778799_1190778804 -4 Left 1190778799 X:53577542-53577564 CCTTCCATGGTCTCCCTCTGATG 0: 4
1: 89
2: 14
3: 27
4: 216
Right 1190778804 X:53577561-53577583 GATGCCGAGCCAAAGCTGGACGG 0: 54
1: 81
2: 38
3: 20
4: 170
1190778799_1190778803 -8 Left 1190778799 X:53577542-53577564 CCTTCCATGGTCTCCCTCTGATG 0: 4
1: 89
2: 14
3: 27
4: 216
Right 1190778803 X:53577557-53577579 CTCTGATGCCGAGCCAAAGCTGG 0: 142
1: 549
2: 481
3: 358
4: 290
1190778799_1190778807 13 Left 1190778799 X:53577542-53577564 CCTTCCATGGTCTCCCTCTGATG 0: 4
1: 89
2: 14
3: 27
4: 216
Right 1190778807 X:53577578-53577600 GGACGGTACTGCTGCCATCTCGG 0: 125
1: 829
2: 365
3: 139
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190778799 Original CRISPR CATCAGAGGGAGACCATGGA AGG (reversed) Intronic
900480798 1:2898222-2898244 CATCACAGGGGCACCATGGAGGG - Intergenic
900714732 1:4137008-4137030 CAAGAGAGGGAGAGGATGGAAGG - Intergenic
900764833 1:4497827-4497849 CCACAGAGAGAGGCCATGGAAGG - Intergenic
900813869 1:4828379-4828401 CATCTGAGCTAGACCATGGGAGG + Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901669434 1:10847004-10847026 CATCAGATGGAGACCCCAGAAGG - Intergenic
901826577 1:11865812-11865834 GTACAGAGGGAGACCATGGGAGG - Intergenic
902523781 1:17040472-17040494 CAGCAGAGTAAGACCATGCATGG - Intronic
902979471 1:20112852-20112874 CAGGAGAGTGACACCATGGAGGG - Exonic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903873639 1:26456350-26456372 CAACAGAGGGAGACCCTGTCTGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905207922 1:36353456-36353478 CAGCAGAGGGACACCAAGCACGG - Intronic
905324655 1:37142392-37142414 AAGCAGAGTGAGACCATGAAGGG + Intergenic
905513654 1:38544751-38544773 CATCAGAGAGAGCCCATGTGGGG + Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909000410 1:70210693-70210715 CAACAGAGCGAGACCCTGTAGGG + Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915342368 1:155183719-155183741 TACCAGAGGGAGACGCTGGAAGG - Intronic
915821864 1:159032391-159032413 CATTAGAGAGAGACCATGTTTGG + Intronic
916125723 1:161569208-161569230 CATCAGAGGGACACCAGGAGGGG + Intergenic
916135639 1:161651039-161651061 CATCAGAGGGACACCAGGAGGGG + Intronic
916320666 1:163499733-163499755 CAAGAGAGGGAGACCGTAGAAGG + Intergenic
916723795 1:167505073-167505095 CACCAGAGGAAGCCCTTGGAAGG - Intronic
917219749 1:172716344-172716366 CATCAGAGTGAGCCCCTGGAGGG + Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
918421261 1:184366297-184366319 AATCAGAGGAAGAGCAAGGAAGG - Intergenic
919887101 1:201942509-201942531 CCTTGGAGGGAGACCCTGGAGGG + Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922740329 1:228010770-228010792 GATGTGAGGGAGACCCTGGAGGG - Intronic
923459695 1:234197565-234197587 CATCAGGGAGTGATCATGGAGGG - Intronic
923622206 1:235588273-235588295 CCTGAGAGGGAGGCCATGGAGGG - Intronic
923814989 1:237367686-237367708 GATCAGGGAAAGACCATGGAAGG - Intronic
924440612 1:244082437-244082459 GAGCAGTGGGAGGCCATGGAAGG + Intergenic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065962873 10:30748439-30748461 TTTCAGAGGAAGACCTTGGAAGG + Intergenic
1067655334 10:48187445-48187467 CCTCAGAGGGACCCCATCGAGGG + Intronic
1068878438 10:62022697-62022719 CATTAGAGGGAGATCATCAAAGG + Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1071386176 10:85123626-85123648 CAACAAAGGGAGACCATGTTGGG + Intergenic
1071525170 10:86354214-86354236 CAGCAGAGCCAGACCATGGGTGG + Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072657068 10:97337222-97337244 CCTCAGAGGGAGGCCAGGCAGGG - Intergenic
1075223960 10:120608679-120608701 AATCAGAGGCAAAACATGGAGGG + Intergenic
1075663523 10:124214818-124214840 CTGCAGAGAGAGACCATGGGTGG + Intergenic
1075688634 10:124380533-124380555 AGTCAGAGGAGGACCATGGAGGG - Intergenic
1076116038 10:127901430-127901452 CATCTGAAGCAGGCCATGGAAGG + Intergenic
1076129192 10:128001241-128001263 CATCACATGGAAACCAGGGAAGG + Intronic
1076509216 10:131000127-131000149 CCTCAAAGAGAGACAATGGAAGG - Intergenic
1077514491 11:2993133-2993155 CATGAGAGGGAGAACAGGGCGGG - Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1079033221 11:17001116-17001138 CTTCGGAGGGTGACCAAGGAAGG - Intronic
1081292055 11:41338456-41338478 CATCTGAGGGAGAACATGAGGGG - Intronic
1081594848 11:44452074-44452096 CATCAGAGGGAGCCAAGGGGAGG - Intergenic
1082667860 11:55996609-55996631 CATAGGAGGGACACCATGGGAGG + Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083187551 11:61026471-61026493 CAACAAAGGGAGACAAAGGAGGG + Intergenic
1083592092 11:63901829-63901851 CACCAGAGGGAGAGCAGGGCAGG - Intronic
1083627357 11:64078512-64078534 CATCGGAGGGATACCCGGGAGGG + Intronic
1083904018 11:65658540-65658562 GTTGAGGGGGAGACCATGGAGGG - Intronic
1084330533 11:68427304-68427326 CCTCAGATGGTTACCATGGAGGG - Intronic
1084769063 11:71330998-71331020 CCTCAGATGGAGAGAATGGAGGG + Intergenic
1084962699 11:72725662-72725684 AATCAGAGGGAGAGCAGGGAGGG - Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1087211109 11:95447063-95447085 CATCAGAGGGAGGCCGAGGTGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088367197 11:109052255-109052277 CATGGGAGGGAGTCCAGGGATGG - Intergenic
1088976255 11:114818717-114818739 CATCAGAGGCAGAGCCTGAAAGG + Intergenic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090879384 11:130820401-130820423 AAGGACAGGGAGACCATGGATGG - Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1096773249 12:53949747-53949769 CATCACAGGGAGCACAGGGAAGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098411954 12:70195739-70195761 CAGCAGAGCCAGATCATGGAAGG - Intergenic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098761722 12:74433801-74433823 CATGAGAGGGACATGATGGAAGG + Intergenic
1101874849 12:108591413-108591435 CACCACAGGGAGGCCAAGGAGGG + Exonic
1101929968 12:109005917-109005939 GACCAGTGGGACACCATGGAAGG + Intronic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1102077698 12:110073217-110073239 CAGCAGAGAGAAGCCATGGAAGG - Intronic
1103516793 12:121513509-121513531 CATCTTAGCGAGAGCATGGATGG + Intronic
1103989122 12:124786487-124786509 CCTCAGAGCGGGGCCATGGAGGG - Exonic
1104652695 12:130548035-130548057 CACCAGAGGGTGACCAGGGCAGG - Intronic
1106549318 13:30757915-30757937 CTAAAGAGGGAGACCAGGGAGGG - Intronic
1107447802 13:40483894-40483916 CATCATAGGGAGACTAGGAAAGG - Intergenic
1109698129 13:65988370-65988392 CATCAGAGGAAGATGATGGCCGG + Intergenic
1109982256 13:69924116-69924138 CATGGGAGGGAGGCCAAGGAGGG + Intronic
1109991676 13:70066800-70066822 CATCAAAGGTAAAACATGGATGG - Intronic
1110777953 13:79432320-79432342 CATGGGAGGGAGGCCAAGGAGGG + Intergenic
1110829868 13:80018695-80018717 CATCAGAGTGAAGCAATGGAAGG + Intergenic
1110969204 13:81739769-81739791 CTTCTGTGGGAGACCAGGGAAGG - Intergenic
1113633490 13:111904240-111904262 CTTTAGAGGGAGGGCATGGAGGG + Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115662724 14:35512830-35512852 AATGAGAAGGAGACCATGCAAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1118992046 14:70806223-70806245 CATCAGAGGGTGAACATGGGCGG - Intronic
1119801838 14:77452488-77452510 AATCAGATGGGGACCAGGGATGG + Intronic
1121517852 14:94565208-94565230 CATCAGAGTGCTGCCATGGAGGG + Intronic
1121927315 14:97939603-97939625 CATCAAAGAGAGACTATGAAAGG - Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1123097546 14:105773628-105773650 CATCAGAAGGTGAGCATGGCTGG - Intergenic
1125534658 15:40436302-40436324 CTCCAGAGGGAGAGCGTGGAGGG - Intergenic
1125791062 15:42366041-42366063 TATCAGAGGGTGTCCATGGAAGG + Intronic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126824939 15:52539642-52539664 CATGAGAGGGACCCCATGGGAGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128319822 15:66685297-66685319 CGTCAGAGTGAGCCCAGGGAAGG + Exonic
1128704187 15:69826740-69826762 CAAGAGAGAGATACCATGGACGG + Intergenic
1129343921 15:74904771-74904793 CATCAGGCGGAGAGCATGCAAGG + Intronic
1130025844 15:80269750-80269772 CAGCAGAGGGAGAGCTGGGATGG - Intergenic
1131921307 15:97331751-97331773 CATGGGAGGGAGTCAATGGAGGG + Intergenic
1133080574 16:3315845-3315867 CATAGGAGCCAGACCATGGAGGG - Intronic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1133843746 16:9435450-9435472 CATCAGAAGGTGAGCATGGCTGG + Intergenic
1134375975 16:13673619-13673641 CATCAGAGTGAGACCCTGTCAGG + Intergenic
1135815394 16:25627927-25627949 GTTCTGATGGAGACCATGGAAGG - Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137559916 16:49495894-49495916 TATCAAAGGGAGACCAGGCAGGG - Intronic
1137592249 16:49700759-49700781 CAGCAGAGGGGGCCCAAGGAGGG - Intronic
1138391740 16:56675539-56675561 CCTCAGAGGAGGAGCATGGAGGG + Intronic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1139443320 16:66979875-66979897 CATCTGAGGGAGAGCAGGGCTGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139876849 16:70153016-70153038 AATCAGATGAAGACCATGGAGGG + Intronic
1140340598 16:74155907-74155929 CAGCAGAGAGACACCATAGAAGG - Intergenic
1140647348 16:77047166-77047188 CATCAGAAGAAGAAAATGGAAGG + Intergenic
1140719141 16:77755120-77755142 GATCAGAGGGAGGCCATCGTTGG + Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143555576 17:7657655-7657677 CTGCAGAGAGAGACCATGGTAGG - Exonic
1144793670 17:17876728-17876750 CATCAGTGGGAGGGCAAGGATGG + Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1147201361 17:38804023-38804045 CAACAGAGTGAGACCTTGTAGGG + Intronic
1149658719 17:58323704-58323726 CATCAGCTGGAGACAATGGGAGG - Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152104020 17:78318534-78318556 CATCAGAGGGTGACCCTGGGAGG + Intergenic
1152509442 17:80775532-80775554 CATCAGTGGGAAACCAGGGCTGG - Intronic
1152771904 17:82175207-82175229 CATGAGGGGTAGACCCTGGAAGG + Intronic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1154178202 18:12103176-12103198 CATCAGAGGGAGAGCAAGAAAGG + Exonic
1156442965 18:37210110-37210132 CATCAGCTGCAGTCCATGGATGG + Intronic
1156621532 18:38857377-38857399 CATGAGAGGGACATGATGGAGGG - Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1164603534 19:29579627-29579649 GAGCAGATGGAGACCAGGGAGGG - Intergenic
1164828049 19:31298691-31298713 CATGACATGGAGCCCATGGACGG - Intronic
1165383682 19:35497973-35497995 CAACAGAGGGAGACCCTGTCTGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167554043 19:50181819-50181841 CAACAGAGAAAGACCCTGGAGGG - Intergenic
1167647384 19:50713086-50713108 CATCTGAGGGAGAGAAGGGAGGG + Intronic
1167802316 19:51752220-51752242 AATCAGAGGGAGGCAATGAAAGG + Intronic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168220357 19:54956118-54956140 CAACAGAGGGAGAGAAAGGAAGG + Intronic
1168275350 19:55274845-55274867 CCACAGAGGGACAACATGGAGGG + Intronic
1168625000 19:57911100-57911122 CAGCAGAGGGTGGTCATGGATGG + Intronic
924970799 2:126228-126250 CATGAGAGGGAAACTGTGGAAGG - Intergenic
925130835 2:1493019-1493041 CCACAGAGTCAGACCATGGACGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928009654 2:27595107-27595129 CAACAGAGGGAGACCGAAGAAGG + Intronic
928378615 2:30799464-30799486 CCTCAGAGGAAGACTATGCAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
931697025 2:64879023-64879045 CACCAGAGGCAGAGCATGGAAGG + Intergenic
931930142 2:67122700-67122722 CATCAGAGAGATACCATGGCAGG + Intergenic
934972143 2:98772480-98772502 CACCACAGGGACACAATGGATGG + Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
937321025 2:120960843-120960865 CACCACTGGGAGACCAGGGAGGG - Intronic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941062947 2:160868782-160868804 TGTGAGAGGGAGACCATGAAAGG - Intergenic
941346031 2:164370833-164370855 CATGGGAGGGACCCCATGGAAGG + Intergenic
942319764 2:174726106-174726128 GCTAAGAGGGAGACCCTGGATGG + Intergenic
942405121 2:175646181-175646203 CTTCAGAGGGAAAGCATCGAGGG + Intergenic
942554744 2:177160191-177160213 CATCAAAGGGAGATCATGGTGGG + Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946006956 2:216533524-216533546 CCCCATAGGGAGACAATGGAGGG + Intronic
947740055 2:232480892-232480914 CTTCACAGGGAGAGCAGGGAGGG - Intronic
948000288 2:234562189-234562211 CATCAGGGGGAGACCATGGAAGG - Intergenic
949063719 2:241976410-241976432 CAGCAGAGAGAGGACATGGATGG - Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1170770960 20:19332151-19332173 TAGCAGAGGGAGTCCATGGAAGG + Intronic
1172518962 20:35555081-35555103 TACCAGATGGAAACCATGGAGGG + Intronic
1173207649 20:41007301-41007323 CATGGAAGGGAGACCAAGGAAGG - Intergenic
1173965452 20:47109138-47109160 CTTCAGGGGGAGACCCTGGATGG - Intronic
1174282089 20:49446870-49446892 CTTCAGAGGGAGATGAGGGATGG - Intronic
1175884927 20:62284394-62284416 CAACAGAGGGAGACCCTGCCTGG - Intronic
1177255237 21:18652888-18652910 CAACAGAGAGAGTCCATGAAGGG - Intergenic
1178027347 21:28483306-28483328 CATCAGAAGGAGACTCAGGATGG + Intergenic
1178109693 21:29357739-29357761 CATCACAGAGAGAGCAAGGATGG - Intronic
1178521032 21:33288650-33288672 CACCAGAGGGAGAGAATGGGAGG + Intronic
1178750404 21:35297230-35297252 CATGAAAGGGACAACATGGATGG - Intronic
1180013840 21:45070081-45070103 CAGAAGAGGGAGACGATGGGTGG - Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182968023 22:34541313-34541335 CATGAGAGGGACCCCATGGGAGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1185283869 22:49990568-49990590 CAACAGAGGGAGACCAGAGAGGG + Intergenic
949304696 3:2626893-2626915 CATCACAGGGATGCCATGCAAGG + Intronic
950060661 3:10069485-10069507 CATCAGAGGGAGACGGGAGAGGG - Intronic
950383015 3:12633461-12633483 CAACAGAGGGAGACCCTGTCTGG + Intronic
952273036 3:31851380-31851402 CATCAAAGGTAGATGATGGAGGG - Intronic
952753371 3:36843823-36843845 CAGCAGAGGGCGAGCAGGGAGGG - Intronic
953827855 3:46269583-46269605 CACCAGAGGGTGAGGATGGATGG - Intergenic
953907271 3:46874651-46874673 CAGCAGCGGGAGCCCATGCAGGG + Intronic
954166627 3:48764604-48764626 CAACAGTGGGAGAACATAGAAGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954929286 3:54266885-54266907 CCTCTTAGGGAGAGCATGGAGGG + Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959960707 3:112294926-112294948 CCTCAGTTGGAGACCATGTAGGG - Intergenic
960012602 3:112849656-112849678 CACCAGAGAGAAACTATGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961355704 3:126338788-126338810 CAGCTGAGGGAGGCCAGGGAAGG - Intergenic
961647776 3:128401529-128401551 CATCAGAGTGTGAGCATGGCAGG + Intronic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967671297 3:192238456-192238478 CAGCAGGGGGAGACAATGGGTGG + Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968852966 4:3095498-3095520 CATCAGAGGGAGACTGTGCGAGG + Intronic
969196850 4:5569875-5569897 CAGTGGAGGGAGGCCATGGATGG - Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
972198151 4:36679195-36679217 CAGGAGAGAGAGACCATGCAGGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
972665442 4:41160650-41160672 GGTGAGAGGGAGACCAGGGAAGG - Intronic
972702746 4:41509717-41509739 AAACAGATGGAGAACATGGAAGG + Intronic
973752177 4:54032289-54032311 CATCAGAGGGAGACCGTAGAGGG - Intronic
974231212 4:59116576-59116598 CATGAGAGGGACACAGTGGAAGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976413776 4:84747623-84747645 CATGAGAGGGACACAGTGGAAGG + Intronic
977474605 4:97489765-97489787 CTTCAGAAGGAGACCTTTGAAGG - Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978578731 4:110211820-110211842 CATCAGAGAGAGACCATGACTGG + Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
981391675 4:144197818-144197840 CAGAAGAGAGAGAACATGGAGGG - Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985802035 5:2010812-2010834 CATCAGCGGGAGACCCAGGGAGG - Intergenic
986772746 5:10988509-10988531 CCTCAGAGAGAGATCATGGAGGG + Intronic
987366873 5:17156656-17156678 CATCAGAGTGAGATCAGGGAGGG - Intronic
988100615 5:26672077-26672099 TTTCAGAGTGAGACCATGGTAGG + Intergenic
988112675 5:26843279-26843301 CAACACTGGGAGACCAAGGAGGG + Intergenic
988336914 5:29919728-29919750 CATCTTAGGAAGACCATGGATGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992738270 5:79745763-79745785 CCTCAGAGGGAAAGCATGGCAGG - Intronic
995054570 5:107744943-107744965 CATCAGTGGGAGGCCATTCAAGG + Intergenic
996385001 5:122901699-122901721 CATCCAAGGGAGAGAATGGAGGG - Intronic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000659626 5:163921171-163921193 CATGGGAGGGAGCCCATGGTTGG + Intergenic
1001316403 5:170644092-170644114 CAGCAGAGGAAGCCCATAGAGGG + Intronic
1002069231 5:176669206-176669228 CATCAGAGTGAGGCCCTGGCTGG + Intergenic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1004072254 6:12311293-12311315 CAACAGAGGGAGTCCTTGTAAGG + Intergenic
1005303987 6:24496090-24496112 CTTCAGAGGGAGAGCTTTGAAGG - Intronic
1006766372 6:36510230-36510252 CATGAGAGGGAGGCCAAGCAGGG - Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009392613 6:63163369-63163391 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1010089880 6:71968185-71968207 CATCTGAGGATGAACATGGATGG - Intronic
1011777609 6:90749140-90749162 CATTAGAGAGTGACAATGGAGGG + Intergenic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1013533782 6:111044522-111044544 GAACTGAGGGAGATCATGGAAGG - Intergenic
1014214164 6:118736840-118736862 CATCAGAGGCAGAGAAGGGAAGG + Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019779260 7:2929937-2929959 CTGCAGGGGGAGACAATGGAGGG + Intronic
1019779539 7:2931204-2931226 CAGCAGAGGGAGGCCAGGGCGGG - Intronic
1019968688 7:4522765-4522787 CATCTGTGGGAGACCTTGGTTGG + Intergenic
1021392430 7:20109891-20109913 TCTCAGATGGATACCATGGATGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1023387592 7:39675711-39675733 CAACAGAGTGAGACCATGTCTGG + Intronic
1024875150 7:54013648-54013670 CAGCTGAGGAAGACCATGGGAGG + Intergenic
1025775000 7:64553609-64553631 CATCAGAGGGAGACAGGAGAGGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1028001226 7:85500865-85500887 CATCAGAAGCTGTCCATGGAGGG - Intergenic
1028527452 7:91801530-91801552 CATGGGAGGGAGGCCAAGGAGGG - Intronic
1030062699 7:105635462-105635484 CATAAGAAGCAGTCCATGGATGG - Intronic
1031720163 7:125164657-125164679 CATGCGAGGGAGATCATGGCAGG + Intergenic
1031837070 7:126691167-126691189 CATGAGAGGGAGGCCAAGAAGGG - Intronic
1032513114 7:132487717-132487739 CATGAGAGGAAGACCCGGGAAGG + Intronic
1033185542 7:139224890-139224912 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033387783 7:140895657-140895679 CATAAGAGTGAGAACATGCAGGG + Intronic
1033825765 7:145187131-145187153 TGACAGAGGGAGACCCTGGAAGG - Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1036017404 8:4800572-4800594 CGTCAGAGGCAGAGCAGGGAAGG + Intronic
1036755775 8:11470274-11470296 GATTTGAGGGAGACGATGGAGGG + Intronic
1038538641 8:28373004-28373026 CATCAGCTGGAGACCAAAGAGGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039329655 8:36523317-36523339 TAGCAGAGGGAAACCATTGAAGG - Intergenic
1039365364 8:36923075-36923097 CATGAGAGGAGGAACATGGAGGG - Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041618187 8:59932746-59932768 TGTCAGAGGGAGACCAAGGGAGG - Intergenic
1043533113 8:81171976-81171998 GAGCAGAGAGAGACCAGGGACGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045424895 8:102055921-102055943 CATCACAGGGAGCTCATGGTCGG + Intronic
1045960395 8:107961306-107961328 CATCAGAGGGTGACCTGGGTGGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046703444 8:117426195-117426217 CAACAGAGGGAGACCAAAGAAGG - Intergenic
1048359879 8:133688597-133688619 CCTCAGAGGGGGGCCATGGCAGG + Intergenic
1049010127 8:139881920-139881942 CATCAGAGGGAGGCCCAGGCAGG - Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1053069639 9:35093496-35093518 CCACAAATGGAGACCATGGAGGG - Exonic
1058456641 9:105143725-105143747 CATGAGAGGAAGCCGATGGAAGG - Intergenic
1060079250 9:120625936-120625958 TAACAGAGAGAGACCATGAAAGG - Intronic
1060396340 9:123319441-123319463 CCTCGGAGGGAGAGCATAGAGGG - Intergenic
1061845397 9:133385338-133385360 CCTCACAGGGATACCATGGGGGG - Intronic
1062407898 9:136406110-136406132 CTACAGAGGGAGACCACAGACGG + Intronic
1185935933 X:4257282-4257304 CATGAGAGGGAGGCCAAGGAAGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189120971 X:38394639-38394661 CATTAAAGGGAGGCCATGGAGGG - Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1192584530 X:72308739-72308761 TATCAGAGGGAGACTAGGCAGGG - Intergenic
1192800825 X:74463111-74463133 CTGCAGAGGGAGAGGATGGATGG + Intronic
1194820889 X:98505695-98505717 TATCAGAGGGAGAAAATTGAGGG + Intergenic
1195244876 X:102986544-102986566 CATCACAGAGCCACCATGGAAGG - Intergenic
1196728327 X:118917214-118917236 CATCAGAAACAAACCATGGAAGG + Intergenic
1200897437 Y:8390615-8390637 TATCAGAAGGAGATCCTGGATGG + Intergenic
1201553703 Y:15246250-15246272 GAACAAAGGGAGACCATGTATGG - Intergenic
1202028601 Y:20551023-20551045 CAACAGAGGGAGACCGAAGAAGG - Intergenic