ID: 1190784290

View in Genome Browser
Species Human (GRCh38)
Location X:53629118-53629140
Sequence TGCCTTTTGGTTTTTCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 339}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190784290_1190784293 17 Left 1190784290 X:53629118-53629140 CCTCTGGGAAAAACCAAAAGGCA 0: 1
1: 0
2: 1
3: 34
4: 339
Right 1190784293 X:53629158-53629180 TATACAGAGAACATTAATGCAGG 0: 1
1: 0
2: 1
3: 13
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190784290 Original CRISPR TGCCTTTTGGTTTTTCCCAG AGG (reversed) Intronic
900309381 1:2025975-2025997 TGCCTTTTGGTTTTTAAAATGGG + Intronic
900791098 1:4681427-4681449 TGCCTCATGGGTCTTCCCAGAGG - Intronic
902525961 1:17057682-17057704 TTGCTGTGGGTTTTTCCCAGAGG - Intergenic
904500891 1:30912305-30912327 TGCCTTGTGGGGTTCCCCAGGGG - Intergenic
905994124 1:42366189-42366211 TGACTTTTGCTTTTCACCAGGGG + Intergenic
907243838 1:53094782-53094804 GCCCATTTGGATTTTCCCAGGGG + Intronic
907710871 1:56879901-56879923 TGCCTTGTGCCTTTTCACAGAGG + Intronic
908109443 1:60880541-60880563 TGTCTTTTGGGTTTTACTAGTGG - Intronic
908758755 1:67492803-67492825 TGGGTTTTGGTTTCTCCCAACGG + Intergenic
909431017 1:75587991-75588013 TGCCTTCTGGTTTCTCACATTGG - Intronic
909637754 1:77836174-77836196 TCCCTTTTTGTTTTTCCTGGTGG - Intronic
910779073 1:90907956-90907978 TACATTTTAGTTTTGCCCAGGGG + Intergenic
911125702 1:94339340-94339362 TGCCTTCTGGTGTTCCCCAAAGG + Intergenic
911476350 1:98378170-98378192 GGTCTTTTGTTTTTTGCCAGAGG + Intergenic
911678257 1:100683883-100683905 AGCCTTTTGTTTTTACCCTGAGG + Intergenic
911866493 1:103031242-103031264 TGTTTTTTTTTTTTTCCCAGGGG - Exonic
912572530 1:110634972-110634994 TGCCTTCTGGTCCTTCCCCGGGG - Intergenic
913114612 1:115684813-115684835 TGCCTCTTCCTGTTTCCCAGGGG + Intronic
914752760 1:150547006-150547028 TGCCTTTAGGTTGGGCCCAGTGG + Intergenic
915578547 1:156798371-156798393 TTCCTTTTCTTTTTTCACAGTGG + Intronic
916349669 1:163834852-163834874 TGACTTAAGGTGTTTCCCAGGGG - Intergenic
916553993 1:165877212-165877234 TGTCTTTTTATTTATCCCAGAGG - Intronic
919406787 1:197195000-197195022 TTCGTTTTGTTTTTTGCCAGGGG + Intronic
920059328 1:203216808-203216830 TGCCTCCTGGGTTTTCCCTGGGG - Exonic
920278237 1:204824430-204824452 TTCCTAGTGGTTTTTCCCATTGG + Intergenic
920409069 1:205744229-205744251 TGGCTTTGGGTTGTTCACAGTGG + Intronic
921330557 1:214031433-214031455 AGCCTTTTGTTTTTTCCCTGTGG + Intronic
921905200 1:220488573-220488595 TGCCTTTTGGATTTCTCCAATGG + Intergenic
922855399 1:228770870-228770892 TGCAGTTTGGTGTTTCCAAGTGG + Intergenic
922896846 1:229107430-229107452 TTCCCTTTGCTTGTTCCCAGTGG - Intergenic
923961911 1:239094778-239094800 TTACTTTTTGTTTTTCCAAGAGG - Intergenic
1063057097 10:2517677-2517699 TGCCTTACTGTTTTTCACAGTGG + Intergenic
1063562202 10:7139106-7139128 TGCCTTTTTTTGTTTCCCATTGG - Intergenic
1063835294 10:10005238-10005260 TTCCTTTTGGATTGGCCCAGTGG - Intergenic
1063996507 10:11625158-11625180 TCCCCTTGGGGTTTTCCCAGGGG + Intergenic
1064437235 10:15321588-15321610 TGTCTTTTGGTTTTTCTTTGTGG - Intronic
1064672044 10:17724788-17724810 TCCCTTTTGCTTTTATCCAGGGG - Intergenic
1064694864 10:17955036-17955058 TGACTTCTGGTTATTTCCAGTGG - Intronic
1065225260 10:23537108-23537130 AGCCTCTTAGGTTTTCCCAGAGG + Intergenic
1067204142 10:44199230-44199252 TGCCTTCTTGTTTCTCCCAAAGG + Intergenic
1068514873 10:58012961-58012983 TTCCTTTTTGTTTATACCAGAGG - Intergenic
1070386728 10:75932139-75932161 TGTCTTTTGTTTTTTCCCTGTGG + Intronic
1071064733 10:81617438-81617460 TGGCTTTTGCTGTTTCCCACAGG - Intergenic
1071252831 10:83838405-83838427 TGCCTTCTGGCCCTTCCCAGTGG + Intergenic
1071427541 10:85574264-85574286 TGACTCTGGGTTCTTCCCAGGGG - Intergenic
1071480275 10:86060300-86060322 TGCTTTATGCATTTTCCCAGTGG - Intronic
1072257732 10:93636444-93636466 TGGTTTTTGGTTTTGCCGAGTGG + Intronic
1074252096 10:111761198-111761220 AGCCTTCTTGATTTTCCCAGGGG + Intergenic
1075126306 10:119702615-119702637 TGTTTTTTGTTTTTTTCCAGAGG - Intergenic
1076063952 10:127433950-127433972 TGCACCTTGCTTTTTCCCAGGGG - Intronic
1076664459 10:132078424-132078446 TCGCTTTTGCTTTTTCCCAGTGG + Intergenic
1076884461 10:133255420-133255442 TGCCTTTTTGTGGCTCCCAGAGG - Intergenic
1078608651 11:12800220-12800242 TGACTGTTGATTTTTCCTAGAGG - Intronic
1079045472 11:17098569-17098591 TGCTTTGTGGTTTTGCCCAGGGG + Intronic
1080091649 11:28355736-28355758 TGGATTTTGGTATTTGCCAGGGG + Intergenic
1081654367 11:44847836-44847858 TGCTTTTTTTTTTTTCCCAATGG + Intronic
1082088258 11:48067685-48067707 TGCCTTCTTGTTTTTCTCAGAGG + Intronic
1082147815 11:48692081-48692103 TTCCTTCTAGTTTTTCCCTGGGG - Intergenic
1082572240 11:54757977-54757999 TTCCTTTTAGTTTTTCTCTGTGG - Intergenic
1083458677 11:62796567-62796589 TTCTTTTTTGTTTTTCCCATAGG - Exonic
1084293495 11:68193625-68193647 TGCCTTTTGATTTTTCTCATAGG + Intronic
1084310535 11:68313540-68313562 CAACTTTTGGTGTTTCCCAGGGG + Intronic
1084450545 11:69234203-69234225 TGACTTTTGGATTTGCCCAGTGG - Intergenic
1084451394 11:69240971-69240993 AGACATTTGGCTTTTCCCAGTGG + Intergenic
1084771946 11:71349143-71349165 GGCCTATTTGTTTTTCCCAAAGG - Intergenic
1085001485 11:73040330-73040352 TGTTTTTTGTTTTTTGCCAGAGG + Intronic
1087871816 11:103303985-103304007 TGCCATTTTTTTTTTCCCTGAGG + Intronic
1087926407 11:103923675-103923697 AGCCTTTTGCTGTTTCCCACAGG + Intronic
1088084888 11:105965541-105965563 TGCCATTTTGTTTTTCCTTGTGG + Intronic
1088551123 11:111013445-111013467 TGCCCTTTGTTTTTTTCCATGGG - Intergenic
1090598253 11:128342608-128342630 TGCATTTTTGTTACTCCCAGAGG - Intergenic
1090946119 11:131431093-131431115 TGCCTTTTGCTGTTTATCAGTGG + Intronic
1092060144 12:5543224-5543246 TCACTTTTGTTGTTTCCCAGAGG + Intronic
1092670713 12:10857853-10857875 TGAATTTGGGTTTTTCCCAAAGG + Intronic
1093805700 12:23430771-23430793 TGCCTTTTGGATTTTGGCAGGGG - Intergenic
1093947245 12:25123589-25123611 TGCATTTTGGTTTATCCAGGAGG + Intronic
1094189020 12:27677841-27677863 TTCCTTTGGGTTTTTCCAAAAGG + Intronic
1096485194 12:51975610-51975632 TGCCTTTTGGATGTTCCCGAAGG + Intronic
1096722492 12:53533684-53533706 TCCCTTTTTATTTTTCCTAGTGG + Intronic
1098802569 12:74980545-74980567 TTCCTTTTGGTGTTTCACTGTGG + Intergenic
1099401971 12:82211378-82211400 AGCTTTTTGTTTTTTCCCAAAGG - Intergenic
1099667691 12:85653286-85653308 GGTCTTTTGTTTTTTTCCAGGGG + Intergenic
1099961396 12:89400576-89400598 TACCTTTAGGTGTTTCCCATCGG - Intergenic
1100879689 12:99002930-99002952 TCCCTTATGCTTTCTCCCAGTGG + Intronic
1103053756 12:117802646-117802668 TGACACTTGGTTTTTCCCAGGGG - Intronic
1103748263 12:123140942-123140964 TCCCTTTTCTTTTTTCCAAGAGG - Intronic
1104887910 12:132122233-132122255 TGCCTTTTGGCTTTGCCGTGTGG + Intronic
1106247041 13:27959466-27959488 TGCCTCTTTTTTTTTCCGAGTGG + Intergenic
1106544655 13:30719839-30719861 TTCCCTTTTTTTTTTCCCAGAGG + Intronic
1106792446 13:33169267-33169289 TGCCTTTTGTACCTTCCCAGAGG - Intronic
1107653460 13:42568307-42568329 TTGCTTTAGGTTTTTTCCAGTGG + Intronic
1110352462 13:74525417-74525439 TGTTTTTTGTTTTTTTCCAGAGG + Intergenic
1110375769 13:74792258-74792280 TTGCTTTTGCTTTATCCCAGTGG + Intergenic
1112723972 13:102280828-102280850 TGATTTCTGGTGTTTCCCAGGGG - Intronic
1112851177 13:103708454-103708476 TCCCCGTTGGCTTTTCCCAGAGG + Intergenic
1113554327 13:111219556-111219578 TGCCACGTGGTTTTCCCCAGCGG + Intronic
1113883731 13:113646256-113646278 AGCCATTTGGTTTTTCATAGTGG - Intergenic
1114562908 14:23606143-23606165 TGCCTTTTGAGTTTTCCCCGTGG + Intergenic
1116961389 14:50971825-50971847 TCCTTTTTCTTTTTTCCCAGGGG + Intergenic
1117078210 14:52125317-52125339 TGCCTTTTGTTGTTTCCTGGAGG - Intergenic
1117334391 14:54744472-54744494 TGCCTGCTGGTCTTTACCAGTGG - Intronic
1118859052 14:69647646-69647668 TTCCTTTTTTTTTTTTCCAGGGG - Intronic
1119659163 14:76438182-76438204 TGCCCTTTGGGTTTTGCCACTGG - Intronic
1120441353 14:84544889-84544911 TGTCTTTTGGTTTCTACCGGTGG - Intergenic
1120732231 14:88016706-88016728 TGCCTTCTGGCTTCTACCAGAGG + Intergenic
1122128922 14:99593915-99593937 TACCTTTTGGCTTTCACCAGTGG - Intronic
1122261737 14:100527498-100527520 TGCCTTTTCCTTGTTCTCAGTGG + Intronic
1123218399 14:106833306-106833328 TGTCTCTTGGGTTTTGCCAGAGG - Intergenic
1125479304 15:40069524-40069546 GCCCTTTTGGTTCTCCCCAGGGG + Intergenic
1125832665 15:42727839-42727861 TGCCTTTTGCTGTTTCCTACTGG + Intronic
1126073299 15:44884776-44884798 TTCCTTTTTTTTTTCCCCAGGGG - Intergenic
1126516550 15:49545652-49545674 TGGCTTTTGCTGTGTCCCAGAGG + Intronic
1127216257 15:56825592-56825614 GGGCTTTTCGTTTCTCCCAGGGG + Intronic
1127468135 15:59265156-59265178 TGCCTGTTTGTTTTTCCCTGGGG - Intronic
1129890378 15:79067863-79067885 TGGGCTTTGGTCTTTCCCAGTGG - Intronic
1130075243 15:80683289-80683311 TGCCAGCTGGTTTTCCCCAGAGG + Intronic
1130823881 15:87523740-87523762 GGACTTTTGCTTCTTCCCAGTGG - Intergenic
1130855930 15:87840057-87840079 CTCCGTTTGGTTTTCCCCAGTGG - Intergenic
1131886819 15:96924704-96924726 TGTCTTCTGGTGTTTCTCAGGGG - Intergenic
1132093849 15:98967452-98967474 TGCCATTTTGTTTTGCACAGGGG - Intergenic
1134102060 16:11459607-11459629 TCGCTTTTAGTCTTTCCCAGAGG - Intronic
1134456307 16:14398027-14398049 TGCCTTTTGGCTCTTCTAAGAGG - Intergenic
1134798174 16:17060601-17060623 TCCCTTGTGGTTTTCCCCTGCGG + Intergenic
1135060541 16:19267640-19267662 TGCCATTTGGTTTCTCCAAATGG - Exonic
1135209645 16:20513460-20513482 TGCCTTTTGGGTTTTCCTCGTGG + Intergenic
1135751742 16:25063870-25063892 TGCTTTTCTGTTTTTCACAGTGG - Intergenic
1137327545 16:47456898-47456920 TGCATTTTTGTTTTTCCCATTGG - Intronic
1138078860 16:54069491-54069513 TGCCTTTTTGTTTTTCCCCATGG - Intronic
1138147262 16:54623971-54623993 TGTCTTTTTGTTTTTGCCAGAGG - Intergenic
1138173362 16:54873816-54873838 TGCCCTTTGAGTTTTTCCAGTGG - Intergenic
1139233094 16:65305879-65305901 TGCCTTGGGGTTGTTCCCATAGG - Intergenic
1139677271 16:68532593-68532615 TTCCTTTTGGCTTTTTCCATTGG - Intronic
1140599263 16:76455717-76455739 CACCCTTTGGTTTTTCCCTGAGG + Intronic
1140828166 16:78726722-78726744 TTCCTTTTTTTTTTTGCCAGGGG + Intronic
1141231541 16:82171598-82171620 AGCCCTTTAGGTTTTCCCAGGGG + Intergenic
1141250399 16:82351238-82351260 TGCCATTTGCTTTATCGCAGTGG - Intergenic
1143171515 17:4933242-4933264 TGCCTTTTGCTTTTCTCCACGGG + Exonic
1144801916 17:17935031-17935053 TGCATTTTGGTTCCTCTCAGAGG - Intronic
1147458211 17:40551864-40551886 GGCCTTTTCCTTCTTCCCAGGGG + Intergenic
1148205699 17:45778504-45778526 TCCCTTTTTGCTTTCCCCAGTGG - Intergenic
1148345722 17:46902591-46902613 TGCCTGTTTGTTTTTCCCCCTGG - Intergenic
1148911478 17:50945191-50945213 TGCCTGATGGTTTTTCCCAACGG + Intergenic
1149474346 17:56946976-56946998 TGCCTTCTGGTTTCTCCTGGGGG - Intronic
1149492055 17:57092094-57092116 TGCATTTTGGTTTAAGCCAGAGG - Intronic
1149881037 17:60290750-60290772 TTTCTTTTTTTTTTTCCCAGTGG - Intronic
1150352550 17:64457231-64457253 TGCCCATTGGCCTTTCCCAGTGG + Intronic
1150472772 17:65451189-65451211 TGCCTATTCCTTTGTCCCAGAGG - Intergenic
1152206468 17:78977107-78977129 CTGCTTTTGGTATTTCCCAGGGG + Intronic
1154086277 18:11308516-11308538 TGCCTTTTCCTTTGTTCCAGAGG - Intergenic
1155995049 18:32322188-32322210 TGCCTTTTAGTTTCAGCCAGTGG - Intronic
1156421269 18:36955795-36955817 TACCTTTTGTCTTTTCACAGGGG + Intronic
1156881374 18:42084836-42084858 GGCCTTGTGAGTTTTCCCAGGGG + Exonic
1157544869 18:48540134-48540156 TCCCCTTTGGTTATTCCCAACGG + Intronic
1160584573 18:79905195-79905217 AGCCTCCTGGTTTTTCCCAGTGG - Intronic
1160825138 19:1076419-1076441 TGACTTTTGATTTTTACCTGTGG + Intronic
1162667742 19:12229397-12229419 TGCCTTTTCTGTTTTCCCAAGGG + Intronic
1166749091 19:45156235-45156257 GGCCTTTGGGATTTTCCCCGGGG - Intronic
1167673243 19:50868328-50868350 TTCCTGTTGTTTTCTCCCAGTGG + Intronic
926921991 2:17948100-17948122 TGCATCTTGCATTTTCCCAGTGG + Intronic
927009399 2:18887092-18887114 TGGCTTTTGTTTTTGCCCACAGG - Intergenic
927943540 2:27120807-27120829 TCCTTTTTGGTTTTTTTCAGAGG - Intergenic
927951363 2:27172063-27172085 AGGCTTTTGGTTCTGCCCAGAGG + Intergenic
928327933 2:30334879-30334901 TGCCATTGTGTTTTTCACAGAGG + Intergenic
929585540 2:43111896-43111918 TGCCTTTTCACTTTTCCCACAGG - Intergenic
932281992 2:70501406-70501428 TGCCCTTGGGTTCTTCTCAGTGG - Intronic
932546409 2:72715267-72715289 TGCTTTTTGCTTTTTGCCTGAGG - Intronic
932556314 2:72827587-72827609 TGCCTTTTTTTTTTTGTCAGTGG - Intergenic
934058318 2:88270985-88271007 TGCCTTTGGGTTTTTCCCCTGGG - Intergenic
935227406 2:101065038-101065060 TTCTCTTAGGTTTTTCCCAGAGG + Intronic
936654173 2:114465343-114465365 AGCCTCCTGATTTTTCCCAGTGG + Intronic
937665244 2:124479702-124479724 TGCCTTTTCTTTTGTCCTAGAGG + Intronic
938764590 2:134452012-134452034 TGCCTTTTCGTTTTTCTTTGGGG + Exonic
939505632 2:143043286-143043308 TAACTTTAGGTTTTTCACAGTGG - Exonic
939514427 2:143148848-143148870 TTCCTTTTGTTTTCTCCCTGTGG - Intronic
940065030 2:149617977-149617999 TGCCTTTTGGTGTTTTAAAGTGG + Intergenic
940219738 2:151339446-151339468 TGCTTTTAGGATTTTCCAAGTGG - Intergenic
940763896 2:157769037-157769059 CCCCTTTTAGTTTTGCCCAGTGG - Intronic
941692693 2:168517628-168517650 TGCCTCTTGGTTTTGGCTAGTGG + Intronic
942341365 2:174951181-174951203 TGCCTTTTTCTTTTTCCCTTGGG - Intronic
943079682 2:183243506-183243528 TGCCAATTGTTTTTTCCTAGAGG + Intergenic
943681137 2:190769298-190769320 TGCCTTTTGGTTTTTCAAACAGG + Intergenic
943984744 2:194604704-194604726 TTCCTTTTGGTATGTCCTAGGGG - Intergenic
944354459 2:198769365-198769387 GTTCTTTTGGTTTTTCTCAGGGG - Intergenic
944504133 2:200392318-200392340 GTCCTTTTGGGTTTTTCCAGAGG - Intronic
945364158 2:208930159-208930181 GGCCTGTTGGTATTTCTCAGTGG - Intergenic
946285329 2:218698349-218698371 TTCTTTTTGTTTTTTCACAGTGG + Intronic
946954714 2:224916641-224916663 AGGCTTTTGCTTTTTCCCAGGGG - Intronic
947037476 2:225875797-225875819 TGCCCATAGTTTTTTCCCAGTGG + Intergenic
947379354 2:229530267-229530289 TGCATTTTGTTTTTGCACAGTGG - Intronic
1170452369 20:16497224-16497246 TAGCTTTTTGTTGTTCCCAGTGG - Intronic
1173031968 20:39369642-39369664 TGCCTTTTTTTGTTTCCCATTGG - Intergenic
1173055515 20:39608525-39608547 AGCATGATGGTTTTTCCCAGTGG + Intergenic
1173743998 20:45422596-45422618 TGCCTTTAATTTTTTCACAGAGG + Intronic
1174280340 20:49434578-49434600 TGCCTTGTGAGTTTTCTCAGAGG - Intronic
1175261218 20:57675369-57675391 TGCCTTTTGCTGCTTCCAAGAGG - Intronic
1175453788 20:59094486-59094508 AGCCTAATGCTTTTTCCCAGTGG - Intergenic
1176999176 21:15590658-15590680 TGCCTACGGATTTTTCCCAGGGG - Intergenic
1180217524 21:46335031-46335053 TCCTTTTTTGTTTTTCCCATGGG + Intronic
1180628269 22:17209091-17209113 TCCCTTTTTAGTTTTCCCAGGGG - Intronic
1180984096 22:19893870-19893892 TGGCTTTCAGTGTTTCCCAGTGG - Intronic
1181151742 22:20888724-20888746 TGCCTAATGGTGATTCCCAGAGG - Exonic
1181943300 22:26495812-26495834 TGCCTTGTGGTTTTCCCGATTGG - Intronic
1181978610 22:26750580-26750602 TGCCCTTTGGTTTTTCCCGGAGG - Intergenic
1182265198 22:29109129-29109151 TATTTTTTGGTTTTTGCCAGTGG + Intronic
1182564463 22:31187037-31187059 TGCCTTTTAGGATTTCCCTGGGG + Exonic
1183327207 22:37200742-37200764 TGCCTGTTGGGTCTTCCCAGAGG + Intergenic
1184628505 22:45756866-45756888 TTCCTCTTGGATTTTTCCAGTGG - Intronic
1185311382 22:50157355-50157377 TCCCTTTTAGTTATTGCCAGTGG + Intronic
949847278 3:8384610-8384632 TGCCTATTTTTTTTTCCAAGGGG + Intergenic
950328436 3:12135758-12135780 TGTCTTCTGGTTTTCTCCAGTGG + Intronic
950398130 3:12749717-12749739 TCCCATGTGGTTTTGCCCAGAGG + Intronic
951631447 3:24725735-24725757 TGCTTTTTTGTTTATCCCTGAGG - Intergenic
952302795 3:32119186-32119208 TGCCATTTGGTTTTCCACAGTGG + Intronic
952671143 3:35970844-35970866 TGATTTTTGTTTTTTCCCTGTGG + Intergenic
952897214 3:38085638-38085660 TTGCTTTTGGGTTTTCTCAGTGG + Intronic
955919276 3:63938339-63938361 TGCATTTAAGTATTTCCCAGTGG + Intronic
956020055 3:64924543-64924565 TGCCTTTTTGTTTTTCATGGGGG + Intergenic
956030658 3:65033789-65033811 TTCCTTTTGGCTATTCTCAGAGG - Intergenic
956668388 3:71663521-71663543 GGCCCTTGGGTTTTTTCCAGGGG + Intergenic
957869503 3:86071673-86071695 TGGCTTTTGAGATTTCCCAGGGG - Intronic
958802203 3:98769327-98769349 TGGCATTGGGTTTTTTCCAGTGG - Intronic
958962059 3:100520412-100520434 TGACTTTTGGGTTTTCCCTTAGG + Intronic
959560283 3:107771866-107771888 TGCCTTTTCTTTTTTTCCAGGGG - Intronic
960993709 3:123327818-123327840 TGCAGTTTGGTTTTTCACGGGGG - Intronic
962171310 3:133104509-133104531 TTCCTTTTGCTTTCTCCCAAAGG + Intronic
963091714 3:141488162-141488184 TGCCATTTTTTTTTTCACAGTGG + Intronic
963949020 3:151178265-151178287 TTCCTTTTGGTTATTCTCAGTGG + Intronic
964242300 3:154610339-154610361 TGCATTTTGTTATTTCCCAAAGG + Intergenic
965381918 3:168000493-168000515 ATCCTTTTGGTATTTCCCTGTGG - Intergenic
965686194 3:171305043-171305065 TTCCTTTTTTTTTTTCCCTGTGG - Intronic
966014045 3:175119056-175119078 TACGTTTTTTTTTTTCCCAGTGG + Intronic
966459494 3:180160405-180160427 TGCTTTTTGGTTTCTCACTGTGG + Intergenic
966553039 3:181227055-181227077 TGGCTTTTGCTGTATCCCAGAGG + Intergenic
967235521 3:187380027-187380049 TTCCTTTTGCTTTTTCCCTTGGG - Intergenic
968011826 3:195286713-195286735 TGGCATTTGGGTTTTCACAGAGG + Intronic
969974432 4:11083792-11083814 TCCTTTTTGTTTTCTCCCAGAGG + Intergenic
971195262 4:24467229-24467251 TGACTTTGGGTTTCTCCTAGGGG - Intergenic
973239827 4:47945589-47945611 TGACTTATGGTGTTTCCCACTGG + Intronic
973768288 4:54183635-54183657 TGATTTTTGGCTTTTCCTAGAGG - Intronic
974318584 4:60314386-60314408 TGCCTGTTGGTATTTCCAGGTGG - Intergenic
974546405 4:63314084-63314106 TGCCATTTTGCTTTCCCCAGTGG + Intergenic
975290674 4:72674743-72674765 TTGCTTTTGCTTTATCCCAGAGG + Intergenic
976079674 4:81341499-81341521 TGGCTTTTGCTGTATCCCAGAGG + Intergenic
976472328 4:85444028-85444050 TGCCTTTTTCTTTTTCTGAGAGG + Intergenic
976869802 4:89777442-89777464 TGGCTTTTGCTGTATCCCAGAGG - Intronic
977031943 4:91894078-91894100 TGTTTTTTGTTTTTTCCTAGTGG - Intergenic
977221521 4:94343259-94343281 TTGTTTTTGGTTTCTCCCAGTGG + Intergenic
977956759 4:103036648-103036670 TGCCTTTTTTTTTTTTCAAGGGG + Intronic
978088934 4:104690714-104690736 TGCCTTTTGTTGTTTTCCATTGG + Intergenic
979295489 4:119028114-119028136 TGGCATTTTGTTTTACCCAGGGG + Intronic
980558877 4:134445161-134445183 TGCCTTTTGGAGATCCCCAGTGG + Intergenic
980847700 4:138343745-138343767 TGCTTTTTGAATTTTCCCTGTGG - Intergenic
981678091 4:147362687-147362709 TTCCTAAAGGTTTTTCCCAGAGG - Intergenic
983569533 4:169190054-169190076 TGCCTTTTGCTGTGTCCCATAGG - Intronic
983716391 4:170786814-170786836 TGCCTTTTTTTTTTTTCCATTGG + Intergenic
983845353 4:172511598-172511620 TGACTTTTGCTGTATCCCAGAGG + Intronic
984307816 4:178017212-178017234 TGCCTTTTGTTGTTTTCCATTGG - Intergenic
984554980 4:181202754-181202776 TTCCTGTTGGTTTTATCCAGTGG + Intergenic
984789243 4:183599854-183599876 AGCCTCTTGGTCTTTGCCAGTGG + Intergenic
985079580 4:186251004-186251026 TGCCTATTAGTTTTCTCCAGAGG + Intronic
985539483 5:481485-481507 TGGCTTCTGGTTCTTCCGAGTGG + Intronic
986644375 5:9902317-9902339 GTGCTTTTGGTTCTTCCCAGAGG + Intergenic
986665499 5:10100310-10100332 TGTCTTTTGGTGTTTAACAGTGG - Intergenic
986826515 5:11528548-11528570 TCCCTTTTGGTATTTTCCAAGGG - Intronic
987388286 5:17351183-17351205 TGCCTATTGATTCTTCACAGGGG - Intergenic
987469955 5:18315708-18315730 AGCCTTCTGGTTTTTCCTAATGG + Intergenic
987947549 5:24631288-24631310 TGACTTCTGGTGTTTTCCAGAGG - Intronic
989449666 5:41571854-41571876 TGCCCTTCTGCTTTTCCCAGAGG + Intergenic
989502561 5:42185794-42185816 TGCCTTCTGGTTTTTTCAAGAGG - Intergenic
989543210 5:42641954-42641976 AGTCTTTTGGTTTTTCCAAGAGG - Intronic
989847354 5:46161608-46161630 TGCCTTCTGGTTTTTACCCTAGG - Intergenic
990275435 5:54190877-54190899 TGCCATATTGTTTTTCACAGTGG - Intronic
990321545 5:54634379-54634401 TCCCTTTGGGTTATTCTCAGTGG + Intergenic
993943136 5:94086008-94086030 TGCCTTCTGTTCTTTCCCAGTGG - Intronic
994659086 5:102631927-102631949 CGCCTTTTGATGTATCCCAGAGG - Intergenic
995115656 5:108475698-108475720 TTGCTTTTGCTGTTTCCCAGAGG - Intergenic
995599484 5:113780112-113780134 TGCCTTTTAGGTTTTCCTGGAGG - Intergenic
996239291 5:121174845-121174867 AGCCTTTCTGTTTTTCACAGAGG + Intergenic
996812693 5:127536079-127536101 TGCCTTTTCACTTTTCACAGTGG + Intronic
998631716 5:143905993-143906015 TCTATTTTGTTTTTTCCCAGAGG - Intergenic
998713327 5:144850751-144850773 TGCCTTCTGGATCTTCCCTGAGG + Intergenic
999402347 5:151275058-151275080 TTCCTTTTTTTTTTTTCCAGAGG + Intergenic
1000248743 5:159472239-159472261 TGCCCTTTGGGTATCCCCAGTGG + Intergenic
1001101615 5:168819012-168819034 TTCCTTTTTGCATTTCCCAGTGG + Intronic
1001215566 5:169852835-169852857 TGCCTTATTGTATTTCACAGAGG - Intronic
1003328332 6:5109537-5109559 TTCCTTCTGGCCTTTCCCAGGGG - Intronic
1006273399 6:32981608-32981630 AGGCTTTAGGTTTTTCCCTGTGG + Intergenic
1006685963 6:35834254-35834276 TGCCTTTCTGATTTTCTCAGAGG - Exonic
1006803539 6:36774562-36774584 TGTCTTTTCATTGTTCCCAGTGG - Intronic
1007382580 6:41500220-41500242 TGCCTCTTGGCTTTTCACTGTGG - Intergenic
1008042100 6:46813360-46813382 TGCTTTTTGCTGTATCCCAGAGG - Intronic
1008874926 6:56315276-56315298 TGCCTTTTGATTGATCCCACGGG + Intronic
1010345862 6:74810064-74810086 TGCTTTTTGCTTTTTCTGAGTGG + Intergenic
1011013729 6:82731580-82731602 TACCTTTTGATTTTTCCCACAGG + Intergenic
1011394670 6:86893316-86893338 TGCTTTTTGCTGTATCCCAGAGG - Intergenic
1012347034 6:98202103-98202125 GGCTTTTTTTTTTTTCCCAGAGG - Intergenic
1014202772 6:118623550-118623572 TGCCTTTTCGACTTTCCCTGAGG - Intronic
1014567644 6:122970024-122970046 TGCTTTTTGCTTTTGCCCTGAGG + Intergenic
1016249605 6:142024676-142024698 TGCATTTTGTTTTTTATCAGTGG + Intergenic
1019147317 6:169983702-169983724 TGCCTTGTGGTTTTTCCTTGTGG - Intergenic
1020805606 7:12786562-12786584 TGGCTTTTGGCTTTGCTCAGAGG + Intergenic
1020942463 7:14558672-14558694 AGCCTCTTGGTTTTTCTTAGCGG - Intronic
1021840513 7:24718253-24718275 TGACTTTTGGCTTTTTCTAGAGG - Intronic
1022921180 7:35016470-35016492 TACCTTTTGATTTCTCCCTGAGG - Intronic
1023903016 7:44498776-44498798 TGCCTTTTGCTTTCTGCCAAGGG - Intergenic
1024336072 7:48206538-48206560 TTCCTTTTTATTTTTCCCATGGG + Intronic
1026332357 7:69363835-69363857 TGTCTTTTTTTTTTTCCAAGGGG - Intergenic
1026664745 7:72332590-72332612 TGACTTGTGGTCTCTCCCAGGGG - Intronic
1028719134 7:94009372-94009394 TGACTTGTTTTTTTTCCCAGTGG + Intergenic
1028970915 7:96858168-96858190 TGCCTTTAGGTCTGTCCCTGTGG - Intergenic
1030945109 7:115709150-115709172 TGCCTTTTTTTTTTTCCTAGTGG + Intergenic
1031579300 7:123451629-123451651 TTCCTTTTGGGTTTGGCCAGCGG + Intergenic
1031649548 7:124270551-124270573 TGCCTTTTAATTTTTTCCAAAGG + Intergenic
1032509305 7:132459444-132459466 TGCTCTTTGGTCTTTCCCTGGGG - Intronic
1033852992 7:145520409-145520431 TGCCTTTTTGTTTCTCCTTGAGG + Intergenic
1034286453 7:149886446-149886468 TACATGTTTGTTTTTCCCAGAGG - Intergenic
1035106360 7:156444846-156444868 TGACTTTTGGTGTGTCCGAGAGG - Intergenic
1035352989 7:158259452-158259474 CTCCTTTAGGCTTTTCCCAGGGG - Intronic
1035980527 8:4365417-4365439 TGTCTTTTATTTTTCCCCAGAGG - Intronic
1036497012 8:9278781-9278803 TCCCTTTTAGTTTCTCCCTGTGG + Intergenic
1037539318 8:19856210-19856232 TGACTTTTTTTTTTTTCCAGAGG - Intergenic
1037598974 8:20377839-20377861 TGGCTTTTGACCTTTCCCAGGGG + Intergenic
1038126053 8:24673913-24673935 TGCCTTTTGGCTTTTTCCGAAGG - Intergenic
1039092237 8:33844471-33844493 TCCCTTTTGGTTGTTCCCTGAGG - Intergenic
1039631683 8:39119647-39119669 TGCTTTTTCATTTTTCTCAGTGG + Intronic
1039834022 8:41241835-41241857 TTCCTTTTGGTTTTCCCCTTAGG + Intergenic
1040118589 8:43654264-43654286 TGCTTTCTAGTTTTTCCCTGGGG - Intergenic
1040401673 8:47056622-47056644 TTCCTTTTGTTGTATCCCAGAGG - Intergenic
1041727651 8:61032823-61032845 TTCCTATTGGATTTTCCCATGGG - Intergenic
1041776902 8:61533206-61533228 TGCCTTTTTGTTTTTCCTTCTGG + Intronic
1043204115 8:77413887-77413909 TTCTTTTTGTTTTTTCTCAGAGG + Intergenic
1043643865 8:82492042-82492064 TGCCTATTAGTCTTTCTCAGAGG - Intergenic
1043863688 8:85351771-85351793 TGCCTCTAGGTTTTCCACAGAGG - Exonic
1043918077 8:85947634-85947656 TGCCTTTTAATTTTTCTCAATGG + Intergenic
1047022409 8:120789222-120789244 CGCCTTTTGCTATATCCCAGAGG - Intronic
1047381670 8:124371205-124371227 CCAGTTTTGGTTTTTCCCAGAGG - Intronic
1047634033 8:126740506-126740528 TGGCTTTTGCTGTCTCCCAGAGG + Intergenic
1047653397 8:126948836-126948858 TGTCTTTTCGTTTTTCCTGGTGG - Intergenic
1047760646 8:127951543-127951565 CGCCTTTTAGTTTCTCCTAGGGG - Intergenic
1047925534 8:129679202-129679224 TGCCTTCTGGCTATTCCCTGGGG - Intergenic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1051231225 9:14957640-14957662 TGCCTTTTGGTGATTTGCAGAGG - Intergenic
1051801909 9:20944371-20944393 TGCCTTTTGTTTTTATCTAGGGG + Intronic
1052070576 9:24077073-24077095 TGCCTTTTAGTATTTAACAGGGG + Intergenic
1052339031 9:27347310-27347332 TGCCTTTTTATTTTTACCAGTGG + Intronic
1052673026 9:31582581-31582603 TGCCTTTGTATTTTTCACAGTGG - Intergenic
1055019867 9:71658376-71658398 TTCCTTTTTTTTTTTTCCAGTGG + Intergenic
1057727353 9:97577333-97577355 TGCCTTCTGGTCATTCTCAGAGG + Intronic
1059043528 9:110840475-110840497 TGCCATTTGGTTATTCCTATAGG - Intergenic
1059662978 9:116419799-116419821 GGCCTTTTGCCTTCTCCCAGAGG - Intergenic
1061946884 9:133913542-133913564 TGCCTTTGGTTTTTTACCAAGGG - Intronic
1186050958 X:5594913-5594935 TGACTTTTGCTTTTTAGCAGTGG + Intergenic
1186229261 X:7435664-7435686 TGTCTTTTAATTTTTCCCGGTGG - Intergenic
1186497347 X:10022135-10022157 TGCCTGCTGGTTTCTCCCTGCGG + Intronic
1187113960 X:16330626-16330648 TTGCTTTTGGTTTTAGCCAGTGG + Intergenic
1187298102 X:18022088-18022110 TGCCCGTTGGTTATTCTCAGAGG - Intergenic
1188214784 X:27463093-27463115 TGTCTCTTGGTATTTCCCATAGG + Intergenic
1188355487 X:29185311-29185333 TACGTTTTGTTTTTTCACAGAGG + Intronic
1190784290 X:53629118-53629140 TGCCTTTTGGTTTTTCCCAGAGG - Intronic
1191583296 X:62789891-62789913 TTCTTTCTGGTTTTTCTCAGGGG + Intergenic
1192977630 X:76303089-76303111 TGCCTTTTTTTTTTTCAGAGAGG + Intergenic
1193365262 X:80623763-80623785 TGCATTTTGGTTCTTCTCAGTGG + Intergenic
1193728449 X:85072167-85072189 TGCTTTTTTCATTTTCCCAGAGG - Intronic
1195779643 X:108447509-108447531 TGCATTGTGGTTTTTCCAGGTGG + Intronic
1196985532 X:121265827-121265849 TGCCTTTTGTTGTTTTCCATTGG - Intergenic
1196994395 X:121365598-121365620 TTGCTTTTGCTTTATCCCAGAGG + Intergenic
1197471954 X:126874849-126874871 TCGCTTTTGCTTTATCCCAGAGG + Intergenic
1198713507 X:139531618-139531640 TGACTTTATGTATTTCCCAGAGG + Intronic
1198720430 X:139612302-139612324 TGCCTTTTTGAATTTCCCATAGG - Intronic
1198761256 X:140034901-140034923 TACCTTTTTTTCTTTCCCAGAGG - Intergenic
1199548345 X:149031914-149031936 TGCCTTTTGGTATGTGCCTGAGG + Intergenic
1199923090 X:152430297-152430319 TGCCTCTTCCTGTTTCCCAGTGG - Intronic
1201597682 Y:15690230-15690252 TGTCTTTTAATTTTTCCCTGTGG - Intergenic
1201973508 Y:19820368-19820390 TGTCTTTTGGTTGTTTCCTGGGG - Intergenic
1202096325 Y:21251327-21251349 TGTCTGTTTGTTTTTCCCAGTGG - Intergenic