ID: 1190779561

View in Genome Browser
Species Human (GRCh38)
Location X:53580259-53580281
Sequence CTGGATCCACAGCCCAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190779558_1190779561 15 Left 1190779558 X:53580221-53580243 CCTAATACATAGCACTCAAATTT 0: 1
1: 0
2: 1
3: 23
4: 241
Right 1190779561 X:53580259-53580281 CTGGATCCACAGCCCAACCAAGG 0: 1
1: 0
2: 1
3: 12
4: 171
1190779560_1190779561 -10 Left 1190779560 X:53580246-53580268 CCAAATCTTTTATCTGGATCCAC 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1190779561 X:53580259-53580281 CTGGATCCACAGCCCAACCAAGG 0: 1
1: 0
2: 1
3: 12
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190779561 Original CRISPR CTGGATCCACAGCCCAACCA AGG Intronic
900242820 1:1625025-1625047 CTGTCTCCACATCCCAGCCACGG - Exonic
901144275 1:7054560-7054582 CGGCATGCACAGCCCCACCAGGG - Intronic
901881221 1:12194864-12194886 GTGGACCCACAGCGCAACCTTGG + Intronic
903295482 1:22340726-22340748 GTGGCTCCAGAGCCCACCCATGG + Intergenic
903646452 1:24898951-24898973 CTGGGACCACAGCCCAACAATGG - Intergenic
905235248 1:36542094-36542116 CTGCATCCACAGCTCAGGCAGGG - Intergenic
906463593 1:46056789-46056811 CTGGATTCAGGGCCCAAACAAGG - Intronic
907334132 1:53689376-53689398 CTGGAACCAGAGCCCAGCCAGGG - Intronic
908651266 1:66336069-66336091 CAGGGTCCCCAGCCCAACAACGG + Intronic
910159786 1:84260433-84260455 CTGGCTCCCCAGCCCACCCCTGG - Intergenic
912635143 1:111284920-111284942 CTGGAGCCACAGCTCAGCCTTGG + Intergenic
914345954 1:146798850-146798872 CTGGATACACACCCCAACTGGGG + Intergenic
916533130 1:165677417-165677439 CTGGTTCCAGAGCACAGCCAGGG + Intronic
918072323 1:181142029-181142051 CAGGATGCACAGGCCAACCTGGG - Intergenic
919125550 1:193388735-193388757 CTGAAGCAACAGCCCAACCTTGG + Intergenic
920097662 1:203497094-203497116 CTGAGTTCCCAGCCCAACCATGG + Exonic
921265262 1:213416550-213416572 CTGGACTCACAGCCCAGCCCCGG - Intergenic
924216182 1:241824717-241824739 CTGGAGCCACAGCTCAAAGATGG + Intergenic
924723377 1:246644577-246644599 CTGGAGCCACCGCACAACCTGGG - Intronic
1062960213 10:1567648-1567670 GTGCCTCCACAGCCCTACCAGGG + Intronic
1063848600 10:10160458-10160480 CTGGATCCAGACCCCAAGAAAGG + Intergenic
1064992287 10:21266614-21266636 GTGGATCCACGGGCAAACCAAGG - Intergenic
1068208279 10:53886308-53886330 CTGGTTACACAGCCCACTCATGG + Intronic
1070168718 10:73916520-73916542 CTGGATCCGCAGTCACACCAAGG + Exonic
1071427117 10:85570058-85570080 CCGGATCCAAGGCCCAATCAAGG + Intergenic
1072660637 10:97361498-97361520 GGGGATCCAGAGGCCAACCAGGG + Intronic
1073076297 10:100827398-100827420 CTGGCTCCACTGCCCAGCCAAGG + Intronic
1074452770 10:113572710-113572732 CTGGATCCTCAGCCCTAAAAAGG + Intronic
1078253424 11:9637243-9637265 CTTGATCCCCAGCACAACTATGG - Intergenic
1078424241 11:11236345-11236367 CTGGATTCAAATCCCAACCATGG + Intergenic
1081345274 11:41978226-41978248 CTGGATCAAGAGTCCAAGCATGG + Intergenic
1081866107 11:46361645-46361667 CTGGATCCAGAGCCCGGCCTTGG + Exonic
1083610468 11:64001832-64001854 CCAGCTCCACAGCCCAGCCACGG - Intronic
1084889183 11:72228402-72228424 CTGTACGCCCAGCCCAACCAGGG + Exonic
1087959704 11:104333248-104333270 CTTGATCAACATCCCAACCCTGG - Intergenic
1088364989 11:109031162-109031184 CTGGTTCCACAGCCCCCACAGGG - Intergenic
1089624842 11:119744836-119744858 CTTGATAGACAGCCCAGCCATGG - Intergenic
1090229490 11:125091385-125091407 ATGGAACCACAGCCCACCCTGGG - Intergenic
1091913409 12:4250341-4250363 TTTGAGCCACAGCCCACCCAGGG + Intergenic
1093916052 12:24803562-24803584 CTGCATCCTCAGCCCAAGGAGGG - Intergenic
1096638421 12:52975753-52975775 CTGGCACCTCAGCCCAACCCGGG - Intergenic
1097042756 12:56165486-56165508 CTGGAGCCACAGCCAAGCCATGG + Exonic
1100210828 12:92396951-92396973 TCAGATCCCCAGCCCAACCATGG + Intergenic
1103572815 12:121856486-121856508 CTGAACCCAGAGCCCACCCACGG + Intronic
1103820060 12:123690537-123690559 CTGCATACACTGCCCAGCCAGGG - Exonic
1103825557 12:123735371-123735393 CTGTATGCACAGCCCGACCAAGG + Intronic
1109260902 13:60144113-60144135 TTGAATCCCCAGCCCTACCATGG + Intronic
1109762327 13:66845597-66845619 CTGGATCCACAGCGCTAGCTTGG + Intronic
1112148067 13:96723664-96723686 TTGCATTCACAGCCCACCCATGG + Intronic
1114288131 14:21265273-21265295 TTGGAGCCACAGCCCAAACCTGG + Intronic
1120907659 14:89634249-89634271 CTGGGTCCAAAGGCCAACCTTGG + Intronic
1121465096 14:94110845-94110867 CTGAGCCCACAGCCCACCCAAGG - Intronic
1123041269 14:105491232-105491254 CTGGAACCTGAGCCCAATCATGG - Exonic
1125003740 15:34795878-34795900 CCGAATCCACAGACCATCCAGGG - Exonic
1126781384 15:52141890-52141912 CAGGATCCAGGGACCAACCAAGG + Intronic
1127526437 15:59797005-59797027 ATGGGTCCACAGCCCACCAAGGG + Intergenic
1130105476 15:80925607-80925629 CTGTATCTGCAGCACAACCATGG - Exonic
1132622793 16:875703-875725 CTGGACACACAGCCCAGGCAGGG - Intronic
1132635855 16:946188-946210 CTGCAACCACAGGCCAGCCAGGG + Intronic
1132831410 16:1930047-1930069 CAGGGGCCACAGCCCCACCAGGG + Intergenic
1136093084 16:27934653-27934675 CTGGAGCCACAGCTCTCCCATGG - Intronic
1136412615 16:30086038-30086060 CTGGCTTCAAAGCCTAACCAAGG - Exonic
1138016864 16:53435723-53435745 CAGGATGCAAAGCCTAACCAAGG + Intronic
1139876668 16:70151537-70151559 CTGCCTGCACAGGCCAACCATGG - Intronic
1139954146 16:70685415-70685437 CTGGATCCAAACCCCATTCATGG + Intronic
1139988028 16:70916417-70916439 CTGGATACACACCCCAACTGGGG - Intronic
1142601963 17:1057736-1057758 CTGGACCCAGAGCCCAGCCTGGG - Intronic
1143054467 17:4152471-4152493 CTGTATCCACAGCATAACCAAGG - Intronic
1143663056 17:8339150-8339172 CTGGAGCCACAGGCCAGGCAAGG + Intergenic
1144669390 17:17124451-17124473 ATGGATACACAGCTCATCCAGGG + Intronic
1145001438 17:19307802-19307824 CGGGATCCACAGAAGAACCAGGG - Intronic
1145077866 17:19870052-19870074 CTGTATTCACAGGCCAAACATGG + Intergenic
1145757848 17:27405795-27405817 TTGGATCCAGAGCTCAAACAAGG + Intergenic
1148649143 17:49237179-49237201 CTGGGTCCCCAGCCCAAGGACGG + Intergenic
1148984848 17:51612342-51612364 CTGGTACCTCAGCCCAGCCAGGG - Intergenic
1151700902 17:75742146-75742168 CTGCAGCCTCAGCCCAGCCATGG - Intronic
1152310192 17:79545318-79545340 CTTGATCCAAAACCCAAACACGG - Intergenic
1153499111 18:5730352-5730374 CTGTATCCCCAGCCCAGCCTTGG + Intergenic
1161800148 19:6412870-6412892 CTGTAGCAACAGCCCATCCATGG + Intergenic
1162516772 19:11152976-11152998 CTGGCTCCATAGGCCAATCAAGG + Intronic
1162793589 19:13075484-13075506 CTGGAGCCTCAGCCCATCCTTGG + Intronic
1163663046 19:18589748-18589770 CTGGGACCACCCCCCAACCAGGG - Intronic
1165116534 19:33532529-33532551 CTGGATCCAGACCCCAAGAAAGG - Intergenic
1166293577 19:41878304-41878326 CTGGCTCCTCAGCCCAGGCAGGG + Intronic
1166311160 19:41963341-41963363 ATGGATTCACTGCCCCACCAAGG + Intergenic
1167169142 19:47819717-47819739 CTGGATCCAGAGTCCTTCCAGGG - Intergenic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
926542108 2:14193786-14193808 CGGCATCCACTGACCAACCATGG - Intergenic
927825752 2:26309172-26309194 CTGGATACCAAGCCCACCCATGG + Intronic
928360907 2:30661630-30661652 ATGGAGTCACAGCCCAATCATGG - Intergenic
930025581 2:47027285-47027307 CTGGACCCACAGCACAAGGAGGG + Intronic
931826906 2:66009981-66010003 CTGCACCCTCAGCCCTACCATGG + Intergenic
931857461 2:66318234-66318256 GTGTATCAACAGGCCAACCAGGG + Intergenic
933688651 2:85162387-85162409 CTGGATCCACAGAGCAGCCTGGG - Intronic
934558532 2:95300265-95300287 CTGGATCCACAGTCCAAAAATGG - Intronic
935785134 2:106541883-106541905 CTGTATCCAGAGCCCAGGCATGG + Intergenic
937543618 2:122988990-122989012 CTGGGTCCATAGCCCCAACATGG - Intergenic
937969299 2:127536920-127536942 CTGCATCCACAGCTCTAGCACGG + Intronic
938310403 2:130285445-130285467 CTGGAGCCACAGGCCAAGCTGGG + Intergenic
940612332 2:156006934-156006956 CTGGGTCCACAGCCCCAGCTTGG + Intergenic
940852572 2:158702581-158702603 GTGGATCCAAAGTCCACCCATGG + Intergenic
941481363 2:166019043-166019065 CTGGATCTACAGCCCACCCATGG - Intronic
946143658 2:217712907-217712929 CTGGGGACACAGCCCAAACATGG + Intronic
948740591 2:240043486-240043508 CTGCATCCACTGCTCAACCCAGG + Intergenic
1168924966 20:1571831-1571853 CAGCATCCACAGCACAGCCAGGG - Exonic
1168928836 20:1604853-1604875 CAGCATCCACAGCACAGCCAAGG - Intronic
1168969544 20:1921579-1921601 CAGCATCCACAGCACAGCCAAGG + Exonic
1169660348 20:7972343-7972365 CAGGATCCAAATCCCAAGCATGG + Intergenic
1171348698 20:24486282-24486304 CTGGCTCCCCAGCCCAGGCAAGG - Intronic
1171442450 20:25176290-25176312 CAGGCTCCACATCCAAACCAAGG + Intergenic
1175549728 20:59809218-59809240 CTCTATCCACAGCCCCACCCCGG - Intronic
1175945113 20:62555080-62555102 CTGAACCCACAGCCCACCCCAGG + Intronic
1180002489 21:45001634-45001656 CGGGATCCACTGCCCCAGCATGG - Intergenic
1180082424 21:45493042-45493064 CTGCCTCGACAGCCCGACCAGGG - Intronic
1180207381 21:46269600-46269622 CTGGAGCCACAGATCAACCAAGG + Intronic
1181849435 22:25739599-25739621 CTGGATCCACAAAACAGCCAAGG - Intergenic
1183271360 22:36864555-36864577 CTGCACCCACAGCACAGCCAGGG + Intronic
1183377777 22:37475015-37475037 CTGTATCCTCAGCCCTAGCATGG - Intronic
1184255816 22:43286281-43286303 CTGGAACCCCAGCTCTACCATGG - Intronic
954286987 3:49626096-49626118 CTGGGTCCACAGCCCCAGCCTGG + Intronic
956002980 3:64748763-64748785 CTGGAACCATAACCCAGCCAAGG + Intergenic
961531773 3:127544464-127544486 CTGGGGCCACAGCCCTCCCAGGG - Intergenic
962023278 3:131522403-131522425 CTGGATCCAGAGCCCAACTGAGG + Intergenic
964590822 3:158360824-158360846 CTGGGTCCACAGCCCCAACTTGG + Intronic
965793208 3:172411401-172411423 CTGGATCCACAGCCACAGCTTGG + Intergenic
967134437 3:186501623-186501645 CTGTATTCTCAGCCAAACCAAGG - Intergenic
968757240 4:2423224-2423246 CTGGATCCACCTACCCACCAGGG + Intronic
973207964 4:47581876-47581898 CTTTATCTACAGCTCAACCAAGG - Intronic
976422940 4:84866521-84866543 CTTGGCCCACAGCCCATCCAGGG - Intronic
977499737 4:97823801-97823823 CTGGATCCGAGGCCCAACCTAGG + Intronic
982141471 4:152324328-152324350 CTGTCTCCACATCCCAAACACGG + Exonic
989257339 5:39379790-39379812 AGGGATCCTCAGCCAAACCATGG - Intronic
990555056 5:56924699-56924721 TTGGCTCCACACCCAAACCAGGG + Intronic
995083037 5:108076276-108076298 CAAGATCCACACCCCAGCCAGGG - Intronic
996315091 5:122152628-122152650 GTGGAACCCCAGCCCGACCAAGG + Exonic
996717604 5:126600564-126600586 CTGTATCCACTCCCCATCCACGG - Exonic
997974225 5:138429972-138429994 CTGGGAGCACAGCCCACCCAGGG - Intronic
998760360 5:145425597-145425619 CTCCATCCACATCCCAACAAAGG - Intergenic
999051212 5:148525605-148525627 ATGAATCCCCAGCCCTACCAGGG - Intronic
1001034678 5:168289322-168289344 CATGTTCCACATCCCAACCATGG + Intergenic
1001933661 5:175689853-175689875 CTGCATCCACAGCATCACCACGG + Intergenic
1002097076 5:176837698-176837720 CTAGCTACACAGCCCATCCATGG - Intronic
1002986100 6:2191470-2191492 CCGGGTCCACAGCCCCACCTGGG - Intronic
1006771451 6:36556590-36556612 CTGGATCCACAGACTAGCAATGG + Intergenic
1007281954 6:40719474-40719496 CCAGCTCCACAGCCCCACCAAGG + Intergenic
1008519353 6:52348328-52348350 CTGGTTCCAGAGCCAGACCAGGG + Intergenic
1009604335 6:65847941-65847963 CTGGATCCAGAACCCAACAGCGG + Intergenic
1011019584 6:82797305-82797327 ATGGATCCTCAGTCCAACAATGG - Intergenic
1013980342 6:116121288-116121310 CTGGAGCCCCAGGCCAGCCAGGG - Exonic
1017033798 6:150249052-150249074 CTCTAGCCACAGCCTAACCAAGG + Exonic
1018413190 6:163576925-163576947 TTGGATGCACAGTCCAACTATGG - Exonic
1019572095 7:1717777-1717799 CTGGCACCACAGCCCCACCCTGG - Intronic
1021577091 7:22114772-22114794 CTGACTCCACAGTCCTACCAGGG - Intergenic
1024606023 7:51023392-51023414 TTGAATGCACAGCCCACCCATGG - Intronic
1028316482 7:89408666-89408688 CAGCAGCCACAGCCCAACAAAGG - Intergenic
1032020357 7:128404369-128404391 CTGGGTCCCCAGCCAAAGCATGG + Intronic
1032497163 7:132371116-132371138 CCGTCTCCCCAGCCCAACCACGG - Intronic
1034481096 7:151320918-151320940 CTGGGTCCACAGCCCCAACTTGG - Intergenic
1034969785 7:155411640-155411662 CTGGAGCCACAGAGCGACCAAGG + Intergenic
1035024331 7:155816172-155816194 CTGGCTCCACATGCCAGCCATGG - Intergenic
1036916067 8:12805317-12805339 CTGCATCCTCAGCCCATCCTTGG - Intergenic
1038876730 8:31558770-31558792 GTGGCACCACAGCCCTACCAAGG + Intergenic
1044997626 8:97852209-97852231 CTGGATTCACATCCCCACCCAGG + Exonic
1046184406 8:110694048-110694070 CTGGATCCAGACCCCAAGAAAGG + Intergenic
1046909423 8:119609545-119609567 CAGGAACCCCAGCCCAACTAGGG + Intronic
1049653419 8:143787321-143787343 ATGGATCCACAGGCTAACCACGG - Intergenic
1049697862 8:143992386-143992408 CTGCGGCCACAGCCCAGCCACGG - Intronic
1049998289 9:1051373-1051395 AGGGATCCACAACCCAACAAAGG - Intronic
1050360762 9:4828888-4828910 CTGGAGCCAGATACCAACCAAGG - Intronic
1053283070 9:36834145-36834167 CTCCATCCTCAGCCCAACCTTGG + Exonic
1054925909 9:70588597-70588619 CTGGACCCACAGCCCTTCCCAGG - Intronic
1056975025 9:91245209-91245231 CTGGAACCACGGCCCACCCCAGG + Intronic
1057140836 9:92725953-92725975 ATGGAGCCACATCCCCACCAAGG + Intronic
1059212243 9:112524224-112524246 ATGGATCCAAGGCCCAACCAAGG + Intronic
1059371678 9:113844619-113844641 CTGGATCCACAAGCCATACAAGG - Intergenic
1059401120 9:114071168-114071190 CTGGGTCCACAGCCACAGCAGGG - Intronic
1060757833 9:126225841-126225863 CTGGGTCCAGAGCCCAGGCAAGG + Intergenic
1060880387 9:127113884-127113906 GTGGTGCCACAGCCCAAGCAAGG + Intronic
1062638647 9:137505530-137505552 CTGGAACCACTGCCCAACAGAGG + Intronic
1186473566 X:9839528-9839550 CTGTGTCCCCAGCCCAAGCACGG + Intronic
1188091272 X:25968281-25968303 CTGCAGCCACTGCCCAGCCAAGG + Intergenic
1190682741 X:52842064-52842086 CTGGATTAACAGCCCAACTGAGG + Intergenic
1190779561 X:53580259-53580281 CTGGATCCACAGCCCAACCAAGG + Intronic
1196130545 X:112150720-112150742 CAGTACCCACAGCCCATCCATGG + Intergenic
1199188091 X:144939852-144939874 CTGGATCCACAGCTGTAGCAGGG + Intergenic