ID: 1190787828

View in Genome Browser
Species Human (GRCh38)
Location X:53669798-53669820
Sequence CTGAAGTAATGGTGTGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190787828 Original CRISPR CTGAAGTAATGGTGTGAAGT AGG (reversed) Intronic
902938944 1:19785825-19785847 ATGAAGTGATGGGGTGAAGCAGG + Intronic
903193108 1:21667813-21667835 CTGAAATATTGCTGTGAAGGGGG + Intronic
910411164 1:86946514-86946536 CTGAAGTAATGGTCTTAGCTGGG + Intronic
914842160 1:151257343-151257365 CCTAAGTAATAGTTTGAAGTTGG + Intronic
915833837 1:159157219-159157241 GTGCAGTAATGGTGTGAAGATGG - Intergenic
916247398 1:162702789-162702811 CTGAACTAATGGTGTAATCTTGG - Intronic
916765208 1:167853635-167853657 CTGAAGTGATGGCATGAAGGAGG - Intronic
918524948 1:185455126-185455148 ATGAATTATTGGTGAGAAGTAGG + Intergenic
921384549 1:214555338-214555360 TTGGAGTAATGGAGAGAAGTGGG + Intergenic
922116205 1:222617494-222617516 GTGAAGTAGCGGGGTGAAGTGGG + Intergenic
923183258 1:231543955-231543977 CAGAAGTACTGGTGGGAAGAAGG + Intronic
923745879 1:236699922-236699944 ATGAAGTAAAACTGTGAAGTAGG + Intronic
1063346475 10:5316740-5316762 GGGAGGAAATGGTGTGAAGTAGG - Intergenic
1066496891 10:35950717-35950739 TTGAATTAATGGTGAGAAGGAGG - Intergenic
1066624522 10:37392604-37392626 TTGAATTAATGGTGAGAAGGAGG - Intergenic
1067168454 10:43884258-43884280 CTGAAGCAATTTTGTAAAGTAGG - Intergenic
1070242778 10:74699624-74699646 CTGGAGTACTGGTGTGATCTTGG - Intronic
1071957927 10:90779345-90779367 CTGATGTGATTGTGAGAAGTGGG + Intronic
1072771639 10:98144903-98144925 TGGAGGGAATGGTGTGAAGTTGG + Intronic
1073518139 10:104097630-104097652 GTGAAGTAATGGGGGGAAGTGGG - Intergenic
1073681344 10:105707309-105707331 CTGAAATATTGTTTTGAAGTAGG + Intergenic
1077981641 11:7307041-7307063 CTGTAATAATGGTGTGAGGCTGG + Intronic
1080891445 11:36412028-36412050 GTGCAGTAATCCTGTGAAGTAGG + Intronic
1088563080 11:111135407-111135429 CTGAAGTGATGATGTGAAACTGG - Intergenic
1089092194 11:115887417-115887439 CTGAGGTAGTGGTGAGAAGGTGG + Intergenic
1090578283 11:128132521-128132543 ATGAAGTAGTGATGTGATGTGGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1097751522 12:63359669-63359691 CTGAAGGATTTCTGTGAAGTTGG - Intergenic
1098206887 12:68120203-68120225 CTCAGCTAATTGTGTGAAGTTGG - Intergenic
1098835379 12:75418583-75418605 TTGTAGTAATAGTTTGAAGTCGG + Intronic
1098946605 12:76596693-76596715 CAGAAGTAATGGTGTGAAACAGG + Intergenic
1100390089 12:94140408-94140430 CTCAGGGAATGGGGTGAAGTTGG - Intergenic
1104154209 12:126115634-126115656 CTGAAGTAAGGAGGTGAAGATGG - Intergenic
1105761400 13:23518259-23518281 ATAAGGCAATGGTGTGAAGTGGG - Intergenic
1108259292 13:48640962-48640984 CTGAAGTGGTGGCGTGAAGGAGG + Intergenic
1108995702 13:56731680-56731702 CAGAAGAAATCCTGTGAAGTAGG + Intergenic
1110120541 13:71874888-71874910 CTGAAGTACTGGTTTTAAGGGGG + Intergenic
1110812832 13:79829400-79829422 CTGAAGTAATGGTGCCATATTGG - Intergenic
1111944669 13:94651984-94652006 ATCAAGTAATGGTGTGACTTTGG + Intergenic
1112093328 13:96106013-96106035 CTGAAGTGATGGGGTGATATTGG + Intronic
1112126865 13:96477817-96477839 CTGAAGCAATGGTGCGATCTCGG - Intronic
1117075173 14:52095117-52095139 CTGGAGTTATGGTGTAAATTTGG - Intergenic
1118346010 14:64941442-64941464 CTGAAGAGATGGTGTGAGGCTGG + Intronic
1120189765 14:81429983-81430005 CTGAAGTAAAGGGGTCAAGTGGG - Intronic
1120910098 14:89658564-89658586 CTGAAATCAAGGTGTGAACTGGG + Intergenic
1126176552 15:45741309-45741331 CCAAAGTAATGTTGTGAAGTAGG + Intergenic
1128121042 15:65146759-65146781 CTGAAGAAATGTTTTTAAGTAGG + Intergenic
1130654318 15:85781532-85781554 GTGCAGCAATGGTGTGATGTCGG + Intronic
1135324036 16:21514613-21514635 GTGAAATAATCGTGTGAAATGGG - Intergenic
1135395453 16:22128262-22128284 CTCAAGCAATGCTGTGAAGGAGG + Intronic
1136335518 16:29607884-29607906 GTGAAATAATCGTGTGAAATGGG - Intergenic
1141369206 16:83471671-83471693 CTGAAGGCAGGGTTTGAAGTAGG + Intronic
1141583219 16:85014900-85014922 CTGAAATAATGTCGTGAGGTTGG + Intergenic
1142036244 16:87863719-87863741 GTGAAATAATCGTGTGAAATGGG - Intronic
1145957386 17:28863974-28863996 CTGAGGGAATGGGGTGAGGTGGG - Intergenic
1146590110 17:34121453-34121475 CTGAACTAAGGGTGTGATGGTGG - Intronic
1148353643 17:46959138-46959160 CTGATGAGATGGTGGGAAGTAGG + Intronic
1148368610 17:47076052-47076074 CTGAAATAATGGTGTTAACAGGG - Intergenic
1148704064 17:49612499-49612521 CTGAAGCCATAGTGGGAAGTTGG - Intronic
1149186218 17:54000933-54000955 GTGATGTAATGGATTGAAGTAGG + Intergenic
1149734655 17:58981317-58981339 CTGAAGGGATGGTGGGAAGGGGG - Exonic
1161998407 19:7728788-7728810 AGGAAGTAATGGTGTAGAGTGGG + Intergenic
1168311515 19:55463314-55463336 CTGAGGCAGTGGTCTGAAGTGGG + Intergenic
1168531241 19:57131181-57131203 CTGATGTAATGGCCTGAATTTGG - Exonic
924967211 2:89137-89159 CTGAGGTATTAGTGTAAAGTTGG + Intergenic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
925428289 2:3769439-3769461 CTGATGGAATGGAGTGAAGACGG - Intronic
925592275 2:5521849-5521871 CTAATGCAATGGTGTGAAGCTGG - Intergenic
926853088 2:17222434-17222456 CGTAAGTAATGGTGTGAGGCAGG - Intergenic
928994751 2:37276034-37276056 CTGGAGTAAGGGTGAGGAGTGGG - Intronic
929227484 2:39525643-39525665 GTGAAGTATTTGTGAGAAGTTGG - Intergenic
929238981 2:39634224-39634246 CAGAAGTCAGTGTGTGAAGTAGG - Intergenic
929245525 2:39697943-39697965 CTGGAGAGAGGGTGTGAAGTGGG - Intronic
929863576 2:45699337-45699359 CTGAAATATTGCAGTGAAGTAGG + Intronic
930772991 2:55146372-55146394 CTGCAGTAAGGGTGTGGTGTGGG + Intergenic
932039799 2:68287160-68287182 AAAAAGTAATGGTCTGAAGTTGG - Intronic
932736910 2:74260662-74260684 TTGAAGTACTGGTGGGAAGTAGG - Intronic
933526667 2:83449454-83449476 TTGCAGTAATGCTATGAAGTAGG + Intergenic
938645543 2:133326401-133326423 GTGCAGTAGTGGTGTGAACTCGG - Intronic
938992892 2:136647531-136647553 CTGAAGTAAAAGTATGAAGGTGG + Intergenic
940088229 2:149885910-149885932 CTGCAGTAATGGTGTGGAGATGG - Intergenic
944019658 2:195086901-195086923 CTGAAGCAAAAATGTGAAGTAGG - Intergenic
944988966 2:205212534-205212556 GTGGAGCAATGCTGTGAAGTGGG + Intronic
945194282 2:207223832-207223854 CTGAAGAAAATGAGTGAAGTGGG - Intergenic
946363972 2:219237078-219237100 CTGAACCAATGGAGTTAAGTGGG - Exonic
946550716 2:220799142-220799164 CTGAAATAAAGGTGTGAGGTAGG + Intergenic
1173390064 20:42623729-42623751 CTGAAGTATGGGTATGGAGTTGG - Intronic
1173669981 20:44792130-44792152 CTGAAGTTATGGTGCTAAATAGG - Intronic
1175627917 20:60504395-60504417 CTGAACTAAGGGTGTGACTTTGG + Intergenic
1178082035 21:29076105-29076127 CTGAAGTGATGGTATTACGTAGG + Intergenic
1183239782 22:36649101-36649123 CTGAAGTGATGATGTCTAGTTGG - Intronic
1183616325 22:38948034-38948056 CAGAAGTAGGGGTGAGAAGTGGG + Intergenic
1185200650 22:49502220-49502242 CTGATGTGATGGTTGGAAGTTGG + Intronic
951398761 3:22203851-22203873 CAGAAGCCATGGTTTGAAGTTGG - Intronic
952449074 3:33413819-33413841 GTCAGGTGATGGTGTGAAGTGGG - Intronic
953611308 3:44449695-44449717 CTGAAGTCCTGGTGGGAAGGTGG + Intronic
958450417 3:94266317-94266339 TTGAAGTATTGGTGAGAAGCGGG + Intergenic
958764977 3:98357032-98357054 TTTAAGTAATTATGTGAAGTAGG - Intergenic
960423482 3:117477580-117477602 CAGAGGTCATGGTGTGAAGCAGG - Intergenic
963611829 3:147478037-147478059 CTGGAGCAATGGTGTGATCTTGG - Intronic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
967849638 3:194072005-194072027 CTGAAGTAAGGGGGGGATGTTGG + Intergenic
970147389 4:13051215-13051237 CTGAAGGAGAGGTGGGAAGTGGG + Intergenic
971423879 4:26497817-26497839 CTGAAGTGCTGGAGTGCAGTGGG + Intergenic
972371717 4:38430512-38430534 CTGAAGAAATGGTGCCAAATTGG + Intergenic
972935901 4:44135053-44135075 CTGAAGTGAAGGTGAGAAGGAGG - Intergenic
973239319 4:47940278-47940300 CTGAAGTATTTCTGTTAAGTAGG - Intronic
978957652 4:114634059-114634081 CTGCAGAGATGGTGAGAAGTGGG + Intronic
979170731 4:117598748-117598770 CTCAAGTAATGTTATAAAGTAGG + Intergenic
980806656 4:137824260-137824282 CTGAAGCAAAGGTGAGAAGTCGG + Intergenic
981248698 4:142572421-142572443 CTGAAGAGTTGGTGGGAAGTTGG + Intronic
982362103 4:154530061-154530083 GCGAAGGAATGGTGAGAAGTTGG - Intergenic
983199595 4:164846584-164846606 CTGCAGCTGTGGTGTGAAGTGGG - Intergenic
983263389 4:165481750-165481772 TTGAAGTAATTGAGGGAAGTTGG + Intronic
985054798 4:186026873-186026895 CTGACGTAATGGTATTTAGTGGG - Intergenic
985178461 4:187228935-187228957 CTGAAGTTATGGTCTGAAGGAGG + Intergenic
987119942 5:14757551-14757573 CTGAGCTAATGGGGTGAAGTTGG + Intronic
990471495 5:56120325-56120347 ATGAAGAAATGGTGTTAAGAGGG - Intronic
990490768 5:56300773-56300795 CTGAACAAATGATGTGAATTTGG + Intergenic
996765696 5:127031936-127031958 ATGAGGCAATGGTCTGAAGTGGG - Intergenic
997419500 5:133754967-133754989 TTGAAGGAAGGGTGGGAAGTGGG - Intergenic
999286257 5:150396080-150396102 ATGAAGTCAGGGTGTGAAATTGG + Intronic
1000187410 5:158872802-158872824 CTGAATTAATGGTATGTAGCAGG - Intronic
1000707041 5:164525375-164525397 ATGAAATAATGGTATGAACTGGG - Intergenic
1001302193 5:170541697-170541719 ATAAAGTAATGTTGTGAAGAGGG + Intronic
1003023218 6:2530036-2530058 CTGAAGTCAAGGTGTGCAGCTGG + Intergenic
1003119799 6:3309957-3309979 CTGCAATCATGGTGTGATGTAGG - Intronic
1003214454 6:4096590-4096612 ATGCAGTAATTATGTGAAGTTGG + Intronic
1009044282 6:58218807-58218829 CAGAAGCAAAGGTGTCAAGTTGG - Intergenic
1009220109 6:60973072-60973094 CAGAAGCAAAGGTGTCAAGTTGG - Intergenic
1010278361 6:73994842-73994864 TTGAAGTCATGCTGTGAGGTTGG + Intergenic
1011406592 6:87022104-87022126 CTCAAGTAATGGTGTTGAGGTGG + Intergenic
1014989411 6:128055402-128055424 CCTAAGTAATGGTGTAGAGTTGG + Intronic
1016117135 6:140301322-140301344 CTTAAGTCATGATGGGAAGTGGG + Intergenic
1017683255 6:156885319-156885341 TTGAAGTATTGGTTTGAGGTGGG + Intronic
1020160512 7:5767647-5767669 CTGAAGTAATGGTGCGATCTTGG + Intronic
1020583007 7:10029451-10029473 GACAAGTAAAGGTGTGAAGTGGG + Intergenic
1021328303 7:19302069-19302091 CACAGGTAATGCTGTGAAGTAGG - Intergenic
1023921195 7:44631347-44631369 GTTAAGTAATGGTGGGAATTGGG + Intronic
1026019820 7:66698108-66698130 CTGAAGTACTGGTCTGAGGGTGG - Intronic
1026880544 7:73904460-73904482 CTGAAGTACTGGTCTGAGGGTGG + Intergenic
1027821296 7:83048569-83048591 CTGCAGTATTAGTGTGGAGTTGG - Intronic
1028213729 7:88106522-88106544 CTTAAGTCATACTGTGAAGTAGG + Intronic
1030164190 7:106536442-106536464 CTGCACTGATGGTGTGAAGATGG + Intergenic
1030886074 7:114939058-114939080 CTGAAGAAATGCTCTGAAGAGGG - Intronic
1032951070 7:136913726-136913748 TTGAAACAATGCTGTGAAGTGGG + Intronic
1034454003 7:151155022-151155044 CTGCAGTAATGGGGTGAATGAGG - Intronic
1035769632 8:2136614-2136636 GTGAAGCAATTGTGTGCAGTGGG + Intronic
1035983569 8:4400926-4400948 CTAAAATAAAGTTGTGAAGTTGG - Intronic
1036653506 8:10661068-10661090 GTGAATTCATGGTGTGAAGGGGG - Intronic
1042148782 8:65759411-65759433 CTGAAGCCAGGGTGGGAAGTGGG - Intronic
1043380548 8:79697520-79697542 CTCACGCAATGGTGTGATGTCGG + Intergenic
1043877225 8:85499246-85499268 CTTAAGTAATGGAGTAGAGTGGG - Intergenic
1044261826 8:90133966-90133988 CTGACATAATGGAGTGAATTTGG + Intergenic
1045673458 8:104583141-104583163 GTGGAGTATTGTTGTGAAGTGGG - Intronic
1046136867 8:110038402-110038424 GTGAAGAAATGGTTTCAAGTAGG - Intergenic
1046288082 8:112121449-112121471 ACGAAGTTAAGGTGTGAAGTAGG + Intergenic
1046665666 8:116999711-116999733 AAGAATTTATGGTGTGAAGTGGG - Intronic
1047038792 8:120969896-120969918 CTGAAATAATGACGTGAGGTGGG - Intergenic
1047882533 8:129212257-129212279 CTGAACTAAAGGTTTGAATTGGG + Intergenic
1051656215 9:19384379-19384401 CTTAAATAATTGTGTGAGGTTGG + Intergenic
1051745468 9:20291116-20291138 CGGAAGTCATGATGAGAAGTAGG + Intergenic
1053289929 9:36873135-36873157 CTGAGGCAATGGGGTGGAGTGGG - Intronic
1054957758 9:70932933-70932955 CAGAAGAGATGGTGAGAAGTAGG + Intronic
1055916464 9:81406829-81406851 CTGAAATAATGGACTGAAGAGGG + Intergenic
1056178229 9:84056544-84056566 TTAAAGGAATGCTGTGAAGTGGG - Intergenic
1056387815 9:86113511-86113533 ATGGAGAAATGGTGTGGAGTTGG + Intergenic
1057880134 9:98786999-98787021 CTGAGGTTGTGGTGTGGAGTTGG - Intronic
1059915462 9:119094787-119094809 CTGATTTAATGGTGTGAAAAGGG + Intergenic
1060210606 9:121707909-121707931 CTGACGAAATGTGGTGAAGTTGG - Intronic
1061693201 9:132352392-132352414 TTGAAGCAGTGGTTTGAAGTAGG - Intronic
1186958202 X:14706063-14706085 CTGATTTAATGGTCTGAGGTGGG - Intronic
1187755389 X:22519889-22519911 CTGAGGTGAAGGTGTGAACTAGG + Intergenic
1188452410 X:30321820-30321842 CTGGAGTAGTGGTGTGACCTCGG + Intergenic
1190522357 X:51293428-51293450 CTCAAGTCATGCTGTGTAGTAGG + Intergenic
1190787828 X:53669798-53669820 CTGAAGTAATGGTGTGAAGTAGG - Intronic
1192725099 X:73741673-73741695 CTGAAGTCATAGTGGGAAGAAGG - Intergenic
1193136856 X:77981402-77981424 GTGAAGGAATGGTGTAAAGAGGG + Intronic
1194816282 X:98446045-98446067 TTGGAGTAATGGTGAAAAGTAGG - Intergenic
1197152162 X:123231859-123231881 CAGAAGTATGGGTGTGTAGTAGG + Intronic
1198245011 X:134822095-134822117 ATGATGTCATGGTGTGAAGGTGG - Intronic
1199878651 X:151955202-151955224 CTGATGTAATGGTGAGAAGTTGG - Intronic