ID: 1190788597

View in Genome Browser
Species Human (GRCh38)
Location X:53678453-53678475
Sequence GGTTGATATTCATAAGTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190788597_1190788599 24 Left 1190788597 X:53678453-53678475 CCAAGTACTTATGAATATCAACC 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1190788599 X:53678500-53678522 AGCAGCCTAAAAGTCCTTAAAGG 0: 1
1: 0
2: 1
3: 11
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190788597 Original CRISPR GGTTGATATTCATAAGTACT TGG (reversed) Intronic
903044788 1:20556613-20556635 GGTTGTTCTTCACATGTACTGGG - Intergenic
906783004 1:48589301-48589323 GTTTGACATTCAAAAGTTCTGGG + Intronic
909248376 1:73320188-73320210 AGATCATATTCTTAAGTACTTGG - Intergenic
911659461 1:100484937-100484959 GATTAATATTCATAACTACCTGG + Intronic
914823902 1:151127220-151127242 GGGTGATAGTCTTAAGTAATGGG + Intergenic
1064721891 10:18237229-18237251 AGATTACATTCATAAGTACTGGG - Intronic
1068612060 10:59071061-59071083 AGGTCATATTCATAAGTATTAGG - Intergenic
1073388170 10:103145862-103145884 GGTTAATATTTATATTTACTTGG - Intronic
1074127871 10:110544265-110544287 GTTTCATATTCATAGGTTCTAGG + Intergenic
1082705784 11:56493009-56493031 GGTTGACATTCTTAAGTTTTAGG + Intergenic
1082706954 11:56503860-56503882 GGTTGACATTCTTAAGTTTTAGG + Intergenic
1091311964 11:134580996-134581018 GGTGCATATTCATAGGTTCTTGG - Intergenic
1097378749 12:58869203-58869225 GGTTGATATCCATGAATACCTGG - Intergenic
1098657749 12:73054617-73054639 GGTTGATAATAATTAGTTCTTGG - Intergenic
1099928515 12:89046888-89046910 GGTTCATTTTCATATGAACTTGG + Intergenic
1103275663 12:119709703-119709725 GGTTGATATACTGAAGAACTTGG + Intronic
1109231623 13:59764515-59764537 GGTTGACATTCACAGGTACTAGG - Intronic
1114237933 14:20838378-20838400 TCTTGATAATCAGAAGTACTTGG + Intergenic
1117142751 14:52806448-52806470 GGTGCATATTAGTAAGTACTAGG - Intergenic
1125159765 15:36629304-36629326 GTTTGATTTTGATAAGTAGTTGG + Intronic
1125276458 15:37997117-37997139 GTTTGACAGTCATAAGTTCTGGG + Intergenic
1126641528 15:50831721-50831743 AGGTGATATTCATAGGTACTGGG + Intergenic
1127285817 15:57532844-57532866 GATTGTTATTCATAACCACTTGG + Intronic
1128795801 15:70465719-70465741 GGTTGGACTTCATAACTACTTGG + Intergenic
1128820282 15:70646145-70646167 GGGTGACATTCACAAGTTCTAGG - Intergenic
1130006885 15:80108097-80108119 GATTGGTATTTATAAGTGCTTGG + Intronic
1130366292 15:83242556-83242578 GCTTGATATTGATAATCACTAGG + Intergenic
1130641847 15:85683774-85683796 GGTTGATTTTCTTAAATGCTGGG - Intronic
1133543324 16:6777713-6777735 GCTTGATATTCATAACTGGTGGG + Intronic
1135359543 16:21800667-21800689 GCATGATATTAAAAAGTACTCGG + Intergenic
1135437009 16:22435642-22435664 GCATGATATTAAAAAGTACTCGG + Intronic
1137492788 16:48946775-48946797 GTTTGATTTTGATAAGTTCTTGG + Intergenic
1141978688 16:87535695-87535717 GGTAGATATCCACAAGTTCTGGG + Intergenic
1148141345 17:45331228-45331250 TGTTTATATTCATATGTAATGGG - Intergenic
1148666004 17:49375398-49375420 GCTTCAGATTCATTAGTACTAGG + Intronic
1151008978 17:70472069-70472091 GGTTCTCATTCATAGGTACTAGG + Intergenic
1151610771 17:75173089-75173111 AGTTGAAATTCAAAAGTACATGG + Intergenic
1153775849 18:8452982-8453004 TGTTGATATTGATAAATACTTGG - Intergenic
1156040287 18:32812966-32812988 GGTTGAAATTCTTAAGAAATAGG + Intergenic
1157298857 18:46465374-46465396 GGTAGATATTGATAAGGTCTGGG - Intergenic
1157962415 18:52170363-52170385 AGATCATATTCATAGGTACTGGG - Intergenic
1158343522 18:56491156-56491178 AGTTCATATTCAAAACTACTAGG - Intergenic
1159432858 18:68378069-68378091 GTTTGACAATCATAAGCACTTGG - Intergenic
1159789231 18:72756565-72756587 GTATGTTATTCATTAGTACTTGG - Intronic
1159852951 18:73547993-73548015 GGTTGATGGTCATAATTACCTGG + Intergenic
925714360 2:6771184-6771206 GGTTCACATTCATAAATAATTGG - Intergenic
926062182 2:9811614-9811636 GGTTCACCTTCACAAGTACTGGG - Intergenic
926407170 2:12567382-12567404 GGTTGTAATCCAGAAGTACTTGG + Intergenic
928689474 2:33784267-33784289 AGGTCATATTCACAAGTACTAGG - Intergenic
931227379 2:60343234-60343256 GGTTGATTTTGGAAAGTACTTGG - Intergenic
931554452 2:63486408-63486430 TGTTTATATTCCTAAGTAATAGG + Intronic
933053838 2:77636043-77636065 GATTGATTTTCGTATGTACTTGG + Intergenic
939485097 2:142801645-142801667 GGTTGTTATTAAGAAGTACGTGG + Intergenic
943770180 2:191707949-191707971 GGATGTTATTTATAAGTATTTGG - Intergenic
945960260 2:216126277-216126299 GATTGTTAATCATAAGTTCTAGG + Intronic
1169411247 20:5372285-5372307 GGTTGAGAGTCATAAGTGCCTGG + Intergenic
1175559075 20:59903292-59903314 TATTGATATCCATAAATACTTGG - Intronic
1177829323 21:26119534-26119556 GGTTGATAAACATTAGTAGTTGG - Intronic
957381603 3:79437278-79437300 GCTTGATATTCATATTAACTTGG - Intronic
959018659 3:101164662-101164684 GGTAGAAATTCATAATTACTGGG - Intergenic
961715764 3:128856436-128856458 GGTCTATATTCATTAGTCCTTGG + Intergenic
963423535 3:145093634-145093656 GGTTAATATTCATAGGTCCTGGG - Intergenic
964825969 3:160828549-160828571 GGTTGATAATGTTAGGTACTAGG + Intronic
964978819 3:162652773-162652795 GGTTTATTTTCATAAGATCTTGG + Intergenic
965640569 3:170824904-170824926 GGATTATATTAGTAAGTACTGGG + Intronic
971755552 4:30703210-30703232 GATTAATATTCATAAGATCTCGG - Intergenic
973821872 4:54668969-54668991 GGTTGATATTGATATTTATTTGG + Intronic
974134321 4:57795467-57795489 AGTTTATATTCATAGGTTCTAGG + Intergenic
974589731 4:63929463-63929485 GGTGGATATTAATAAGGACATGG - Intergenic
975058708 4:69969878-69969900 GATTGCTATTCATAAGTGTTTGG + Intergenic
975692869 4:76983113-76983135 GAGTGATATTCACAAGTTCTGGG - Intronic
976053531 4:81035016-81035038 GCTTGAAATTTAAAAGTACTTGG + Intronic
977711210 4:100128053-100128075 GGTTGATATTCTCAAATACATGG + Intergenic
978629994 4:110733148-110733170 GGTTGATTTACATCAGTATTTGG + Intergenic
980016970 4:127660896-127660918 GGTTGATATACATAAATATTAGG - Intronic
980690756 4:136293291-136293313 GTTTGAAATTCAGAAGTATTAGG - Intergenic
981636746 4:146890220-146890242 AGGTCACATTCATAAGTACTGGG + Intronic
984463872 4:180072207-180072229 AATTCACATTCATAAGTACTGGG + Intergenic
984841499 4:184072329-184072351 GGTTGATATTCACAGGTATGTGG + Intergenic
986516544 5:8570494-8570516 GGTTGTTATTCATAAGGATGTGG - Intergenic
986868710 5:12020801-12020823 GGTCTATATTCGTAAGAACTTGG - Intergenic
987750818 5:22037199-22037221 GGGTAATATTCATAAGTTCCAGG - Intronic
990598646 5:57335446-57335468 GGAAGATACTCATAAGTAGTTGG + Intergenic
995488042 5:112658777-112658799 GGTTCACATGCATAAATACTTGG - Intergenic
995855103 5:116583356-116583378 AGTTTATGTTAATAAGTACTTGG - Intergenic
997765970 5:136503643-136503665 GCTTTATATTCATATGCACTGGG - Intergenic
1002287068 5:178170652-178170674 TGTAAATATTCATGAGTACTTGG + Intergenic
1004820221 6:19360043-19360065 TTTTGATATACATAAGAACTAGG - Intergenic
1005921007 6:30401622-30401644 GGATGATATGCATAGGTAGTAGG - Intergenic
1006754331 6:36402065-36402087 CCTTGATATTCCAAAGTACTGGG + Intronic
1009528754 6:64782117-64782139 GGTTGGTATTCATAAGTTATTGG + Intronic
1009618573 6:66042553-66042575 GGCTCATATTCATAAAGACTGGG - Intergenic
1013832618 6:114292613-114292635 GAGTCATTTTCATAAGTACTGGG + Intronic
1013945296 6:115715870-115715892 GAATGATATCCATAAGTACTTGG - Intergenic
1014596127 6:123342023-123342045 GGTTCAATTTCATAATTACTAGG + Intronic
1015471096 6:133607313-133607335 GCTGGAGATTCATAAATACTAGG + Intergenic
1016266218 6:142235258-142235280 AGATCATATTCACAAGTACTGGG - Intergenic
1016618040 6:146075960-146075982 AGGTCACATTCATAAGTACTGGG + Intronic
1020402366 7:7793526-7793548 GGGAGATATTTTTAAGTACTGGG + Intronic
1020560061 7:9719592-9719614 GGTTAATATTGCTAAGAACTGGG + Intergenic
1021134254 7:16946282-16946304 GGTTGATATTTTTATGTAATAGG - Intergenic
1022683622 7:32573757-32573779 GCTTCATATTCATCAGTATTTGG + Intronic
1032622857 7:133555433-133555455 GGTTTATATTCAGAAGCCCTAGG + Intronic
1036763641 8:11531585-11531607 GGTTGATATTCTTGAGTCTTCGG + Intronic
1041337163 8:56799365-56799387 TGTTCATATTCATGAGTTCTAGG + Intergenic
1043729541 8:83657425-83657447 GGTTAACATTCATATGTATTAGG + Intergenic
1044819525 8:96146010-96146032 TGTAGATAATCCTAAGTACTGGG - Intronic
1046979214 8:120318508-120318530 GTTAGATATTAATAATTACTGGG + Intronic
1056765257 9:89441216-89441238 GGTTGGTATTCGTAAGGTCTGGG - Intronic
1058198211 9:102005473-102005495 TGCTGATATTCTTAAGTACATGG + Intergenic
1059850806 9:118337049-118337071 AGGTTACATTCATAAGTACTTGG - Intergenic
1060435656 9:123590548-123590570 GGTTAATATTTTAAAGTACTTGG + Intronic
1061767893 9:132893716-132893738 GCTTGGTATTCATAAATATTGGG - Exonic
1187228887 X:17401875-17401897 AGGTCATATTCACAAGTACTGGG + Intronic
1187632389 X:21188497-21188519 GGTTAATATTCATTAGTGCTGGG + Intergenic
1190788597 X:53678453-53678475 GGTTGATATTCATAAGTACTTGG - Intronic
1197195670 X:123698480-123698502 GTTTGATCTTCATGAGTATTAGG - Intronic