ID: 1190790106

View in Genome Browser
Species Human (GRCh38)
Location X:53691120-53691142
Sequence GAGCTCACTGTTCAGTGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190790106_1190790109 -10 Left 1190790106 X:53691120-53691142 CCTCTACACTGAACAGTGAGCTC 0: 1
1: 0
2: 1
3: 20
4: 142
Right 1190790109 X:53691133-53691155 CAGTGAGCTCCTCAGAGGCAGGG 0: 1
1: 0
2: 9
3: 85
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190790106 Original CRISPR GAGCTCACTGTTCAGTGTAG AGG (reversed) Intergenic
900770999 1:4544271-4544293 GAGTTCACTGTTCAGAATAAAGG - Intergenic
903097365 1:20990272-20990294 GTGCTGACTGATCAGGGTAGTGG - Intronic
905402885 1:37716225-37716247 GACCTCACTCCTCAGTGGAGGGG + Exonic
905808672 1:40895941-40895963 GTGCTTACTGATCAGTGCAGAGG - Intergenic
905956432 1:42001253-42001275 GAGCTGACAGTTCAGTGTCTAGG - Intronic
906636513 1:47413977-47413999 GAGCTGACTCTTCATTGTTGTGG + Intergenic
907790570 1:57659574-57659596 GAGCACACTGGTCAGGGAAGGGG - Intronic
918141818 1:181726176-181726198 GAGCTCAGGGATCAGTGAAGGGG - Intronic
918441308 1:184569844-184569866 GAGGTCACTGTGCTGTGGAGAGG + Intronic
919485548 1:198142552-198142574 GAGCTCACTGGACAGTCTACAGG - Intergenic
922565035 1:226596246-226596268 TAGTACACTGTGCAGTGTAGAGG - Intronic
923499954 1:234556295-234556317 AAGCTCACAGTTCAGTAGAGGGG + Intergenic
1065212299 10:23415913-23415935 GAGCTCAGAGTGCAGTGTGGAGG + Intergenic
1071695188 10:87863065-87863087 GACCACGCTGCTCAGTGTAGAGG - Exonic
1074471733 10:113733322-113733344 CAGCTCCATGTTCAGTGCAGAGG - Intergenic
1075718895 10:124573751-124573773 GGGCACACTGTTCAGTGATGGGG - Intronic
1077027423 11:447206-447228 GAGCTCCCTGTAGAGTGCAGGGG + Intergenic
1080842188 11:35994538-35994560 TTGCTGACTGATCAGTGTAGTGG + Intronic
1083631804 11:64099314-64099336 GAGCTCACAGTCCAGTGGGGAGG - Intronic
1085691527 11:78668042-78668064 GAGCTCACTTTTCAAGTTAGGGG + Intronic
1088220265 11:107563259-107563281 AAGCTCACAGTTCAGTGGAAGGG - Intronic
1088648992 11:111940941-111940963 GAGCTCACAGACCAGTGAAGAGG + Intronic
1095400833 12:41813580-41813602 GAGCTCCCTGTTCAGGGGAGTGG + Intergenic
1101750305 12:107577908-107577930 GAGCTCATGGTTTAGTGAAGTGG - Intronic
1103444141 12:120983039-120983061 GAGCTGACTTCTCAGTGTGGGGG - Intronic
1105211148 13:18257900-18257922 GAGGTCACTGGTCAGTGTGGGGG + Intergenic
1106951429 13:34888719-34888741 CAGCACACTCTTCAGTGTGGTGG - Intergenic
1108415386 13:50193199-50193221 GAGCTGATTGTTAAGTTTAGGGG + Intronic
1110570591 13:76998603-76998625 TAACTCACGGTTCAGTGGAGAGG + Intronic
1110732308 13:78893245-78893267 GATCTAACTGTTTAGTTTAGGGG + Intergenic
1114081128 14:19201946-19201968 GAGCTCCCTTTTCAGATTAGTGG + Intergenic
1116469320 14:45268921-45268943 CAACCCACTGGTCAGTGTAGAGG - Intergenic
1117893303 14:60450290-60450312 GATCTCACCCTTCAGGGTAGTGG - Intronic
1119909175 14:78334226-78334248 GAGCTTACAGTTCAGGGGAGAGG + Intronic
1119964115 14:78894066-78894088 CTGCTCACTGATCAGGGTAGTGG + Intronic
1127055445 15:55126509-55126531 GAGCTTACAGTTCAGTGTAGGGG - Intergenic
1127167738 15:56265185-56265207 GGTCTCACTGTGGAGTGTAGTGG + Intronic
1128538542 15:68508868-68508890 GAGCTCACTATTCAGCGCAAAGG - Intergenic
1128720208 15:69942359-69942381 AAGCTCACTGTCTAGTGGAGAGG - Intergenic
1131266602 15:90919144-90919166 GAGCTCACAGCTCAGTGGAACGG + Intronic
1132721038 16:1315732-1315754 TAGCTCCCTGTTCAGTGTCCTGG + Intronic
1136237088 16:28921256-28921278 GAGCTCACAGTCCAATGAAGAGG + Intronic
1138018755 16:53457185-53457207 GAGTTCACAGTTCACAGTAGAGG + Intronic
1144548771 17:16220983-16221005 GAGCTGACAGTGCAGTCTAGAGG - Intronic
1148381218 17:47199534-47199556 GAGCTCACTGTCTGGTGTAGAGG + Intergenic
1149118625 17:53132597-53132619 AAGCTCACGTTTCTGTGTAGTGG - Intergenic
1150600072 17:66643246-66643268 CAGCTGACTCTTCAGTGAAGAGG - Intronic
1150992779 17:70280026-70280048 TAGCTCACAATTCAGTGTAGAGG + Intergenic
1151806389 17:76408134-76408156 GAAGTAACTGTTCAGTGGAGTGG - Intronic
1153780152 18:8487786-8487808 GATCTCAATGTTGTGTGTAGGGG - Intergenic
1155470220 18:26183905-26183927 GAGCTGACTCATCAGGGTAGTGG - Intronic
1155803329 18:30136292-30136314 GAACTCCCTGTTCTGTCTAGTGG + Intergenic
1158214644 18:55087190-55087212 GAGCTCTCTGTTCACAGGAGAGG + Intergenic
1158910423 18:62055812-62055834 GAGCTCACAGGCCAGGGTAGAGG - Intronic
1159171477 18:64774361-64774383 CACCTCAGTCTTCAGTGTAGTGG + Intergenic
1164549105 19:29193375-29193397 GAGCTCACTGCTGAGTTGAGTGG - Intergenic
1165769079 19:38367969-38367991 GACCTCAGTGGTCAGTGTGGAGG - Intronic
925664426 2:6238118-6238140 AGTCTCACTGTTCACTGTAGCGG - Intergenic
926135882 2:10335734-10335756 GAGCTCACTGACCCTTGTAGAGG - Intronic
928458908 2:31451112-31451134 GGACTCACTGTTCAGGGCAGTGG - Intergenic
928715511 2:34055775-34055797 GGACTCACTCTTCAGGGTAGTGG + Intergenic
929002627 2:37363048-37363070 GATCTCACTGTTCAATGTGTAGG - Intronic
930166497 2:48208706-48208728 AAGCTCACTGTTCATTGTGTGGG - Intergenic
931158401 2:59661329-59661351 GAGCTCATAGTTTAGAGTAGAGG - Intergenic
935785553 2:106545383-106545405 GACCTCACTGTTTATTGTACAGG + Intergenic
936444793 2:112587025-112587047 GAGCTCACAGTCCAGTGAGGAGG - Intronic
937552700 2:123113865-123113887 GAGCTCCCTGCTCAGTCTGGAGG - Intergenic
937656390 2:124381613-124381635 GAGCTGACTTTTCAGGGTCGGGG + Intronic
943967349 2:194354017-194354039 AGGCTCACTCTTCAGGGTAGTGG - Intergenic
944630558 2:201619509-201619531 GAGCTCACGGGACAGTGTAGAGG - Intergenic
946541456 2:220688646-220688668 GAGCTCACTGTCAAGTATATAGG - Intergenic
947578453 2:231295264-231295286 GGACTCACAGTTCAGTGCAGTGG + Intronic
948243322 2:236456742-236456764 CAGCTCATTCTTCAGTGCAGAGG - Intronic
1173556638 20:43970929-43970951 GAGCTCTGTGTGCAGTGTGGTGG + Intronic
1180499646 22:15920740-15920762 GAGCTCCCTTTTCAGATTAGTGG - Intergenic
1180765094 22:18341536-18341558 GAGGTCACTGGTCAGTGTGGGGG - Intergenic
1180813935 22:18778148-18778170 GAGGTCACTGGTCAGTGTGGGGG + Intergenic
1181200120 22:21212483-21212505 GAGGTCACTGGTCAGTGTGGGGG + Intronic
1181370140 22:22409285-22409307 GCTCTCACTGTTTATTGTAGAGG - Intergenic
1181701615 22:24624476-24624498 GAGGTCACTGGTCAGTGTGGGGG - Intronic
1185318932 22:50191312-50191334 GAGCTCTCTGTGCAGTGTCTAGG - Intronic
1203226716 22_KI270731v1_random:82441-82463 GAGGTCACTGGTCAGTGTGGGGG - Intergenic
1203264034 22_KI270734v1_random:3835-3857 GAGGTCACTGGTCAGTGTGGGGG + Intergenic
950785827 3:15434667-15434689 GAGCTCACTGTTCAGAGATGGGG + Intronic
952065548 3:29565230-29565252 GAGCTTATTGTACAGTGTAAAGG + Intronic
953285296 3:41600730-41600752 GAGCTCACGGTTTACTGTGGAGG - Intronic
953541819 3:43826329-43826351 GAGCCCAGTGATCAGTGGAGGGG - Intergenic
953690197 3:45111369-45111391 GAGCTGACTGTTAAGTGTTCAGG - Intronic
958491902 3:94786051-94786073 GAGCTCACCGTCTAGTGGAGGGG + Intergenic
960564944 3:119123113-119123135 GGACTCACTTTTCAGAGTAGTGG - Intronic
961360059 3:126361344-126361366 GAGATCCCAGTGCAGTGTAGGGG + Intergenic
965175214 3:165322268-165322290 GAACTCACACTTCAGGGTAGTGG + Intergenic
965331350 3:167378621-167378643 GAGCTCACGGTTCAGGGAAAGGG + Intronic
966209253 3:177435698-177435720 AAGCTTACAGTTCAGTCTAGTGG - Intergenic
966489299 3:180509137-180509159 GAGCTCACTGTTTAGCAAAGAGG + Intergenic
981927349 4:150154274-150154296 GAGCTCACAGTCTAGTGGAGCGG - Intronic
982141687 4:152327247-152327269 TAGCACACTGTTCAAAGTAGAGG + Intronic
982157811 4:152538464-152538486 GAGCTCACTTTCAAGTGTAGAGG - Intergenic
985027875 4:185757112-185757134 AAGCACACTGTCCACTGTAGGGG + Intronic
988069310 5:26266717-26266739 GAGATCCCTGCTCAGTGCAGAGG + Intergenic
990515310 5:56525918-56525940 GAGCTCACTATTTAATGAAGAGG + Intronic
991171513 5:63631591-63631613 CCGCTGACTGATCAGTGTAGTGG + Intergenic
992761383 5:79953753-79953775 GAGCTGATTGTTCAGGTTAGGGG - Intergenic
992901430 5:81301004-81301026 GAGCAAACTGTTGAGAGTAGTGG + Intergenic
993280281 5:85917123-85917145 GAGCTCACAGTTTAAAGTAGAGG + Intergenic
993462440 5:88200327-88200349 AATCTCATTGTTCATTGTAGTGG - Intronic
993542726 5:89172443-89172465 GAGCTTACAGTTCAATGTGGAGG + Intergenic
995063151 5:107832995-107833017 GAACTCACTGCTGAGTGTGGAGG + Intergenic
995848020 5:116514866-116514888 GACCTCACTATTCAGTGGATGGG + Intronic
996161654 5:120173964-120173986 GTACTCACCCTTCAGTGTAGTGG - Intergenic
998634036 5:143932407-143932429 GAACTCACTCTTCAGAGTAGTGG - Intergenic
999633053 5:153591539-153591561 GAGCTCACAGTTGAGTGAAAAGG - Intronic
1003375656 6:5574643-5574665 AAGCTCAGTATTCAGTGTTGGGG - Intronic
1005722106 6:28613270-28613292 GAGCACACTGTTCAGAGAGGTGG + Intronic
1008727576 6:54441195-54441217 GAGCTCACTCTTCAGGGCAGTGG + Intergenic
1008761694 6:54859535-54859557 GAGCTCACAGTCTAGTGGAGAGG + Intronic
1011849954 6:91614340-91614362 GAGGTCACTGTTCAGTGGTCAGG + Intergenic
1013130999 6:107232659-107232681 GAGCTCACATCTCAGTGGAGAGG - Intronic
1014820874 6:125987137-125987159 GAGCTTACTGTTTAGAGTAAGGG + Intronic
1015681946 6:135818247-135818269 GAGCTCACAGTCCTGTGTTGGGG - Intergenic
1016567506 6:145472530-145472552 GAACTCACTCTTCAGGGCAGTGG - Intergenic
1017398144 6:154027858-154027880 GGACTCACTCTTCAGAGTAGTGG + Intronic
1018426532 6:163687915-163687937 GAGCACACTGTTCCCTTTAGGGG + Intergenic
1019122250 6:169812461-169812483 GTGCTGGCTGTTCAGTGTGGCGG + Intergenic
1019436478 7:1024890-1024912 GAGCACACTCTTCAGTGTGGAGG + Intronic
1020623099 7:10542221-10542243 TAGCTCAGTGTTCAATGTAGAGG - Intergenic
1023393238 7:39730379-39730401 GAGGTCACTGCTGGGTGTAGTGG + Intergenic
1027934302 7:84583549-84583571 GGGCTCAATGTTCCGTGTAGTGG - Intergenic
1029628921 7:101738197-101738219 GAGCTTACAGTCCAGTGCAGGGG + Intergenic
1029871494 7:103697615-103697637 GAACTCACTGTGCTGTGTACTGG - Intronic
1030589211 7:111459793-111459815 GAACTCCCTCTTCAGTGCAGGGG + Intronic
1031862316 7:126994506-126994528 GGGCTCACTCTTCAGGGAAGTGG - Intronic
1035089549 7:156295915-156295937 GATCTCAGTGTTAACTGTAGAGG + Intergenic
1038863547 8:31414121-31414143 GAGCTCAGTGTCCAGAGCAGGGG - Intergenic
1045967182 8:108038659-108038681 CAGCTGACTGATCAGTGTGGTGG - Intronic
1046742932 8:117847656-117847678 GAGCTCAGTTTTCTGTGCAGAGG - Intronic
1047312981 8:123708047-123708069 GAGGTCACTGTTCAGTGACTGGG - Intronic
1048806885 8:138249410-138249432 GAGTTCACAGTCCAGTGAAGTGG - Intronic
1049486249 8:142865171-142865193 GAGCTATCTGTTCAGTGGATGGG + Intronic
1050854294 9:10331923-10331945 TATCTCAATGTTCAGGGTAGGGG + Intronic
1052031227 9:23631155-23631177 GAGCTCACTGTACAGAGCATTGG - Intergenic
1053870528 9:42487138-42487160 GAGCTCACTGTGGAGGTTAGAGG + Intergenic
1055227381 9:74015473-74015495 GAACTCACTCTTCAGGGCAGTGG - Intergenic
1055243739 9:74216881-74216903 GAACTCACCCTTCAGTGCAGTGG + Intergenic
1056793820 9:89642826-89642848 GAGCTCACCTCTCAGTGGAGGGG - Intergenic
1057875832 9:98753949-98753971 GAGCCGACTGTTCAGTTTATAGG - Intronic
1059814345 9:117894740-117894762 GAGCTCACTGTTGAGTCTGTGGG - Intergenic
1059988112 9:119839348-119839370 GAGCTCATGGATCAGTGTAGAGG - Intergenic
1060946040 9:127569600-127569622 GGGGGCACTGTTCAGGGTAGAGG - Intronic
1062238924 9:135525717-135525739 GAGCTCCCTGCTGAGTGAAGTGG - Intronic
1187610561 X:20938921-20938943 GAACTCACTTTTCAGGGAAGTGG + Intergenic
1187750396 X:22457235-22457257 GATCTCACTGTTCTGTCCAGTGG + Intergenic
1187934912 X:24326640-24326662 GAGCTGACTGGTCAATGTGGAGG + Intergenic
1188078493 X:25807664-25807686 GGACTCACTCTTCAGGGTAGTGG + Intergenic
1189657967 X:43267102-43267124 GGACTCACTGTTCAGTGAAGTGG + Intergenic
1190015146 X:46820128-46820150 GGACTCACTCTTCAGGGTAGTGG - Intergenic
1190790106 X:53691120-53691142 GAGCTCACTGTTCAGTGTAGAGG - Intergenic
1192580757 X:72278916-72278938 GAGCTCTCTGTTCAGTGGCAAGG - Intronic
1193683705 X:84552569-84552591 GAATGCACTGTTCAGGGTAGTGG + Intergenic
1193984950 X:88229013-88229035 GAACTCACCCTTCAGGGTAGTGG - Intergenic
1194595184 X:95848407-95848429 GGACTCACTCTTCAGGGTAGTGG - Intergenic
1194788743 X:98119166-98119188 GGGCTCACTTTTCAGGGCAGTGG - Intergenic
1195070012 X:101269892-101269914 GAGGTCACAGCTCACTGTAGGGG + Intronic
1199308656 X:146297368-146297390 GAACTCACTCTTCAGGGAAGTGG + Intergenic