ID: 1190789730

View in Genome Browser
Species Human (GRCh38)
Location X:53687048-53687070
Sequence GCGGAGGGTGGGAGACGACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 267}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190789715_1190789730 27 Left 1190789715 X:53686998-53687020 CCTTGTGAAGAATGGGGAGTGTG 0: 1
1: 0
2: 0
3: 28
4: 298
Right 1190789730 X:53687048-53687070 GCGGAGGGTGGGAGACGACGTGG 0: 1
1: 0
2: 1
3: 18
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190789730 Original CRISPR GCGGAGGGTGGGAGACGACG TGG Intergenic
900107012 1:986606-986628 GCTGAGTGTGGGTGAGGACGAGG - Intergenic
901775547 1:11558416-11558438 GAGGCGGGTGGGAGAGGACGAGG - Intergenic
903218516 1:21855871-21855893 GCGGATGGATGGAGACCACGGGG + Exonic
903240716 1:21980964-21980986 GGGGAGGGTGGGTGATGATGGGG + Intronic
903548462 1:24141661-24141683 GAGGAGGGTGGGAGAAGAGGGGG - Intronic
904053453 1:27655195-27655217 GTGAAGGATGGGAGACCACGTGG + Intergenic
905461531 1:38125914-38125936 GTGGAGTGTGGGAGGGGACGGGG + Intergenic
905533904 1:38703674-38703696 GTGGAGGATGGGAGAACACGTGG - Intergenic
907091288 1:51728757-51728779 GCGGAGGCTGGGAGAGGCGGGGG - Intronic
907403324 1:54238929-54238951 GCAGGGGGTGGGAGAGGAAGGGG - Intronic
907404093 1:54243177-54243199 GCAGAGGGTGGGGGAAGACCTGG + Intronic
907471753 1:54678880-54678902 GCGGAGGGTGGGGGGTGAGGAGG + Intronic
908416189 1:63915592-63915614 GCAGAGGGTGGGAGATGTTGTGG - Intronic
909441041 1:75696659-75696681 GCCGAGGCGGGGAGACCACGAGG + Intergenic
911429631 1:97767548-97767570 ACGGAGGATGAGAGACGACAGGG + Intronic
916173970 1:162022829-162022851 GCAGAGGGTGGGACACCAGGCGG - Intronic
916667086 1:166975902-166975924 GGCGAGGGTGGGGGACGGCGGGG + Intronic
919763352 1:201111935-201111957 GAGGAGGGTGGGGGAGGAGGAGG - Intronic
919763363 1:201111963-201111985 GAGGAGGGTGGGGGAGGAGGAGG - Intronic
920706285 1:208252950-208252972 GCAGGGGGTGGGAGATGAGGAGG - Intergenic
921564988 1:216706047-216706069 GCTGGGGGTGGGGGACGAGGAGG - Intronic
922416534 1:225427781-225427803 GAGGAGGGGAGGAGACGAGGAGG + Intronic
923696111 1:236254111-236254133 GGGGAGGGTGGCAGAGAACGAGG + Intronic
1062880399 10:973583-973605 GCCGAGGCAGGGAGACCACGAGG - Intergenic
1063371299 10:5524665-5524687 GCGGCAGGTGGGAGACGGGGAGG + Exonic
1063443053 10:6089080-6089102 GCGAAGGGTGGGCGCCGCCGAGG + Intronic
1063876493 10:10484236-10484258 GGGGAGGGAGGGAGAGGAGGGGG - Intergenic
1067015741 10:42755313-42755335 GCGTGGGGTGGGAGCCGACCCGG + Intergenic
1067473434 10:46551676-46551698 ACGGAGGGTGGGGGACAATGAGG - Intronic
1067597065 10:47566431-47566453 GCGGTGGGTGGGGGAAGAAGGGG - Intergenic
1068760234 10:60699127-60699149 GGGAAGGGTGGGAGGGGACGAGG + Intronic
1069872989 10:71544511-71544533 GCAGAGGGTGGGAGCGGGCGTGG - Intronic
1069982240 10:72260769-72260791 GGGGAGGGAGGGAGAGGCCGAGG - Intergenic
1070791904 10:79194680-79194702 GCGGAGGTGGGGAGAGGAAGAGG - Intronic
1070812540 10:79305624-79305646 GCAGGGGGTGGGAGGGGACGAGG + Intronic
1071621834 10:87127537-87127559 GCGGGGGGTGGCAGACGGGGTGG - Intronic
1072904741 10:99442409-99442431 GGGAAGGGTGGGAGACAAAGAGG - Intergenic
1076854510 10:133109265-133109287 GCGGGGGCTGGGAGAGGAGGAGG - Intronic
1077368488 11:2170814-2170836 GGGGAGGGCGGGGGAGGACGGGG + Intronic
1078066193 11:8081041-8081063 GCCGAAGGTGGGAGCCGGCGCGG + Intronic
1081504115 11:43697010-43697032 GCGGGGGGTGGGAGGCAAGGGGG + Intronic
1081666669 11:44920687-44920709 GGAGAGGGAGGGAGAGGACGAGG + Intronic
1082786641 11:57320784-57320806 TCGGAGGGTGGGAGATGAGGTGG - Intronic
1083040952 11:59686411-59686433 GGGGAGGGTGGGGGAAGATGAGG + Intergenic
1083450348 11:62740097-62740119 GCGGGGGGTGGGAGAACATGAGG - Intronic
1084376839 11:68783463-68783485 GCAGAGGGTGGGAGCAGACCAGG - Intronic
1088501163 11:110484591-110484613 GCAGAGGGTGGGAGGGGAGGTGG - Intergenic
1088896988 11:114085933-114085955 GGGGAGGGTGTGAGACCATGTGG + Intronic
1089729683 11:120512175-120512197 GCGGAGGGAGGGAGACGGACCGG - Intronic
1090320979 11:125843362-125843384 GGGGAGGGTGAGAGGTGACGAGG - Intergenic
1090372803 11:126268592-126268614 GGGGAGGGTGGGAGGAGGCGCGG + Intronic
1091323031 11:134665061-134665083 GCTGAGGGTGGGAGCTGACTGGG + Intergenic
1095717483 12:45363328-45363350 GCTGAGGGTGGCAGATCACGAGG + Intronic
1095991299 12:48036432-48036454 GAGGTGGGTGGGAGGCGATGTGG + Intergenic
1096117001 12:49060585-49060607 GCGGAGGGGGGGAGGCGGAGCGG - Intergenic
1096313594 12:50543993-50544015 GAGGAGGCTGGCAGACCACGAGG + Intronic
1096838086 12:54363868-54363890 GCAGAGGGTGGAAGAGGAAGAGG + Exonic
1102236621 12:111298081-111298103 GCAGGGGGTGGGAGACGCGGGGG - Intronic
1102503153 12:113366790-113366812 GGGGAGGGAGGGAGAGGAGGAGG - Intronic
1106447669 13:29850664-29850686 GCGGAGGGAGGACGAGGACGGGG - Exonic
1106856238 13:33856339-33856361 GTGGAGGGTGGGAGGAGAAGAGG + Intronic
1108229828 13:48325117-48325139 GTGGAGGGTGGGAGAGGAAGCGG - Intronic
1108382547 13:49868181-49868203 GGGGAGGGTGGGAGGCCACCAGG - Intergenic
1108541798 13:51452725-51452747 GCGGAGGCGGGGGTACGACGGGG - Exonic
1108573186 13:51769803-51769825 GCAGAGGGTGGGACACCTCGAGG - Intronic
1110975615 13:81830264-81830286 GGGGAGGATGGGAGACGGAGAGG + Intergenic
1111350148 13:87017813-87017835 GTGGAGGGTGGGAGAGGGAGAGG - Intergenic
1113200760 13:107866201-107866223 GGGCAGGGTGGGGGACGAGGAGG + Exonic
1113699773 13:112375823-112375845 GGGGAGGGTGGGAGGGGACATGG + Intergenic
1113759371 13:112836987-112837009 GCTGAGGGTGGGGGGAGACGAGG - Intronic
1114638987 14:24206431-24206453 GCTGAGGGTAGGAGACGGCTGGG + Intronic
1114663992 14:24368037-24368059 AGGGAGGGTGGGGGAGGACGAGG + Intronic
1118248249 14:64132966-64132988 GCGGAGGGGGGCAGATCACGAGG + Intronic
1119808695 14:77499003-77499025 GAGGAGGGTGGGGGACGTCCAGG - Intergenic
1122856107 14:104561013-104561035 GAGGAGGGTGGGAGGTGAGGGGG - Intronic
1122931340 14:104934049-104934071 GGGGAGGGCGGGAGGCGACCCGG + Exonic
1125310412 15:38372985-38373007 GCGGAGGGTGGGGGAGGGGGCGG - Intergenic
1126014470 15:44336680-44336702 GCCGAGGTTGGCAGATGACGAGG + Intronic
1126671642 15:51120831-51120853 GAGGAGGGTGGGAGAAGGCCAGG + Intergenic
1129334156 15:74842629-74842651 GCCGAGGGTTGGAGAAGACCAGG - Intronic
1129976464 15:79826406-79826428 GAGGTGGGTGAGAGACGAAGGGG + Intergenic
1131148470 15:90031702-90031724 GCAGAGAGTGAGAGATGACGTGG - Intronic
1131174627 15:90201886-90201908 GCGGAGGGAGGGAGAGGAGAGGG + Intronic
1131263900 15:90904412-90904434 GCGGGGGGTGGGAGGGGAGGCGG - Intronic
1132641577 16:980798-980820 GCGGAGGCGGGGAGAGGGCGGGG - Intronic
1133392373 16:5420862-5420884 GGGGAGGGAGGGAGAGGAGGAGG - Intergenic
1134034042 16:11015926-11015948 CCAGAGGCTGGGAGACGAGGAGG + Intronic
1135100661 16:19602532-19602554 GGAGAGGGTGGGAGAGGAGGAGG - Intronic
1136120870 16:28133101-28133123 GCAGAGGCGGGCAGACGACGAGG + Intronic
1136298912 16:29320381-29320403 GAGGAGGGTGGGAGCCCAGGAGG + Intergenic
1137467795 16:48726690-48726712 GCGGAAGGAGGGAGAAGACATGG + Intergenic
1137521748 16:49200895-49200917 GAGGATGGTGGGAGAAGAGGAGG - Intergenic
1137820931 16:51445223-51445245 TCGGAGGCTGGGAGCCGAGGTGG - Intergenic
1141028367 16:80568553-80568575 GGGGAGGGTGGGAGAGGTGGGGG - Intergenic
1141028380 16:80568587-80568609 GGGGAGGGTGGGAGAGGTGGGGG - Intergenic
1141028404 16:80568655-80568677 GGGGAGGGTGGGAGAGGTGGGGG - Intergenic
1141028417 16:80568689-80568711 GAGGAGGGTGGGAGAGGTGGGGG - Intergenic
1141028427 16:80568723-80568745 GGGGAGGGTGGGAGAGGTGGGGG - Intergenic
1141028439 16:80568757-80568779 GGGGAGGGTGGGAGAGGTGGGGG - Intergenic
1142060593 16:88026936-88026958 GAGGAGGGTGGGAGCCCAGGAGG + Intronic
1143724371 17:8835326-8835348 GCAGGGCGTGGGAGACCACGTGG + Exonic
1143823726 17:9587008-9587030 GTGGAGGGTGGGAGAGGGAGAGG - Intronic
1144869949 17:18363253-18363275 GCAGAGGGTGGGGTACGGCGGGG + Intronic
1147261725 17:39212940-39212962 GCGGAGGGAGGGAGTGGGCGGGG - Intronic
1147361906 17:39936109-39936131 GCCGAGGGTGGGAGGCTAAGAGG + Intergenic
1148388506 17:47253747-47253769 GCGGTGGGTGGGACGCAACGGGG - Intergenic
1148856430 17:50581489-50581511 GGGGATGGTGGGAGAGGACAGGG - Intronic
1149224898 17:54458323-54458345 ACCGAGGGTGGGAGACCACGAGG + Intergenic
1149806142 17:59619837-59619859 GCGGAGGGGGTGAGGCGACTGGG + Exonic
1149850152 17:60029273-60029295 TGAGAGGGAGGGAGACGACGTGG - Intergenic
1149860014 17:60117251-60117273 TGAGAGGGAGGGAGACGACGTGG + Intergenic
1152151147 17:78602171-78602193 GCCTAGGGTGGGAGAGGATGGGG + Intergenic
1152649178 17:81484015-81484037 GCAGAGGGTGGGGGAAGGCGTGG + Intergenic
1152697315 17:81803736-81803758 GCGGAGGGAGCGAGAGGAAGGGG + Intergenic
1152718585 17:81911517-81911539 GCGGAGGGCGGGAGGCGGGGCGG - Intergenic
1152872698 17:82766386-82766408 ACGGAGGGCTGGAGACGAGGGGG - Intronic
1154335643 18:13462687-13462709 GCGGAAGGTGGGAGTCCAGGAGG + Intronic
1155392464 18:25351026-25351048 GCGGAGGGCGCGAGGCGCCGCGG - Intronic
1158614357 18:58972562-58972584 GGGGTGGGTGGGTGACGAAGGGG - Intronic
1159369853 18:67516481-67516503 CCGTAGCGCGGGAGACGACGCGG - Exonic
1159475832 18:68920103-68920125 GTGGAGGGTGGGAGAGGGAGAGG - Intronic
1159918258 18:74204686-74204708 GGTGAGGGTGGGAGAAGAAGGGG + Intergenic
1159918301 18:74204794-74204816 GGTGAGGGTGGGAGAAGAAGGGG + Intergenic
1160698389 19:495260-495282 GAGGAGGGTGGGGGGCGAGGGGG + Intronic
1160872207 19:1282557-1282579 GAGGAGGGTGGGAGGGGAGGAGG + Intergenic
1161370686 19:3909319-3909341 CTGCAGGGTGGGAGAGGACGTGG - Intronic
1161642487 19:5432905-5432927 GGGGAGGGTGGGAGGTGTCGAGG + Intergenic
1161746025 19:6060803-6060825 GCCGAGGGTGGGAGACAAGCAGG - Intronic
1161800356 19:6414161-6414183 GGGAAGGGTGGGAGACTAGGGGG + Intronic
1166294866 19:41883998-41884020 GCTGGGGGTGGGAGACGGAGGGG + Intronic
1167095460 19:47372993-47373015 GCTGAGGGTGGGACACGAGGAGG - Intronic
1167789748 19:51666792-51666814 AGGGAGGGAGGGAGACGATGTGG + Intergenic
1167798163 19:51724219-51724241 GAGGAGGGAGGGAGAGGAGGGGG - Intergenic
926329123 2:11810389-11810411 GGGGAGGCTGGGAGACGAGCAGG + Intronic
927476217 2:23416336-23416358 GAGGAGGGAGGGAGACAAAGAGG - Intronic
927886796 2:26723779-26723801 GAGGAGGCTGGGAGAGGAGGCGG + Intronic
928280017 2:29937737-29937759 GGGGATGATGGGAGATGACGGGG + Intergenic
928280023 2:29937757-29937779 GGGGATGATGGGAGATGACGGGG + Intergenic
932717815 2:74115421-74115443 GGGGAGGATGGGAGACGACACGG + Intergenic
933564650 2:83935114-83935136 GCGGAGGTTGGCAGATCACGAGG + Intergenic
934978722 2:98823220-98823242 GCGGAGAGTGGGGGCCGACTCGG + Exonic
935191111 2:100779574-100779596 GCGGGGGGCGGGAGACAACTTGG - Intergenic
935671387 2:105559871-105559893 GTGGAGGGTGGGAGTGGAGGTGG - Intergenic
936080670 2:109430486-109430508 GGAGAGGATGGGAGAGGACGGGG - Intronic
936141789 2:109947604-109947626 GCGGAGGACGGGCGACGGCGGGG - Intergenic
936178477 2:110245552-110245574 GCGGAGGACGGGCGACGGCGGGG - Intergenic
936202901 2:110423880-110423902 GCGGAGGACGGGCGACGGCGGGG + Exonic
936377160 2:111951142-111951164 GGGGAGGGAGGGAGGCGACAGGG + Intronic
936524876 2:113235586-113235608 CCGGAGGGAGGGAGACAACAAGG + Intronic
937497916 2:122443907-122443929 GTGGAGGGAGGGAGAAGATGGGG - Intergenic
940226928 2:151410123-151410145 GCGGAGGGCGGGAGAAGCCCGGG - Exonic
944402705 2:199346380-199346402 GCTGAGGGTGGCAGATCACGAGG - Intronic
946194920 2:218027193-218027215 GCTCAGGGTGGAAGACGACAGGG - Intergenic
946306690 2:218860314-218860336 GCGGGGGGTGGGAGAGAACCCGG - Intronic
946326220 2:218985826-218985848 GCAGAGAGTGGGAGAAGAGGAGG - Intergenic
947593514 2:231397556-231397578 GGGCAGGGTGGGAGAGGAAGCGG + Intronic
947714596 2:232333309-232333331 GCGGGGGGTGGGGGAGGAGGAGG - Intronic
948196988 2:236103799-236103821 GCCGAGGTTGGCAGACCACGAGG - Intronic
948983715 2:241508038-241508060 GCGGAGGGTCTGAGGCGGCGCGG - Exonic
1168845305 20:940398-940420 GCAGAGGGTGGGAGGTGAGGAGG + Intergenic
1168897801 20:1335889-1335911 GGGGAGGGTGGGAGAGGTTGAGG + Intronic
1169062828 20:2673916-2673938 GCTGAGGCTGGGAGATGACGAGG + Intergenic
1170603178 20:17857361-17857383 GCTGAGGATGAGAGACCACGTGG - Intergenic
1170622718 20:18008933-18008955 GCTGAGGGGGGCAGACCACGAGG - Intronic
1172650687 20:36499708-36499730 GCGGAGGGAGGGAGAGGAGAGGG - Intronic
1172753507 20:37267787-37267809 GCGGGGGGTGGGGGAGGATGGGG + Intergenic
1173594189 20:44248044-44248066 GTGGGGGGTGGGCGACGACTGGG - Intronic
1173673017 20:44810764-44810786 GCTGAGGGTGGGGGCCGAGGCGG - Intergenic
1174198568 20:48790926-48790948 GGGGAGGGTGGGAGCTGATGGGG - Intronic
1174358855 20:50015539-50015561 GGGGAGGGGGGGAGGGGACGAGG - Intergenic
1175294209 20:57897318-57897340 GGGGACTGTGGGAGACGAGGAGG + Intergenic
1176044517 20:63085426-63085448 GCAGAGGGAGGGAGGCCACGGGG + Intergenic
1176142101 20:63549263-63549285 GTGGAGGGGAGGAGACGGCGGGG - Intronic
1178521397 21:33290760-33290782 GTGCAGGGTGGGATACGACCAGG + Intronic
1181495278 22:23284092-23284114 GCGGAGGGTGAGTGACGATGTGG + Exonic
1183353968 22:37348772-37348794 GGGGAAGGTGGGAGAGGACATGG + Intergenic
1183417489 22:37690934-37690956 GGGGTGGGTGGGACAGGACGGGG - Intronic
1183540807 22:38428305-38428327 GCGGAGGGTGGCAGCAGAGGTGG + Intronic
1184561816 22:45268269-45268291 GTGGAGGATGGGGGGCGACGGGG - Intergenic
1184697825 22:46149959-46149981 GCGTAGGGTGGGAGGCGGCCCGG - Intergenic
1184807184 22:46802800-46802822 GAGTAGGGTGGGAGACTAGGGGG + Intronic
950360034 3:12443659-12443681 CTGGAGGGTGGGAGACCACGAGG + Intergenic
950457540 3:13101605-13101627 GCAGTGGGTGGGAGAGGAAGGGG + Intergenic
950601687 3:14040819-14040841 GGAGGGGGTGGGAGACGAAGGGG + Intronic
952898114 3:38092718-38092740 GAGGAGGGTGGGAGGCGGGGAGG + Intronic
953563495 3:44012670-44012692 GCGGAGATGGGGAGACGATGGGG - Intergenic
954325343 3:49860434-49860456 GGGGAGGGTGGGAGAGGCCAGGG - Intronic
956788160 3:72660004-72660026 GCAGAGGGTGGCAGAAGAAGGGG - Intergenic
959766571 3:110037499-110037521 GTCGAGGGTGGCAGATGACGAGG - Intergenic
959849738 3:111072004-111072026 GGGGAGGGTGGGGGATGGCGCGG + Exonic
960715121 3:120567614-120567636 GGGGAGGGAGGGAGACAAGGGGG - Intergenic
960995239 3:123336199-123336221 GCGGAGGGTGGGCCAGGATGGGG - Intronic
962275717 3:134011903-134011925 GAGGAGTGTGAGAGATGACGTGG + Intronic
962444647 3:135453611-135453633 GCGGAGGGTGGGAGAGGCCAAGG - Intergenic
964671376 3:159229779-159229801 GAGGAGGATGGGAGAGGAGGAGG - Intronic
967605535 3:191440923-191440945 GTGGAGGGTGGGAGAGGGCGAGG + Intergenic
968541289 4:1169640-1169662 ATGGAGGGTGGAGGACGACGGGG + Intronic
968613843 4:1568677-1568699 GGGGTGGGTGGGAGGCGGCGCGG - Intergenic
968613854 4:1568702-1568724 GGGGTGGGTGGGAGGCGGCGCGG - Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968915264 4:3494515-3494537 GTGGAGGGTGGGCGAGGAGGCGG - Intronic
969724874 4:8912938-8912960 GGGGAGGGTGGGGGCCGGCGTGG - Intergenic
971426383 4:26520080-26520102 GCAGAGGGTGGCAGACGTAGGGG - Intergenic
971975673 4:33683295-33683317 GGGGAGGGTGGGAGAGGAGTGGG - Intergenic
972759811 4:42092171-42092193 GCGGAGGCTGGCAGATCACGAGG - Intergenic
977492579 4:97733439-97733461 GGGGAGGGTGGGAGAGGAATAGG + Intronic
983049601 4:163030554-163030576 GCCGAGGCTGGCAGACCACGAGG - Intergenic
983308066 4:166019307-166019329 GGAGAGGGTGGGAGGCGACAAGG + Intronic
985651310 5:1109033-1109055 GCTGAGGGTGGGAGACCTGGGGG + Intronic
985808872 5:2068680-2068702 GTGGAGGGTGGGAGGAAACGTGG + Intergenic
986311371 5:6553364-6553386 GTCGAGGGTGGGAGACGGGGAGG + Intergenic
988314104 5:29601687-29601709 GGGGAGGGTGGGAGAGGAGGAGG - Intergenic
988578070 5:32445174-32445196 GCGGAGGGAGGGAGAAGGAGAGG + Intergenic
988985403 5:36613762-36613784 GCAGAGGCTGGGAGAGGAGGAGG + Intronic
989794663 5:45452544-45452566 GTGGAGGGTGGGAGAGGGAGAGG - Intronic
994149227 5:96429593-96429615 GTGGAGGGTGGGAGAAGAGAAGG - Intronic
996425150 5:123305983-123306005 GCGGAGGGTGGGGGGCAATGGGG - Intergenic
999029552 5:148275893-148275915 GCGGAGGCGGGCAGACCACGAGG - Intronic
1000311078 5:160045435-160045457 GTGGAGGGTGGGGGATGTCGGGG - Intronic
1002916768 6:1535417-1535439 GCGGAGGGTGGGGCAGGAAGCGG + Intergenic
1003146825 6:3516682-3516704 GGGGAGTGGGGGAGATGACGGGG - Intergenic
1003146899 6:3516920-3516942 GGGGAGTGGGGGAGATGACGGGG - Intergenic
1003147002 6:3517239-3517261 GGGGAGTGGGGGAGATGACGGGG - Intergenic
1005959914 6:30687218-30687240 GAGGAGGGAGGGAGAGGAGGAGG + Exonic
1006441594 6:34056777-34056799 GCGGAGGGAGAGAGACCAGGAGG + Intronic
1006798878 6:36746993-36747015 GAGGAGGGTAGGAGATGACCTGG - Intronic
1006994022 6:38241056-38241078 GCTGAGGGTGGGAGAAGGAGGGG - Intronic
1007514527 6:42400679-42400701 GCTGGGGATGGGAGAAGACGAGG + Intronic
1011370473 6:86632141-86632163 GTGGAGGGTGGGAGAAGGAGAGG - Intergenic
1012396758 6:98806951-98806973 GCTGAGGCAGGCAGACGACGAGG - Intergenic
1014827593 6:126064132-126064154 GGGGAGGGAGGGAGAAGATGGGG + Intergenic
1018697198 6:166399590-166399612 GCGGAGGTTGGGTGAAGATGTGG + Intergenic
1018864781 6:167737846-167737868 GTGGAGGGTGACAGACGAGGAGG - Intergenic
1019748739 7:2715452-2715474 GCTGAGGGTGGGAGCCCACTGGG + Exonic
1020050054 7:5075497-5075519 GATGAGGGTGGGAGAGGATGGGG + Intergenic
1021452901 7:20798439-20798461 TCGGGGGGTGGGAGAGGAGGAGG - Intergenic
1022704531 7:32790036-32790058 GAGGAGGGTGGGTGGCGATGGGG - Intergenic
1026967763 7:74451267-74451289 AGGCAGGGTGGGAGACGACCTGG + Intergenic
1027162576 7:75813447-75813469 GGGGAGGCTGGGAAAAGACGTGG - Intronic
1029462900 7:100706394-100706416 GAGGTGAGTGGGAGAGGACGAGG + Intronic
1029667838 7:102007428-102007450 GCGGAGGGTGGGAGGTGAGGAGG - Intronic
1030839203 7:114327732-114327754 GCTGAGGGTGGCAGATCACGAGG - Intronic
1032086335 7:128885754-128885776 GCGCAGGGTGTGGGACGAGGGGG + Intronic
1032288789 7:130567246-130567268 GTGTAGGGTGGGAGAGGATGAGG + Intronic
1032508703 7:132455064-132455086 GAGGAGGTTGGGAGACGTCTGGG + Intronic
1034075638 7:148228587-148228609 GCTGAGGCTGGCAGATGACGAGG + Intronic
1034182121 7:149147335-149147357 GGGGAGGGGCGGAGGCGACGCGG + Intronic
1035530311 8:345891-345913 GCTGAGGATGGGAGAAGATGGGG - Intergenic
1036482393 8:9150698-9150720 GCGGTGGGAGGAAGACGACGAGG + Intronic
1037170873 8:15890369-15890391 GCTGAGGGTGGCAGATCACGAGG + Intergenic
1038256640 8:25956570-25956592 TGGGAGGGTGGGAGAGGGCGAGG - Intronic
1038644449 8:29350789-29350811 GCGGGGGGCGGGGGACGGCGCGG - Intergenic
1041164246 8:55075071-55075093 GCCGAGGCTGGCAGATGACGAGG - Intergenic
1042368532 8:67964164-67964186 ACAGAGGGTGGGAGACAAAGTGG + Intronic
1042397411 8:68308004-68308026 GGGGAGGGTGGGTGAGGAGGGGG + Intronic
1042552981 8:70010730-70010752 GCGGAGGCGGGCAGACCACGAGG + Intergenic
1042591706 8:70403448-70403470 GGGGAGGGCGGGAAGCGACGGGG - Intronic
1045235633 8:100350767-100350789 GTGGAAAGTGGGAGACGAGGTGG - Intronic
1046238968 8:111465202-111465224 GTGGAGGGTGGGAGGAGATGAGG + Intergenic
1047100167 8:121667544-121667566 GCGGGGCGGGGGCGACGACGAGG + Intergenic
1049357866 8:142197600-142197622 GTGGAGGGTAGGAGAGGAGGTGG + Intergenic
1049763916 8:144344065-144344087 GCTGAGGGTGGGAGAGGGCAAGG - Intergenic
1049803779 8:144529938-144529960 GCCGAGGGAGGGAGAGGAGGCGG + Exonic
1055341714 9:75291628-75291650 CAGGAGGGTGGGAGAAGAGGTGG - Intergenic
1055590302 9:77805636-77805658 GCTGAGGTTGGCAGATGACGAGG - Intronic
1056035072 9:82595734-82595756 GTGGAGGGTGGAAGAAGACAAGG + Intergenic
1057308829 9:93928619-93928641 GCAGAGGGTGCGAGAGGAAGAGG + Intergenic
1058058816 9:100474150-100474172 GCGGTGGGTGGGAGACGGCGAGG + Intronic
1059507052 9:114809090-114809112 GAAGAGGGTGGGGGAGGACGTGG + Intergenic
1059577817 9:115509881-115509903 GCTGAGGGTGGGGGATCACGAGG - Intergenic
1060109190 9:120894514-120894536 GAGGCGGGTGGGAGGCGTCGTGG - Intronic
1060919304 9:127409096-127409118 GAGGTGGGGGGGAGACGATGGGG + Intergenic
1060919314 9:127409118-127409140 GAGGTGGGGGGGAGACGATGGGG + Intergenic
1061222456 9:129260122-129260144 GCGGAGGGTGGGAGGGGTCATGG - Intergenic
1185895537 X:3855129-3855151 GGGGAAGGTGGGAGAGGATGAGG - Intergenic
1185900656 X:3893553-3893575 GGGGAAGGTGGGAGAGGATGAGG - Intergenic
1185905772 X:3931984-3932006 GGGGAAGGTGGGAGAGGATGAGG - Intergenic
1187067594 X:15855285-15855307 GAGGAGGGTGGGAGGAGACGAGG + Intergenic
1188318066 X:28700697-28700719 TCGGAGGGTGGGAGGCAAAGGGG - Intronic
1190109724 X:47582258-47582280 GAGGCGGGTGGGAGAGGAGGAGG + Intronic
1190789730 X:53687048-53687070 GCGGAGGGTGGGAGACGACGTGG + Intergenic
1192656902 X:73002721-73002743 GCGGGCGGTGGGAGATGACGGGG - Intergenic
1192665218 X:73080280-73080302 GCGGGCGGTGGGAGATGACGGGG + Intergenic
1194361933 X:92963205-92963227 GTGGAGGGTGGGAGGAGAGGAGG - Intergenic
1200003327 X:153072849-153072871 GCTGGGGGTGGGAGTGGACGTGG + Intronic
1200004396 X:153077160-153077182 GCTGGGGGTGGGAGTGGACGTGG - Intergenic
1200670180 Y:6079421-6079443 GTGGAGGGTGGGAGGAGAGGAGG - Intergenic