ID: 1190789735

View in Genome Browser
Species Human (GRCh38)
Location X:53687083-53687105
Sequence GGGTTTGCTCGCGTGAACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 38}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190789735_1190789736 -8 Left 1190789735 X:53687083-53687105 CCAGAGTTCACGCGAGCAAACCC 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1190789736 X:53687098-53687120 GCAAACCCTTAAAACACTTCAGG 0: 1
1: 0
2: 1
3: 11
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190789735 Original CRISPR GGGTTTGCTCGCGTGAACTC TGG (reversed) Intergenic
906248395 1:44293097-44293119 GGGTTTTCTAGGGAGAACTCTGG + Intronic
1070719736 10:78747758-78747780 GGGCTTGCTCGCCTCACCTCTGG - Intergenic
1074457280 10:113606200-113606222 GTTTTTGCTCGGATGAACTCGGG + Exonic
1079989821 11:27234593-27234615 GGATTTGCTCCTGTGTACTCTGG - Intergenic
1084964555 11:72737849-72737871 GGGGAAGCTCGCATGAACTCAGG - Intronic
1096094945 12:48928435-48928457 AGATATGCTCGCTTGAACTCAGG - Intronic
1110056236 13:70976195-70976217 GGGTTTGCTTCCGTGTGCTCAGG + Intergenic
1115809937 14:37095660-37095682 AGGATTGCTTGCTTGAACTCTGG + Intronic
1128408741 15:67371135-67371157 GGGTTTACTGACGAGAACTCAGG + Intronic
1129256595 15:74337374-74337396 GGCTCTGCTTGGGTGAACTCTGG - Intergenic
1140411875 16:74746021-74746043 GGTTTTGAACTCGTGAACTCAGG + Intronic
1152549128 17:81020679-81020701 GTGTGTGCTCGCGGGCACTCAGG + Intergenic
1152747291 17:82047099-82047121 GGGTCTGCCCGCGTGGCCTCGGG - Intergenic
1156389501 18:36637394-36637416 GGATGTGCTCACATGAACTCAGG - Intronic
1161200865 19:3014056-3014078 GGATGTGCTCGCTTGAACCCAGG - Intronic
1163654093 19:18535629-18535651 GGATGTGCTCGCTTGAACCCAGG + Intronic
1167650487 19:50725909-50725931 GCGTTTGTACGCGTGTACTCCGG - Intergenic
931994425 2:67826199-67826221 GGGTTTGCTCCTGTGCACGCTGG + Intergenic
938725280 2:134103345-134103367 GGGTTTGCTCCCCTGACCACTGG - Intergenic
945936205 2:215905157-215905179 GGGTTAACTCAGGTGAACTCAGG - Intergenic
946163127 2:217848040-217848062 GAGGCTGCTCGCGGGAACTCAGG + Exonic
946445170 2:219733321-219733343 GTGTTAGCTCCAGTGAACTCAGG + Intergenic
948830088 2:240594423-240594445 GGGGTTGCTGGCAGGAACTCAGG + Intronic
1182203964 22:28604059-28604081 GGTCTTGATCTCGTGAACTCAGG - Intronic
1184363490 22:44033179-44033201 GGATGTGCTCGCTTGAACCCAGG - Intronic
961368586 3:126416206-126416228 GGGTTTGCGCGCGAGGACGCGGG - Intronic
995399908 5:111729198-111729220 GGGTTTGCTGGCCTGACTTCTGG + Intronic
995925277 5:117366343-117366365 GTGGTGGCTCGCTTGAACTCAGG + Intergenic
1011710482 6:90047755-90047777 GGGTTTGCTGGAGAGAACTCAGG - Intronic
1012168283 6:95986744-95986766 AGGGTGGCTCCCGTGAACTCAGG - Intergenic
1012893225 6:104920534-104920556 TGGTTTGATCGCTTGAGCTCAGG + Intergenic
1018195028 6:161348033-161348055 AGGTTTGCTCCCATGAGCTCAGG - Exonic
1018388975 6:163328807-163328829 CGATTTGCTTGCGTGCACTCAGG - Intergenic
1023360861 7:39414115-39414137 GGCTCTGCCAGCGTGAACTCTGG - Intronic
1032478906 7:132230966-132230988 GTGTTTGCTCGGGGGATCTCAGG + Intronic
1036390618 8:8321353-8321375 GGGATTACTCGCGTGAACCACGG + Intronic
1047960577 8:130008800-130008822 TGCTTTGCTCCCCTGAACTCTGG - Intronic
1059697424 9:116742564-116742586 GGGTTTGCTCCCCTAGACTCAGG + Intronic
1190047506 X:47124437-47124459 GGGCGTGCTCGCTTGAACCCAGG + Intergenic
1190789735 X:53687083-53687105 GGGTTTGCTCGCGTGAACTCTGG - Intergenic