ID: 1190801882

View in Genome Browser
Species Human (GRCh38)
Location X:53796710-53796732
Sequence TGAAGTAAGGGGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 905
Summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 844}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190801882 Original CRISPR TGAAGTAAGGGGAAGGTGGA GGG (reversed) Intergenic
900015077 1:142767-142789 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900016680 1:155589-155611 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900045344 1:501376-501398 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900046941 1:514181-514203 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900067541 1:743106-743128 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900069144 1:755899-755921 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900758064 1:4451247-4451269 TGAAGGACTGGGAAGGAGGAAGG - Intergenic
900946752 1:5835099-5835121 TGAGGGAAGGAGAAGGTAGAGGG + Intergenic
900968792 1:5977853-5977875 GGAAGGAAGGGGACGGTGAAAGG + Intronic
901528315 1:9837922-9837944 GGAAGGAAGGGAAAGGAGGAAGG + Intergenic
901921478 1:12540567-12540589 TGGAGTTGGGGGAGGGTGGAGGG - Intergenic
902045865 1:13523936-13523958 TGTAGCCACGGGAAGGTGGAAGG + Intergenic
902101794 1:13996504-13996526 TGAAGTCAGGGGAGGGAGGGAGG + Intergenic
902320341 1:15658947-15658969 TAAAGAAAGGGGAATGTGGAGGG - Intronic
902368284 1:15991012-15991034 TGCAGGGAGGGGAAGGTGTAAGG + Intergenic
902535759 1:17118676-17118698 TGAAGTCAGGGGAAGGTATCTGG + Intronic
902771807 1:18649524-18649546 TGAAGAACGGGGGAGGGGGATGG - Intronic
903142418 1:21346755-21346777 TGAGGTCAAGGGAAGGAGGAAGG + Intergenic
904073095 1:27816982-27817004 GGAAGGAAGGGGAGGGAGGAAGG + Intronic
904087191 1:27917133-27917155 AGGAGGAAGGGGAAGGAGGAAGG - Intergenic
904124615 1:28228939-28228961 TGAAGTAAGAGGAACCAGGACGG + Exonic
904152475 1:28453679-28453701 TGAAGTAAGAGGAACCAGGACGG - Intronic
904599112 1:31664153-31664175 GGAAGGAAGGGGAAGGGGAAGGG + Intronic
904631771 1:31848127-31848149 TGGAGTTAGAGGCAGGTGGAGGG + Intergenic
905108935 1:35580359-35580381 TGGAGCAAGAGGAAGGTAGACGG - Intronic
905757936 1:40527500-40527522 TGGAGTGGGGGGAAGGGGGAAGG + Intergenic
905830208 1:41059560-41059582 TGAAGAATGGTGAATGTGGAGGG - Intronic
905891271 1:41520005-41520027 TGAAAGAATGGGAAGTTGGATGG + Intronic
906026797 1:42681333-42681355 GGAAGCAGGGAGAAGGTGGAGGG - Intergenic
906253701 1:44331315-44331337 TTAAGCAGGGGGAAGGTGAAGGG + Intronic
907217791 1:52880650-52880672 TGAAGTAAGTGGTTGGAGGAGGG + Intronic
907462745 1:54614970-54614992 TGGAGTCAGGGGAGGGCGGAAGG + Intronic
907935828 1:59041463-59041485 TTAAGGAAGGGCAAGGAGGAAGG + Intergenic
907975371 1:59426378-59426400 TGAAGGGAGGGGAAGGAGGAAGG + Intronic
908119116 1:60968972-60968994 TGACATAAGGGAATGGTGGATGG + Intronic
908252473 1:62275888-62275910 GGAAGGAAGGGGAAGGGGAAGGG + Intronic
908511706 1:64854802-64854824 GGAAGGAAGGTGAAGGTGGAAGG - Intronic
908920117 1:69180125-69180147 TGAGTTATGGTGAAGGTGGAGGG - Intergenic
909424166 1:75502695-75502717 TGGAGTAGGGGGAGGGGGGAGGG - Intronic
911122724 1:94312205-94312227 TGGAGTTAGGGGGATGTGGAAGG - Intergenic
911164468 1:94712636-94712658 GGAAGCAAGGAGAAGATGGAGGG + Intergenic
911239140 1:95446593-95446615 TGAAGTGAGGGGTAGTAGGAGGG - Intergenic
911308528 1:96262251-96262273 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
912029212 1:105218486-105218508 TGAGGTAGGGGGTAGGGGGAGGG - Intergenic
912052631 1:105549186-105549208 TGAGGTATGGGGAGGGGGGAGGG - Intergenic
912241811 1:107918479-107918501 TGAAGGTAGGGGAATGGGGAGGG + Intronic
912468900 1:109893046-109893068 TGAAACTAGGAGAAGGTGGAGGG + Intergenic
912554726 1:110507959-110507981 TGAAGTAAGAGGAAGAAAGATGG - Intergenic
912667392 1:111594507-111594529 GGAAGGAAGGGGAAGGGGAAAGG + Intronic
913688542 1:121256815-121256837 TTCAGTCAGGGGAAGGTGGGGGG + Intronic
914005390 1:143728542-143728564 TGAAGAAAGAGGAAGGGGGGAGG + Intergenic
914040398 1:144044458-144044480 TTCAGTCAGGGGAAGGTGGGGGG + Intergenic
914096764 1:144550904-144550926 TGAAGAAAGAGGAAGGGGGGAGG + Intergenic
914097870 1:144559801-144559823 TGAAGAAAGAGGAAGGGGGGAGG + Intergenic
914149058 1:145023462-145023484 TTCAGTCAGGGGAAGGTGGGGGG - Intronic
914352554 1:146853227-146853249 TGCAGTGAGAGGCAGGTGGAAGG - Intergenic
914429665 1:147609432-147609454 TAAAGTAATGGGAAGGAAGATGG + Intronic
915117903 1:153611998-153612020 TGAAGTGAGTGGAAGGGTGATGG - Intronic
915148486 1:153809984-153810006 TGAAATAAAGGGGAGGTGGCAGG + Exonic
915161291 1:153922609-153922631 TGGGGGAAGGGAAAGGTGGAGGG - Intronic
915444501 1:155967043-155967065 TGAAGGAAGAGGGAGGTGGGAGG - Intronic
915493858 1:156267245-156267267 GGCAGTAAGGAGAAGGGGGAAGG + Intronic
915596416 1:156898907-156898929 TGAAGGAAGGGGATGGGGAAAGG + Intronic
915691945 1:157698650-157698672 TGAAGGCAGGGGAAGGTCAATGG + Intronic
915851745 1:159331748-159331770 TGGAGTGAGGGGAGGGGGGAGGG - Intergenic
915916470 1:159943737-159943759 TTAAGTGAGGGGTAGGGGGAAGG + Intronic
916224756 1:162478490-162478512 TGAAGGAAAGGGAAGGGGAAGGG + Intergenic
916482807 1:165230613-165230635 TGCAGCAAGGGGCAGCTGGAGGG - Intronic
917224805 1:172770156-172770178 TGGAGTTAGGGGAAGGAGCAAGG + Intergenic
917496351 1:175543759-175543781 TGAAGTAGGGGCAAGGGGAATGG + Intronic
917653455 1:177102198-177102220 TTAAATAAGGGGAGGGAGGAAGG + Intronic
918328996 1:183438192-183438214 GGAAGGAAGGGGAAGGGGAAAGG + Intergenic
918556111 1:185801333-185801355 TGAAATAAGTGGAAGAAGGATGG - Intronic
918661797 1:187097868-187097890 TGAGGTGGGGGGAAGGGGGAGGG - Intergenic
918817513 1:189208593-189208615 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
919756588 1:201069826-201069848 TGCAGGAAGGGGCAGGTGGTGGG - Intronic
919858750 1:201724416-201724438 TAAAGTAGGGAGAAGATGGAGGG - Intronic
920475864 1:206275314-206275336 TTCAGTCAGGGGAAGGTGGGGGG + Intronic
920995077 1:210982410-210982432 TGGAGTGGGGGGAAGGGGGAGGG - Intronic
921271169 1:213471517-213471539 GGAAGGTAGGAGAAGGTGGAGGG - Intergenic
921450353 1:215298122-215298144 GGTAGTAAATGGAAGGTGGATGG - Intergenic
922102144 1:222485879-222485901 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
922104505 1:222501291-222501313 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
922263227 1:223960990-223961012 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
922264823 1:223973804-223973826 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
922535778 1:226379688-226379710 AAAAGTAAGGGGAAGGTAGAAGG + Intronic
922873704 1:228923474-228923496 TGAAGTAAATGGATGGTGGTAGG + Intergenic
922887060 1:229028289-229028311 GGAAGGAAGGGGAGGGAGGAAGG + Intergenic
922894411 1:229089097-229089119 AGAACTGAGGGAAAGGTGGACGG + Intergenic
923865155 1:237931774-237931796 TGAAGGAAGGGGATGATGGATGG - Intergenic
924345067 1:243065999-243066021 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
924346680 1:243078810-243078832 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
924606503 1:245540044-245540066 TGAAGGCAGGGAAAGGTGGGAGG - Intronic
924674216 1:246159366-246159388 TGAAGAATGGGGAAGGCTGAAGG + Intronic
1062767171 10:74690-74712 GAAAGTAAGGGGAAGGAGAAGGG + Intergenic
1062790517 10:301395-301417 TGGGGTCTGGGGAAGGTGGAGGG + Intronic
1063440794 10:6071423-6071445 TGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1064271227 10:13868357-13868379 TGAAGTAAGATGACGATGGAAGG + Intronic
1064546628 10:16456846-16456868 TGAACCATGGGGAAGGTGGGGGG + Intronic
1064596934 10:16954802-16954824 GGAAGGAAGGGGAGTGTGGAAGG - Intronic
1064930208 10:20617046-20617068 TGAACTATCGTGAAGGTGGAAGG + Intergenic
1065696828 10:28388114-28388136 GGAAGGGAGGGGAAGGTGGAAGG + Intergenic
1065696854 10:28388171-28388193 GGAAGGGAGGGGAAGGAGGAAGG + Intergenic
1066408535 10:35143320-35143342 TGAAGAAAGGGGGAGGCAGATGG + Intronic
1066729669 10:38426039-38426061 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1066731267 10:38439078-38439100 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1066934291 10:41805979-41806001 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
1066934935 10:41817586-41817608 TGGGGTTAGGGGAAGGGGGAGGG - Intergenic
1067062463 10:43084847-43084869 TGGAGGAAGGGGAAGGTGCAAGG + Intronic
1067231913 10:44418007-44418029 TGAGGGAAGGGGACAGTGGAGGG + Intergenic
1067991299 10:51215712-51215734 AGAAAGAAGTGGAAGGTGGAAGG - Intronic
1068015207 10:51507151-51507173 TGGAGTAGGGGGAGGGGGGAGGG + Intronic
1068269169 10:54697652-54697674 GGAAGGAAGGGGAAGGGGGAAGG + Intronic
1068977283 10:63023450-63023472 TGAAGCAAGCTCAAGGTGGAAGG + Intergenic
1069144672 10:64875624-64875646 TGTAGTAAGGGAAAAGAGGAAGG - Intergenic
1069603947 10:69728309-69728331 TGGAGGAAGGGGAAGCAGGAAGG - Intergenic
1070016448 10:72537271-72537293 TGGAGTGTGGGGAATGTGGATGG + Intronic
1070272523 10:74970210-74970232 AGAAGTATAGGGAAGGTGGGAGG - Intronic
1070702414 10:78613404-78613426 TGAAGGAGGGGGAAGGAAGATGG + Intergenic
1070771837 10:79087104-79087126 ACAAGCAATGGGAAGGTGGAGGG - Intronic
1070786813 10:79166746-79166768 TGAAGGGAGAGGAAGCTGGAAGG + Intronic
1071164163 10:82785204-82785226 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1071729905 10:88237304-88237326 GGAAGGAAGGGGAAGAGGGAAGG - Intergenic
1072317820 10:94220938-94220960 TGGAACAAGGGGAAGCTGGAGGG - Intronic
1072723221 10:97793684-97793706 GGAAGAAAGGGGAAGAAGGAAGG - Intergenic
1072877731 10:99191042-99191064 TGAAGAAAGGGGAAAGAAGAAGG + Intronic
1072916528 10:99540506-99540528 CGACAGAAGGGGAAGGTGGAAGG + Intergenic
1073196374 10:101694978-101695000 CGAAGGAAGGGGAAGGGGAAGGG - Exonic
1073348516 10:102802102-102802124 GGAAGGAAGGAGAAGGTGGAAGG - Intronic
1073653510 10:105387239-105387261 TGAAGGAAGGGGAACGTGAAAGG + Intergenic
1074045202 10:109831692-109831714 TGGAGTGGGGGGAAGGGGGAGGG + Intergenic
1074111162 10:110423598-110423620 GGAAATCAGGGGAAGATGGATGG + Intergenic
1074750254 10:116578956-116578978 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1074773757 10:116750964-116750986 TGAAGAAAGAGGAAGGAAGAAGG + Intergenic
1074890122 10:117728873-117728895 TGTAGTGAGGGGATGGTGAATGG + Intergenic
1074947273 10:118293421-118293443 AGAAGGAAAGGGAAGGTGCAGGG - Intergenic
1075132753 10:119754485-119754507 TGAAAGAAGGGAGAGGTGGAGGG + Intronic
1075136092 10:119787613-119787635 GGAAGGAAAGGGAAGGGGGAGGG + Intronic
1076314780 10:129532535-129532557 TGAAGTAGGGGCATGGGGGATGG - Intronic
1076329605 10:129654693-129654715 TGAGGTATGAGGAAGGTGGCCGG + Intronic
1076403847 10:130199974-130199996 GGAAGGACGGTGAAGGTGGAGGG + Intergenic
1076557282 10:131335438-131335460 TGAAGTGAGGGTGAGGTGGAGGG + Intergenic
1076971671 11:137867-137889 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1076973270 11:150658-150680 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1077087256 11:759977-759999 TCCAGTGAGGGGAAGGTTGAGGG + Intronic
1077163255 11:1123126-1123148 GGAAGGAAGGGGGAGGGGGAAGG - Intergenic
1077537565 11:3131785-3131807 TGAATGAATGGGTAGGTGGATGG - Intronic
1077916536 11:6615269-6615291 TGAAGTAACTGGATGGTGGCAGG + Exonic
1077963935 11:7107049-7107071 TGAGGTGGGGGGAAGGGGGAGGG - Intergenic
1078362566 11:10680531-10680553 GGAAGGAAGGGGAAGGGGAAGGG + Intronic
1078400318 11:11020540-11020562 AGAAGGAAGGGGAAGGGAGAAGG - Intergenic
1079026312 11:16950677-16950699 TGAGGGAATGGGCAGGTGGAGGG - Intronic
1079448492 11:20578756-20578778 TGAGGTAGGGGGAGGGGGGAGGG + Intergenic
1079536449 11:21520754-21520776 TGAGGTAAGGAGCAGGTGCATGG - Intronic
1079635828 11:22739276-22739298 TTAAGAAAGGGGAAGTTGGCCGG + Intronic
1080237905 11:30092884-30092906 GGAAGGAAGGAGAAGGAGGAAGG - Intergenic
1080558661 11:33441061-33441083 TGAGGTAGGGGGAGGGGGGAGGG - Intergenic
1081385147 11:42463327-42463349 GGGAGGGAGGGGAAGGTGGAAGG + Intergenic
1081635477 11:44718671-44718693 GGAAGGAGGGGGAAGGAGGAAGG + Intergenic
1081655645 11:44855751-44855773 AGATGTCAGGGGAAGGTGGGTGG - Intronic
1081797881 11:45834283-45834305 TGGAGTCAAGGGATGGTGGAAGG - Intergenic
1082190095 11:49232584-49232606 TGAAGGAAGGGGAAGGAAGCAGG - Intergenic
1082297438 11:50459474-50459496 TGGAGTGGGGGGAAGGGGGAGGG - Intergenic
1082314515 11:50700445-50700467 TGGTGTGAGGGGAAGGGGGAGGG + Intergenic
1083593746 11:63909479-63909501 CAAAGGAAGGGGAGGGTGGATGG + Exonic
1083739327 11:64700134-64700156 AGAAGTAAGAGGAATGTGGAGGG - Intronic
1083757341 11:64798766-64798788 TGAGGTATGGGGAAGCTGCAGGG - Intronic
1084502029 11:69540553-69540575 GGAAGTAAGGAGAAAGTGGAGGG - Intergenic
1084772639 11:71353821-71353843 GGAAGGAAGGGGAAGATGGAGGG + Intergenic
1085311012 11:75516622-75516644 TGAAGGAAGGGGCAGGAGGCAGG + Intronic
1085340157 11:75726069-75726091 TGAAGTGGGGTGAAGGTGAAAGG - Intronic
1085547276 11:77331635-77331657 TGGGGTCAGGGGAGGGTGGAGGG + Intronic
1086008805 11:82073251-82073273 GAAAGTAAGGCAAAGGTGGAGGG - Intergenic
1086104782 11:83135523-83135545 TGAAATAGGGGAAAGGTAGAGGG - Intergenic
1086165442 11:83772480-83772502 GGAAGGAAGGAGAAGGGGGAGGG + Intronic
1086518854 11:87646327-87646349 TGAAGGGAAGGGAAGGAGGAAGG - Intergenic
1086629535 11:89000088-89000110 TGGGGTGAGGGGAAGGGGGAGGG + Intronic
1086676034 11:89608348-89608370 TGAAGGAAGGGGAAGGAAGCAGG + Intergenic
1086902893 11:92387484-92387506 TGAAGTAAGGGTAGGGGAGAAGG + Intronic
1087474839 11:98622152-98622174 GGAAGGAAGGGGAAGGGGAAGGG - Intergenic
1087857462 11:103109535-103109557 GGAAGTTGGGGGAAGGGGGAAGG - Intronic
1088155751 11:106800738-106800760 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1088987514 11:114922848-114922870 TGAAGTAAGAGGAGAGGGGAAGG + Intergenic
1089058360 11:115606243-115606265 TGGAATAAGTGGAAGGTGGAGGG - Intergenic
1090648857 11:128789114-128789136 TGAAGCAAAGGGAAGGAGGAAGG + Intronic
1090652493 11:128819582-128819604 GGAAGGAAGGGGAAGGAAGAAGG + Intergenic
1090827604 11:130398747-130398769 GGAAGGGAGGGGATGGTGGAGGG + Intergenic
1090883264 11:130853400-130853422 AGAAGTGGGTGGAAGGTGGAGGG - Intergenic
1091110707 11:132963632-132963654 TGAAGGAAGTGGAAGCAGGAAGG - Intronic
1091253405 11:134163093-134163115 GGAGGTATGGGAAAGGTGGAAGG + Intronic
1091388756 12:112290-112312 GGAAGTGGGGGGAAGGGGGATGG + Intronic
1091440913 12:511414-511436 GGAAGAAGGTGGAAGGTGGAAGG - Intronic
1091440919 12:511438-511460 GGAAGAAGGTGGAAGGTGGAAGG - Intronic
1091440933 12:511496-511518 GGAAGAAGGTGGAAGGTGGAAGG - Intronic
1091440964 12:511628-511650 GGAAGAAGGTGGAAGGTGGAAGG - Intronic
1091440990 12:511737-511759 GGAAGAAGGTGGAAGGTGGAAGG - Intronic
1091440996 12:511761-511783 GGAAGAAGGTGGAAGGTGGAAGG - Intronic
1091441002 12:511785-511807 GGAAGAAGGTGGAAGGTGGAAGG - Intronic
1091441010 12:511819-511841 GGAAGAAGGTGGAAGGTGGAAGG - Intronic
1091441016 12:511843-511865 GGAAGAAGGTGGAAGGTGGAAGG - Intronic
1091441022 12:511867-511889 GGAAGAAGGTGGAAGGTGGAAGG - Intronic
1091441035 12:511922-511944 GGAAGAAGGTGGAAGGTGGAAGG - Intronic
1091441074 12:512093-512115 GGAAGAAGGTGGAAGGTGGAAGG - Intronic
1091441104 12:512208-512230 GGAAGAAGGTGGAAGGTGGAAGG - Intronic
1091441110 12:512232-512254 GGAAGAAGGTGGAAGGTGGAAGG - Intronic
1091441120 12:512276-512298 GGAAGAAGGTGGAAGGTGGAAGG - Intronic
1091441144 12:512373-512395 GGAAGAAGGTGGAAGGTGGAAGG - Intronic
1091441190 12:512562-512584 GGAAGAAGGTGGAAGGTGGAAGG - Intronic
1091441210 12:512642-512664 GGAAGAAGGTGGAAGGTGGAAGG - Intronic
1091441227 12:512712-512734 GGAAGAAGGTGGAAGGTGGAAGG - Intronic
1091441280 12:512929-512951 GGAAGAAGGTGGAAGGTGGAAGG - Intronic
1091441302 12:513020-513042 GGAAGAAGGTGGAAGGTGGAAGG - Intronic
1091441308 12:513044-513066 GGAAGAAGGTGGAAGGTGGAAGG - Intronic
1091441337 12:513163-513185 GGAAGAAGGTGGAAGGTGGAAGG - Intronic
1091618969 12:2071209-2071231 GGAAGCAAAGGGAAGGAGGAAGG - Intronic
1091694521 12:2618756-2618778 AGAAGGAAGGGGAAGTGGGATGG + Intronic
1092349667 12:7745917-7745939 TCAAGAAAGGGGAACGTGGCCGG + Intronic
1093675131 12:21929974-21929996 TGAGGTAGGGGGAGGGGGGAGGG - Intronic
1093760372 12:22903128-22903150 TGGAGTAGGGGGAGGGGGGAGGG + Intergenic
1093872978 12:24314365-24314387 TGGAGTAGGGGGAGGGGGGAGGG + Intergenic
1094259726 12:28479464-28479486 TGGGGTAGGGGGAAGGGGGAAGG + Intronic
1095217199 12:39563767-39563789 TGAGGTGAGGGGAGGGTGGAGGG - Intronic
1095299709 12:40569451-40569473 AGAAGTAAGAGGAAGGGAGAAGG - Intronic
1095376418 12:41534437-41534459 AGGAGTGAGGGGAAGGGGGAAGG - Intronic
1095482800 12:42653172-42653194 TGTGGTGGGGGGAAGGTGGAGGG - Intergenic
1095531046 12:43186989-43187011 TGAGGTAGGGGGAGGGGGGAGGG - Intergenic
1095700284 12:45184540-45184562 TGAAGTAATGGGTAGATGGAAGG + Intergenic
1095813869 12:46400187-46400209 TGAGGTGGGGGGAAGGGGGAGGG + Intergenic
1095863578 12:46947220-46947242 TGAAGGAAGGAGAAAGGGGAAGG - Intergenic
1096046663 12:48568466-48568488 TGGGGTAAGGAGAAGGAGGATGG + Intronic
1096748420 12:53743582-53743604 AGAAGGAAAGGGAAGGTGCAAGG - Intergenic
1097191656 12:57222347-57222369 AGAAGTAAGGGGCAGGGGGAGGG - Intronic
1097204005 12:57304555-57304577 TGGAGAACTGGGAAGGTGGATGG + Intronic
1097392716 12:59035045-59035067 GGAAGAAAGGAGAAGGTGAAGGG + Intergenic
1098358372 12:69632000-69632022 GGAAGGAAGGGGGAGGGGGAGGG - Intergenic
1098725124 12:73954841-73954863 TGAAGTAAATGGATGATGGATGG - Intergenic
1099272659 12:80530945-80530967 TGAAGGAAGGCTAAGGTGGTAGG + Intronic
1100090602 12:90964804-90964826 TGAAGTGAGGGGAAGGAAGGAGG + Intronic
1101103130 12:101414202-101414224 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
1101239385 12:102823580-102823602 AGAAGATAGAGGAAGGTGGAAGG - Intergenic
1101321682 12:103678474-103678496 TGAAGGAAAGGGAAGGTAGGAGG - Intronic
1101348566 12:103907209-103907231 GGAAGGAAGGGGGAGGGGGAGGG + Intergenic
1101431220 12:104628956-104628978 TGAAACAAGGGGGAGCTGGATGG + Intronic
1101765169 12:107691278-107691300 TGAAGCACAGAGAAGGTGGATGG + Intronic
1101819566 12:108173479-108173501 TGAAGGCAGGGGAGGGTGGGGGG - Intronic
1101843805 12:108345987-108346009 AGAAGGAGGGGGAAGGAGGAGGG + Intergenic
1102112087 12:110372210-110372232 TCAAGGAAGGGGATGGTGGGAGG + Intergenic
1102167961 12:110821031-110821053 AGAAGAAAGAAGAAGGTGGAGGG - Intergenic
1102230383 12:111257682-111257704 AGGAGGAAGGGGAAGGAGGAGGG - Intronic
1102728101 12:115083541-115083563 TGAAGGAAGGGGAAGAGAGAGGG + Intergenic
1102844012 12:116158254-116158276 GGAATGAAGGGGAAGGTGAAGGG + Intronic
1102866986 12:116382313-116382335 AGAAGGAAGAGGAAGGAGGAGGG + Intergenic
1103596442 12:122027015-122027037 TGAAGTCAGGGTAAGGTGACGGG + Intronic
1104901501 12:132191815-132191837 CGAAGCAAGGGGAAGGTGAAGGG - Intergenic
1106649889 13:31679063-31679085 TGGGGTAGGGGGAGGGTGGAGGG - Intergenic
1106753574 13:32798686-32798708 GGAAGGAAGGGGAAGAAGGAAGG - Intergenic
1107218157 13:37947067-37947089 TGAGGTCAGGGGAGGGGGGAGGG - Intergenic
1107764802 13:43722769-43722791 TGAATTCAGTGGAAGGTGGTTGG - Intronic
1108437346 13:50413665-50413687 GGAAAGAAGGGGAAGGTGGAGGG + Intronic
1108894191 13:55302684-55302706 TAAATTAAGGGGATGGAGGAGGG - Intergenic
1109569950 13:64174761-64174783 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1109777341 13:67058980-67059002 TGAAGTCAGGTGCAGTTGGAAGG - Intronic
1109981739 13:69916590-69916612 TGGAGTGGGGGGAAGGGGGAGGG + Intronic
1110034778 13:70669347-70669369 TGAGACAAGGGGAAGGAGGAAGG - Intergenic
1110988654 13:82008576-82008598 TGGAGTCAGGGGATGTTGGATGG - Intergenic
1111446120 13:88347867-88347889 GGAAGGAAGGGGAGGGAGGAAGG + Intergenic
1111605183 13:90529186-90529208 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1112542149 13:100325307-100325329 TAAAGCAAAAGGAAGGTGGAAGG + Intronic
1112572559 13:100607185-100607207 TTAAGGAATGCGAAGGTGGATGG - Intronic
1113005342 13:105695562-105695584 TGAAGTAAGGTGAATGAGAAAGG - Intergenic
1113009968 13:105752979-105753001 GTAAGTAAGGGGGAGGTGTAAGG - Intergenic
1113749168 13:112766615-112766637 TAAGGGAAGGGGAAGGGGGAGGG + Intronic
1113851174 13:113419045-113419067 TGAAGGAAGGAGAAGAAGGAAGG - Intergenic
1114494558 14:23123715-23123737 GGGAGTAAGGGGGTGGTGGAGGG - Intergenic
1114796164 14:25717667-25717689 TGGAGTAGGGGGATGGGGGAGGG - Intergenic
1114909352 14:27171053-27171075 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1115193403 14:30770672-30770694 TGAAGTATGGGGAGGCAGGAAGG + Intergenic
1115304141 14:31916617-31916639 GGAAGTAGGAGGCAGGTGGATGG - Intergenic
1115654456 14:35430006-35430028 TGAAGTAAGAGGAACCAGGACGG - Intergenic
1116036462 14:39633679-39633701 TGGAGTGAGGGGAGGGGGGAGGG - Intergenic
1116604326 14:46969784-46969806 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1116715835 14:48425316-48425338 TGAAGGAAGTGAAAGGTTGATGG + Intergenic
1116788097 14:49309919-49309941 TGAGGTAAAGGGAGTGTGGAGGG + Intergenic
1117735341 14:58763316-58763338 TGATGTAATGGAAAGGTAGATGG + Intergenic
1118597658 14:67448576-67448598 TGAAGTTTGGGGAAGGGGGATGG + Intronic
1119186509 14:72646634-72646656 TGAAGGAAGGGGATGGAGAAAGG - Intronic
1119310234 14:73640187-73640209 TGGAGAAGGTGGAAGGTGGAAGG - Intergenic
1120461076 14:84796053-84796075 TGAAGTGAGGGGAAGGTGGCAGG + Intergenic
1120510117 14:85403013-85403035 GGAAGGCAGGGGAAGGTGGCAGG - Intergenic
1120546460 14:85818283-85818305 TGAATTAAGAGGAAGTTGCATGG + Intergenic
1120627831 14:86851035-86851057 AGAACTAATTGGAAGGTGGAAGG - Intergenic
1120835449 14:89035137-89035159 TGAGGTCAGAGGAAGGTGGAGGG - Intergenic
1120860197 14:89248089-89248111 AAAAGTAAGGTGAAGGTAGAGGG - Intronic
1121005009 14:90484511-90484533 GGTAGGAATGGGAAGGTGGATGG - Intergenic
1121188353 14:91997735-91997757 TGAAATAAGGCTAAGGTGGTAGG + Intronic
1121488338 14:94338779-94338801 TGAAGTAAATGGAAGGTGGGTGG - Intergenic
1121652076 14:95566117-95566139 AGAGGAAAGGGGAAGGAGGAAGG + Intergenic
1122030456 14:98908092-98908114 GGAAGGAAGGGGCAGGTGGGGGG - Intergenic
1122426810 14:101614427-101614449 TTAAGTAAATGGATGGTGGATGG + Intergenic
1122915243 14:104855355-104855377 TGAAGGGAGGGGAGAGTGGAGGG + Intergenic
1123701212 15:22916113-22916135 TGACGTGGGGGGAAGGTGGCGGG - Intronic
1124104977 15:26729348-26729370 CCAAGGAGGGGGAAGGTGGAGGG - Intronic
1124798955 15:32810771-32810793 TGAAATAAGGGGAAGGGATAAGG + Intronic
1124824233 15:33077505-33077527 TGGAGTCAGGGGAAGGGGGAGGG - Intronic
1125240707 15:37572230-37572252 TGTAGGAAGGTGAAGGAGGAAGG - Intergenic
1125767855 15:42147058-42147080 AGAAGCAAGGGGCGGGTGGAAGG + Intronic
1126123733 15:45276330-45276352 TGGGGTGAGGGGAAGGGGGAGGG + Exonic
1126701874 15:51375305-51375327 TCAAGTGAGGGGAAAATGGAGGG - Intronic
1126802350 15:52310405-52310427 TGTAGTAAGGTGAATGGGGAGGG + Exonic
1127548999 15:60018404-60018426 AGAAGTAATGAGAAGATGGATGG + Intronic
1127693252 15:61418619-61418641 AGAAGTAAAGGGAAGGAAGAAGG + Intergenic
1128342190 15:66830375-66830397 TGGAGTCAGGGGAGGGTGCAGGG - Intergenic
1128793543 15:70449628-70449650 TGAAGAGAGGGAGAGGTGGATGG + Intergenic
1128930177 15:71697268-71697290 TGATGTAATGGAAAGGGGGATGG + Intronic
1129088665 15:73124726-73124748 TGAAGTAAAATGAAGGTAGAAGG - Intronic
1130055878 15:80525533-80525555 GGAAGGAAGGGGAGGATGGAAGG + Intronic
1130703003 15:86204505-86204527 GGAAGGAAGGGGAAGGGGAAGGG - Intronic
1131039550 15:89250545-89250567 TGGAGTGAGGGGAGGGGGGAGGG + Intronic
1131342220 15:91613108-91613130 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1131449325 15:92526010-92526032 GGAAGGAAGGGGAAGAAGGAAGG - Intergenic
1132177414 15:99726494-99726516 TGCAGTAGGGGGAGTGTGGAGGG - Intronic
1133000229 16:2846990-2847012 TTATGTTAGGGGAAGGAGGAGGG - Intergenic
1133107863 16:3525366-3525388 TGAAGGAAGGGTAGGGTAGAGGG - Intronic
1133330153 16:4967953-4967975 GGAAGGGAGGGGAAGGGGGAGGG - Intronic
1133698774 16:8289685-8289707 TAAAGTAAGGGGACCCTGGAGGG + Intergenic
1133964279 16:10519501-10519523 GGAAGAAAGGGGAAGGGGAAGGG - Intergenic
1133982041 16:10640126-10640148 GGAAGAAAGGGGGAGGAGGAAGG - Intronic
1134249697 16:12565750-12565772 TGAAAAAAGGTGAAGGTGGCAGG - Intronic
1134433208 16:14231133-14231155 TGGGGTAAGGGGAGGGGGGAGGG + Intronic
1134549443 16:15132274-15132296 GGAAGTGAGGGGAAGGTCTAGGG + Intronic
1134710860 16:16326442-16326464 TGAGGTGAGGGGAAGGTCTAGGG - Intergenic
1134948741 16:18342203-18342225 TGAGGTGAGGGGAAGGTCTAGGG + Intergenic
1135669550 16:24363384-24363406 TGGGGGAATGGGAAGGTGGATGG + Intergenic
1136538271 16:30913300-30913322 TGAAGGAAGGAGGAGGTTGAAGG + Intergenic
1137460912 16:48662489-48662511 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1137526266 16:49239063-49239085 TGATGGAAGGGAAAGGAGGAAGG + Intergenic
1138567850 16:57846420-57846442 TGAAGAAGGCGGATGGTGGAGGG + Intronic
1138587733 16:57982062-57982084 TGAAGCAGGAGGAAGGTGGTGGG - Intronic
1138891913 16:61154038-61154060 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1139446727 16:67002767-67002789 AGAAATGAGGGGTAGGTGGAAGG - Intronic
1139497031 16:67327117-67327139 TGAAGTAACGGGAGGGTGTGGGG + Intronic
1139981474 16:70862292-70862314 TGCAGTGAGAGGCAGGTGGAAGG + Intronic
1141508455 16:84496451-84496473 AGAAGGAAGGAGAAGGCGGAAGG - Intronic
1142421738 16:89974873-89974895 TGAAGAAAGGGAATGGAGGAGGG + Intergenic
1142446981 16:90146868-90146890 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1142448577 16:90159655-90159677 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1142458908 17:75634-75656 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1142460511 17:88463-88485 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1142672996 17:1496023-1496045 TGAGGGAAGGGGAAGGGTGAGGG - Intronic
1143018654 17:3904932-3904954 AGAAGTGAGGGGCAGGGGGAGGG + Intronic
1143994645 17:10996216-10996238 TCCAGTAAGGGAAAAGTGGAGGG - Intergenic
1145980783 17:29010183-29010205 TGAATTTAGGGGCAGGAGGAGGG + Intronic
1146184862 17:30718154-30718176 AGAAGTGATGGGAAGGTGGCAGG + Intergenic
1146359433 17:32161762-32161784 TGAAGTAAGGGCAATGTTGTTGG - Intronic
1146463949 17:33071197-33071219 AGAAGTATGGGGCAGGTGGGAGG - Intronic
1146529554 17:33596680-33596702 TGAAGGAAAAGGAAGGAGGAGGG - Intronic
1146693250 17:34891036-34891058 TGGAGCAAGGGGAGGGTGGGGGG - Intergenic
1146930108 17:36770898-36770920 GGAAGGGAGGGGAAGGTTGAAGG - Intergenic
1147040476 17:37714493-37714515 GGAAGTAAGTAGAAGGTGAATGG - Intronic
1147856488 17:43484224-43484246 TGAGGGAAGCGGAAGGAGGAAGG + Intronic
1148235999 17:45969569-45969591 TGAAGGAAGGGATGGGTGGATGG - Intronic
1148236018 17:45969672-45969694 TGAAGGAAGGGATGGGTGGATGG - Intronic
1149168882 17:53785723-53785745 TGAAGGAAAGGGAAAGGGGAAGG + Intergenic
1149952588 17:61005938-61005960 TGGAGTGGGGGGAAGGGGGAGGG - Intronic
1151281318 17:73076764-73076786 AGAAGTAAGGGGAAGAGGCAAGG + Intronic
1151884514 17:76915795-76915817 TGAAGGAAGGGGAAGGAAAAAGG - Intronic
1152513392 17:80805429-80805451 TAAAATAAGGGGAAGCAGGACGG - Intronic
1152990058 18:355083-355105 TGAATTAATGGGAGGATGGATGG - Intronic
1153240642 18:3028621-3028643 AAAATTAAGGGGAAGGTGTATGG + Intergenic
1153708475 18:7772432-7772454 GGAAGGAAGGGGAAGGGGAAGGG - Intronic
1154929447 18:20977088-20977110 TGAAGTAAGGGAAAGCTGGGTGG - Intronic
1154957187 18:21270379-21270401 AGAATCATGGGGAAGGTGGATGG + Intronic
1154966763 18:21366289-21366311 TGGGGTAAGGGGATGGGGGAGGG - Intronic
1155840699 18:30638997-30639019 TGAAGTAAGGTGACAGTGTATGG - Intergenic
1155895699 18:31323375-31323397 TGGAGTAAGGGTGAGGTGGATGG - Intronic
1156051629 18:32943062-32943084 TGAAGTTAGGGGATATTGGAAGG + Intronic
1157083631 18:44554759-44554781 TGCATTCAGGGGAAGGTGGTGGG - Intergenic
1157311213 18:46554665-46554687 TGAGGGAAGGGGAGAGTGGAGGG + Intronic
1157602451 18:48902324-48902346 TGGAGAAAGGGGAAGGAGGGCGG - Intergenic
1157880156 18:51313767-51313789 TGAAGTAAAGGAAAAGGGGATGG - Intergenic
1158030907 18:52963573-52963595 TGAAGCAGGATGAAGGTGGAGGG + Intronic
1158494287 18:57940183-57940205 CAACGTAAGGTGAAGGTGGATGG - Intergenic
1159134558 18:64321895-64321917 GGTAGTAAGGTGAAGGGGGAAGG + Intergenic
1159179957 18:64890059-64890081 TTAAGGAAGGGGAAGGAGGAGGG + Intergenic
1159311994 18:66720945-66720967 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1159983261 18:74811874-74811896 TGGGGTAAGGGGAAGGGGGAGGG + Intronic
1160141931 18:76332124-76332146 GAAAGGAAGGGGAAGGGGGAGGG + Intergenic
1160648627 19:208147-208169 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1160650226 19:220963-220985 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1161258514 19:3322876-3322898 TGAATGGATGGGAAGGTGGATGG + Intergenic
1161258537 19:3322976-3322998 TGAATGGATGGGAAGGTGGATGG + Intergenic
1162707586 19:12566762-12566784 TGGAGTAGGGGGAGGGGGGAGGG + Intronic
1162973919 19:14197541-14197563 AGAAGTGATGGGAAGGTGGCAGG - Intronic
1163085388 19:14975890-14975912 GGAAGGAAAGGGAAGGGGGAAGG + Intronic
1163185020 19:15631859-15631881 TCAAGTGAGAGGAAGGTAGAGGG + Intronic
1163733248 19:18962337-18962359 TGAATAAGGGGGATGGTGGAGGG - Intergenic
1164522211 19:28988316-28988338 GGAAGGAAGGGGAGGGAGGAAGG + Intergenic
1164721268 19:30433315-30433337 GGAAGTGGGGGGAAGATGGATGG - Intronic
1164956678 19:32392388-32392410 GGAAGGAAGGGAAAGGGGGAGGG + Intergenic
1165416055 19:35694179-35694201 TGAAGGAAGGAGAAGGAAGAAGG - Intergenic
1165460466 19:35940880-35940902 TGAGGCAAGGGGAGGGTTGAGGG + Intronic
1166228431 19:41411525-41411547 GGAAGTAGAGGGAAGGCGGAAGG + Intronic
1167240837 19:48342200-48342222 GGAAGGAAGGGGAAGAAGGAAGG + Intronic
925056865 2:863070-863092 GGAAGGAAAGAGAAGGTGGAGGG - Intergenic
925143315 2:1564706-1564728 AGAAGAAAGGGGAAGCTGGGTGG + Intergenic
925186497 2:1850170-1850192 GGAAGGAAGGGGGAGGGGGAGGG - Intronic
925301319 2:2815016-2815038 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
925332882 2:3072313-3072335 TCAAGTCAGAGGAAGGTGGGTGG + Intergenic
925388816 2:3482127-3482149 AGAGGTAAGGGGAGTGTGGACGG - Intronic
926213530 2:10889470-10889492 AGAAGTAAGGGTGAGGTGAAAGG + Intergenic
926264403 2:11301856-11301878 TGAAGTAAGGGGCAAGGGAAAGG - Intronic
926434144 2:12821509-12821531 TGATGTAAGAAGAAGGAGGAAGG - Intergenic
926638026 2:15204859-15204881 TGCAGTTGGGGGAAGGGGGAGGG + Intronic
926650439 2:15338361-15338383 ATAAGTAAGGGTTAGGTGGAGGG - Intronic
926917840 2:17909861-17909883 TGAAGTTAGGGGAGGGTGGATGG + Intronic
927106773 2:19834417-19834439 GAAAGAAAGGGGAAGCTGGAAGG - Intergenic
927403917 2:22746500-22746522 TGAAGTAAGGAGAAGTTAGAGGG - Intergenic
927557428 2:24045649-24045671 GGAAGGAAGGGGGAGGGGGAGGG + Intronic
927826874 2:26315473-26315495 GGAAGTAAGAGGAAGGAGAAAGG + Intronic
928167701 2:28982591-28982613 TGAAGAAAGGGGGAGGTAGTTGG + Intronic
928323028 2:30298449-30298471 TAAAGAAAGGGGAAGGAGGATGG + Intronic
928328853 2:30341851-30341873 TGAAGTTTAGGGAAGGTGGCAGG + Intergenic
929047479 2:37804131-37804153 TGGGGTCAGGGGAAGGAGGAAGG - Intergenic
929077166 2:38087572-38087594 TGAAGCAAGGGGAAGGAAAAGGG - Intronic
929377331 2:41303989-41304011 TAAAATAAGGGGAAGCTGGGTGG + Intergenic
929809150 2:45174198-45174220 GGATGCAAGGGGAAGGTGGAGGG + Intergenic
931732462 2:65165390-65165412 GGTAGTTGGGGGAAGGTGGATGG + Intergenic
932285180 2:70525606-70525628 AGAAGCAAGGGGCAGGAGGAGGG + Intronic
932714269 2:74090200-74090222 TGAAATAAGGGGTGTGTGGAGGG + Intronic
932747394 2:74345157-74345179 TGAAGTGAAAGGAATGTGGAAGG + Intronic
932807108 2:74793977-74793999 TGGAGTAGGGGGAAGGGGAAGGG - Intergenic
933177977 2:79197303-79197325 AGTGGTAAGGGGAAGCTGGAGGG + Intronic
933386641 2:81619182-81619204 TGGAGTAGGGGGAGGGGGGAGGG + Intergenic
933594432 2:84268342-84268364 TGAGGTAGGGGGAGGGTGGAGGG + Intergenic
933722254 2:85405545-85405567 GGAAGTCAGGGGTAGGGGGAAGG + Intronic
933820186 2:86104190-86104212 AGGTGTAAGGGGAGGGTGGAAGG + Intronic
933943042 2:87260942-87260964 TGAAGGAAGGGGAGGGGTGAAGG + Intergenic
934475983 2:94593817-94593839 TGGAGTTTGGGGAAGGTGGCGGG - Intronic
935207755 2:100911243-100911265 TGAAGAAAGGGGAAGGACCATGG - Intronic
936061949 2:109300646-109300668 AGAAGGAAGAGGAAGATGGATGG - Intronic
936170467 2:110167495-110167517 CGAAGTGCTGGGAAGGTGGAAGG + Intronic
936337171 2:111600620-111600642 TGAAGGAAGGGGAGGGGTGAAGG - Intergenic
936749841 2:115628956-115628978 TGGGGTAGGGGGAAGGGGGAAGG - Intronic
937074529 2:119091275-119091297 TGGATGAAGGGGTAGGTGGATGG + Intergenic
937090462 2:119202818-119202840 TGAGGTGATGGGAAGGGGGAGGG - Intergenic
937614439 2:123905022-123905044 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
937773409 2:125747918-125747940 AAAAGCAATGGGAAGGTGGAAGG + Intergenic
937921576 2:127135288-127135310 GGATGGAACGGGAAGGTGGAGGG + Intergenic
938957675 2:136314504-136314526 GGAAGGAAGGGGAAGGGGAAGGG - Intergenic
939464829 2:142543997-142544019 TGGAGTAAGGGGGAAGGGGAAGG - Intergenic
939766126 2:146252154-146252176 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
940080025 2:149790767-149790789 TGCAGTGAGGGGAAGGGGGAGGG - Intergenic
940602434 2:155878627-155878649 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
941450907 2:165658995-165659017 TGAAGTAACGTGAAGGAGGCAGG + Intronic
941521046 2:166543510-166543532 GAAAGAAAGGGGAAGGGGGAAGG + Intergenic
941763004 2:169265201-169265223 TGAGGTAAGGGGAAGATGTGGGG - Intronic
942588009 2:177507544-177507566 AGAAGTGAGGGGCAGGGGGAAGG - Intronic
943659083 2:190538124-190538146 AGAGGTAAGGGGATGGTGGGAGG - Intergenic
943820974 2:192320429-192320451 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
943920726 2:193705043-193705065 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
944972149 2:205005313-205005335 TGAAGAAAGCTGAAGGTGGTTGG + Intronic
945177908 2:207062261-207062283 TAAAGGATGGGGAAAGTGGATGG + Intergenic
945349248 2:208758240-208758262 TGGGGTGAGGGGAGGGTGGAGGG - Intronic
945474847 2:210269258-210269280 TGAAGTAGGGGGAAGTGGAATGG - Intergenic
945556834 2:211287319-211287341 TGAGGGAGGGGGAAGGTGGGAGG + Intergenic
946010496 2:216560149-216560171 AGAAGGAAGGGGAAGGGGAATGG - Intronic
946152346 2:217785109-217785131 TGAGGGAAGGGGCAGATGGAAGG + Intergenic
946324952 2:218980521-218980543 TGAGGTGAGGGGCGGGTGGAAGG + Intergenic
947783043 2:232787364-232787386 TGAAATAAGGGAAAGTTTGATGG + Intronic
947811873 2:233009870-233009892 TGGAGTGGAGGGAAGGTGGAGGG - Intronic
948577640 2:238964969-238964991 GGAAGGATGGGGAAGGAGGAGGG - Intergenic
948695721 2:239732192-239732214 TGGAGGAAGGAGAGGGTGGAGGG - Intergenic
948818740 2:240527564-240527586 TGAATTAATGGGTAGGTGGGTGG + Intronic
1168863178 20:1060793-1060815 TGAAGTTGTGGGAAGATGGAAGG - Intergenic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1169469488 20:5871754-5871776 GGAAGAAGGGGGAAGGGGGAAGG + Intergenic
1169469500 20:5871778-5871800 GGAAGAAGGGGGAAGGGGGAAGG + Intergenic
1169469512 20:5871802-5871824 GGAAGAAGGGGGAAGGGGGAAGG + Intergenic
1169469529 20:5871836-5871858 GGAAGAAGGGGGAAGGGGGAAGG + Intergenic
1169686850 20:8284765-8284787 AGAATTAAGGGCAAAGTGGAAGG - Intronic
1170126091 20:12965699-12965721 TGAAGTGAGGGGAGGGAGGGTGG + Intergenic
1171069783 20:22057492-22057514 TGAATGAAGGGAAAGGTGGATGG + Intergenic
1171086001 20:22239017-22239039 TGATGTACTGGGAATGTGGATGG - Intergenic
1171368389 20:24643230-24643252 TTAAGTAAGTGGATAGTGGATGG - Intronic
1171528681 20:25836552-25836574 TGAAGCATGGAGAAGATGGAAGG + Intronic
1171539423 20:25934923-25934945 TGGGGTAGGGGGAAGGTGGGAGG - Intergenic
1171548145 20:26019334-26019356 TGAAGCATGGAGAAGATGGAAGG - Intergenic
1172224410 20:33295824-33295846 GGAAGGAAGGGGAAGGGGAAGGG + Intronic
1172595663 20:36149501-36149523 GGAAGTAGGGGGCAGCTGGAGGG + Intronic
1173053023 20:39583674-39583696 AGAGGAAAGGGGAAGGGGGAAGG + Intergenic
1173185053 20:40834204-40834226 TTGAGTAAGAGGGAGGTGGACGG + Intergenic
1173294280 20:41742199-41742221 GGAAGGAAGGGGAAGGAGGAAGG - Intergenic
1173571394 20:44078976-44078998 AGGAGTAAGAGGAAGCTGGAAGG - Intergenic
1173609999 20:44360172-44360194 TGAATGAATGGGAAGATGGATGG + Intronic
1174137535 20:48390980-48391002 GGAAGGAAGGGGAAGGAGGGAGG + Intergenic
1175293721 20:57894811-57894833 AGAAGGAGGGGGAAGGAGGAAGG + Intergenic
1175831551 20:61967580-61967602 GGAAGGGAGGGGAAGGGGGAAGG - Intronic
1176270373 20:64233109-64233131 AGAAGGGAGGGGAAGGAGGAGGG - Intronic
1176901258 21:14444970-14444992 TGATGTAAGGGTGAGGTGAAGGG - Intergenic
1177322096 21:19535992-19536014 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1177572859 21:22909614-22909636 TGGGGTCAGGGGAAGGGGGAGGG + Intergenic
1177833566 21:26167248-26167270 GGGAGTAAGGGGAGGGAGGAGGG + Intronic
1178277812 21:31254833-31254855 GCAAGAAAGGGGAAGGAGGATGG + Intronic
1179089945 21:38255727-38255749 TGAACTAAGTGGGAGCTGGAAGG - Intronic
1179264096 21:39786958-39786980 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1179714341 21:43279979-43280001 TGAGGTGAGGTGGAGGTGGAGGG + Intergenic
1179787810 21:43739880-43739902 TGGGGTAAGGGGTAGGAGGAGGG - Intronic
1180027722 21:45177421-45177443 TGAAGGAAGGGGAAGTTCCAGGG + Intronic
1180085949 21:45507982-45508004 TGAATCAATGGGGAGGTGGATGG + Intronic
1180910496 22:19446982-19447004 TGAAGCAGAGGGTAGGTGGATGG - Intronic
1181041265 22:20193763-20193785 TAAAGTCAGGGGAATGTGGCAGG - Intergenic
1181341381 22:22182522-22182544 TGAAGTAAGGATAAGAGGGAAGG - Intergenic
1181441506 22:22938237-22938259 GGGAGAAAGGGGTAGGTGGATGG + Intergenic
1182015335 22:27034392-27034414 GGAAGCAAAGGGAAAGTGGAAGG + Intergenic
1182025509 22:27115060-27115082 TGATGAAAGATGAAGGTGGAAGG + Intergenic
1182262571 22:29085328-29085350 TGTAGTAAGGGGAATGAAGAGGG - Intronic
1182671543 22:32000302-32000324 GGAGGTAAGGGGAAAGGGGAGGG - Intergenic
1182673236 22:32015704-32015726 GGAAGTGAGGGGAAACTGGAGGG - Intergenic
1182970521 22:34570434-34570456 TTAAGTAAATGGATGGTGGATGG - Intergenic
1183107171 22:35622831-35622853 TGAAGGAAGGGGAGGATGGGTGG - Intronic
1183122176 22:35738456-35738478 TGAATCTAGGGGAGGGTGGACGG + Intergenic
1183491142 22:38116252-38116274 TGGGGAAAGGGAAAGGTGGATGG - Intronic
1183764917 22:39864223-39864245 GGAATGAGGGGGAAGGTGGAAGG - Intronic
1184312216 22:43653778-43653800 TGGAGGAAGGGGCAGGGGGAGGG + Intronic
1185029936 22:48436993-48437015 AAAAGTGAGGGGAAGGTAGATGG + Intergenic
949493526 3:4610960-4610982 AGAAGGAGGGGGAAGGGGGAAGG - Intronic
949824787 3:8154208-8154230 TGAAGTCAGAAGGAGGTGGAAGG - Intergenic
949970038 3:9396886-9396908 CGAAGGAAGGGGAGGGTGGGAGG + Intergenic
949976974 3:9469968-9469990 TGGAGGAAGGAGAAGGTAGACGG - Intronic
950483756 3:13260836-13260858 TGAAGGAAGAGGAGAGTGGAGGG + Intergenic
950762413 3:15243785-15243807 TGAAGTGGGGGGAGGGTGGGAGG + Intronic
950835402 3:15914463-15914485 TGAGGCAAGGGGGAGGTGGCTGG - Intergenic
950904247 3:16523313-16523335 TGAAGTCTGGGCAGGGTGGAGGG - Intergenic
951795915 3:26538204-26538226 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
951930116 3:27955879-27955901 GGAAGGAAGGGGAAGGGGAAGGG - Intergenic
952875629 3:37941977-37941999 TTAAGTAAGGGGATTGGGGAGGG + Intronic
952894605 3:38069711-38069733 TGAAATGAGGTGCAGGTGGAAGG - Intronic
953246865 3:41200450-41200472 TGAAATAAGGGGGTGGAGGAAGG + Intronic
953266178 3:41390945-41390967 TGAAGGGAAGGGAAGGGGGATGG - Intronic
953503060 3:43456667-43456689 TTAAATAAGTGAAAGGTGGAAGG + Intronic
953639724 3:44695186-44695208 TGGGGTGAGGGGAAGGGGGACGG + Intergenic
953781026 3:45870794-45870816 AGAAGTCAGGGGGTGGTGGAAGG - Intronic
953916195 3:46922553-46922575 TGAGCTAAGGCAAAGGTGGATGG + Intronic
953925059 3:46978553-46978575 TGAGGTAAGGGGATGGGGAAGGG + Intronic
953979091 3:47404847-47404869 TGCAGCAAGGAGAAGGGGGAAGG - Intronic
954397305 3:50299537-50299559 TGACGCAAGGAGAAGGAGGAGGG - Intergenic
954411764 3:50374121-50374143 GGAGGTAAGGGGAAGGAGGAAGG + Intronic
954701899 3:52454950-52454972 CGAAGGAAGGTGTAGGTGGATGG - Intergenic
955015835 3:55067932-55067954 AGAAGCAAGGGGAAAGAGGACGG + Intronic
956161026 3:66352773-66352795 AGAGGTATGGGGAAGGGGGATGG - Intronic
956269208 3:67432025-67432047 TGCAGGAAGGGGATGATGGATGG + Intronic
956668252 3:71662167-71662189 TACTGTAAGGGCAAGGTGGAGGG + Intergenic
957265956 3:77966112-77966134 TGGAGTAGGGGGAAGGGGAAGGG + Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
958129183 3:89395803-89395825 GGATGGGAGGGGAAGGTGGAAGG - Intronic
958770212 3:98417152-98417174 TGGAGTAGGGGGATGGGGGAGGG - Intergenic
958878824 3:99645966-99645988 TGGAGTAAGGGGAAGGGAGCTGG + Intronic
959180048 3:102967857-102967879 TGGAGTCGGGGGAAGGGGGAGGG - Intergenic
959237453 3:103743199-103743221 TGAGGTGGGGGGAAGGGGGAGGG - Intergenic
959416219 3:106078909-106078931 GGAAGGAAGGGGAGGATGGAAGG - Intergenic
959640252 3:108623977-108623999 TGTAGTCAGGGGATGGAGGAAGG + Intronic
960360270 3:116702646-116702668 TGAAATAAAGGGAAAGGGGAAGG + Intronic
960899656 3:122542212-122542234 AGAAGAAAGGGGTAGGGGGAGGG - Intronic
961527729 3:127517553-127517575 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
961551461 3:127672612-127672634 TGAAGTCGGGGGAAGCGGGAAGG - Exonic
961946848 3:130700188-130700210 TGAAGTAAAGGGAATATGAAGGG - Intronic
962077365 3:132096837-132096859 TCACGTAAGGTGGAGGTGGAGGG + Intronic
962081431 3:132143061-132143083 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
963199825 3:142574838-142574860 TGAAATAAGGGTAAGAGGGAGGG + Intronic
963239514 3:142989239-142989261 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
963676376 3:148316531-148316553 TGGGCTAAGGGAAAGGTGGAGGG + Intergenic
963854459 3:150239240-150239262 GGAAGGAAGTGGGAGGTGGAAGG + Intergenic
964144111 3:153437902-153437924 TAATGTCAGGGGAAGATGGATGG + Intergenic
965660586 3:171037867-171037889 TGAACAAAGGTGAAGGTAGAAGG - Intergenic
966001421 3:174953344-174953366 GGAAGGAAGGGGAAAGAGGAGGG - Intronic
966409218 3:179631446-179631468 TGCAGTAAGGGGAAACTGGAAGG - Intergenic
966437851 3:179908609-179908631 TGGAGTAGGGGGAGGGGGGAGGG - Intronic
967336695 3:188352088-188352110 TTAAGTCAGGAGAAGGAGGAAGG - Intronic
967364583 3:188671501-188671523 TGTAGTAAGGGAAAGGGGGAGGG - Intronic
967568512 3:190999762-190999784 GGAAGGAAGGGGAGGGAGGAGGG + Intergenic
968367620 3:198199166-198199188 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
968369222 3:198211968-198211990 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
968762992 4:2451912-2451934 TGAAGGGAGGGGTGGGTGGATGG + Intronic
969173759 4:5384126-5384148 CGAAGTGAGTGGAAGGAGGATGG + Intronic
969551274 4:7869224-7869246 AGGAGGAAGGGGAAGGAGGAAGG + Intronic
970122756 4:12775276-12775298 GGAAATAAGGGCAAGGTGGGTGG - Intergenic
970311000 4:14782438-14782460 GGAAGGAAGGGAAAGATGGATGG + Intergenic
970444184 4:16110224-16110246 GGAAGGAGGGGGAAGGAGGAAGG + Intergenic
970444191 4:16110241-16110263 GGAAGGAGGGGGAAGGAGGAAGG + Intergenic
970444198 4:16110258-16110280 GGAAGGAGGGGGAAGGAGGAAGG + Intergenic
970572043 4:17392879-17392901 AGAAGGAAGGAGAGGGTGGAAGG + Intergenic
971177506 4:24293748-24293770 TGAAGCAAGGGGATGGTGCCTGG - Intergenic
973149859 4:46873811-46873833 TGGGGTGAGGGGAAGGGGGAGGG - Intronic
973602672 4:52557665-52557687 TGATATAAGGGGAAGTTGGCTGG - Intergenic
974389103 4:61242006-61242028 TGATGTGAGAGGAAGCTGGAGGG - Intronic
975010110 4:69340272-69340294 CAGAGTAGGGGGAAGGTGGAGGG + Intronic
975270381 4:72425475-72425497 TGGGGTAAGGGGAAGGGGGAGGG - Intronic
975372000 4:73599883-73599905 TGAAGTGAGGGAAGGGTGGGAGG - Intronic
975757681 4:77587268-77587290 TGAACAAAGGGGATGGTGGTGGG - Intronic
976571541 4:86617566-86617588 TGCTGGAAGGGGAAGGGGGAGGG - Intronic
976737075 4:88320976-88320998 TCAATTCAGGGAAAGGTGGAAGG + Intergenic
978315624 4:107433293-107433315 TGAACAAAGTGGAAGGTGGTAGG - Intergenic
978695421 4:111571087-111571109 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
978753510 4:112279253-112279275 TGAAGTGAAGTGTAGGTGGAGGG - Intronic
979256035 4:118608878-118608900 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
979257647 4:118621696-118621718 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
979327247 4:119394510-119394532 TGAAGTAAGTGTTAAGTGGAAGG + Intergenic
979330700 4:119418866-119418888 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
979332309 4:119431659-119431681 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
979379741 4:119994970-119994992 GGAAATAAGGGGAAGGGGCACGG - Intergenic
980867530 4:138570757-138570779 TGGAGTGGGGGGAAGGGGGAGGG + Intergenic
981046667 4:140271108-140271130 TGAAGCAATGAGAAGGAGGAGGG + Intronic
981990060 4:150907338-150907360 GGGAGGAAGGGGAAGGGGGAGGG + Intronic
982061162 4:151605354-151605376 TGAAGTAAGAGGTAGATGGAAGG + Intronic
982156013 4:152521638-152521660 AGAAATAAGGGGACGGTGGAAGG + Intronic
982383189 4:154771912-154771934 TGGGGTAGGGGGAGGGTGGAGGG - Intergenic
982435438 4:155379392-155379414 GGAATTAGAGGGAAGGTGGAAGG - Intergenic
982981767 4:162146709-162146731 GGAAGGAAGGGGAAGGGGAAGGG - Intronic
983083094 4:163412106-163412128 AGAAGGAAGGTAAAGGTGGAGGG + Intergenic
983245130 4:165279198-165279220 TGAAGTAAGTGCTAAGTGGAAGG + Intronic
983440473 4:167777346-167777368 TGGGGTAGGGGGAAGGGGGAAGG - Intergenic
984164201 4:176288174-176288196 GGAAGGTAGGGGAAGGGGGAAGG - Intergenic
984310383 4:178051003-178051025 TGGTGTAAGGGGATGGGGGAGGG - Intergenic
985188583 4:187345977-187345999 TCAAGGAAGTGGAAAGTGGACGG - Intergenic
985783091 5:1881106-1881128 TGGAGTAGGAGGAAGTTGGAGGG + Intronic
986117194 5:4787185-4787207 TGAGGTAGGGGGATGGGGGAGGG + Intergenic
986600298 5:9466219-9466241 TGGGGTGAGGGGAAGGGGGAGGG + Intronic
986856859 5:11879164-11879186 TGAAAGGAGAGGAAGGTGGAGGG + Intronic
986921973 5:12696058-12696080 TTAAATAATGGGAAGGTGAAAGG + Intergenic
987447647 5:18040687-18040709 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
987517054 5:18924123-18924145 AGAAGAAAGGGAAAGGAGGAAGG + Intergenic
987561577 5:19530574-19530596 TGGGGTAGGGGGAAGGGGGAGGG - Intronic
987797926 5:22654025-22654047 GGAAGGAAGGGGAAGGGAGAAGG - Intronic
988828053 5:34960104-34960126 TGAATGAAGGGGAAGATGAAGGG + Intergenic
989272912 5:39553643-39553665 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
989477737 5:41893236-41893258 GGAAGGGAGGGGAAGGAGGAAGG + Intergenic
989585097 5:43068284-43068306 TGAAGAAAGGGTAAGGTATAGGG - Intronic
989823045 5:45818606-45818628 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
990611350 5:57460041-57460063 TGGGGTCAGGGGAAGGGGGAGGG - Intergenic
990719751 5:58680926-58680948 TGAAGCAAGGGGGATGTGGTGGG - Intronic
990821408 5:59844767-59844789 TTATGTATGGAGAAGGTGGAGGG + Intronic
990829086 5:59936211-59936233 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
990843492 5:60109861-60109883 TGAGGTGAGGGGACGGGGGAGGG + Intronic
990982111 5:61611156-61611178 TGGAGTGAGGGGTATGTGGAGGG + Intergenic
991379200 5:66001955-66001977 GGGAGTGAGGGGAAAGTGGAGGG - Intronic
991563693 5:67982525-67982547 TGTGGTAAGGGGAGGGAGGAGGG + Intergenic
991641681 5:68760638-68760660 TGAAATAAGGCAAAGGTAGAAGG - Intergenic
992171031 5:74102269-74102291 TGAAGGAAGGGGAGGGGGGGAGG - Intergenic
992605165 5:78448084-78448106 TGGAGTAGGGGGAAGGGGGAGGG - Intronic
992629885 5:78669610-78669632 GGAAGGAAGGGAAAGGAGGAAGG + Intronic
992744065 5:79801969-79801991 TGTGGCAAGGGGACGGTGGAAGG + Intergenic
992757897 5:79926190-79926212 TGTAGTAAGGGCAAGGTGGTGGG + Intergenic
993176575 5:84494383-84494405 GGAAGAAAGGGGAGGGAGGAAGG - Intergenic
993212731 5:84975536-84975558 TGGGGTAGGGGGAGGGTGGAGGG - Intergenic
993310901 5:86330937-86330959 TGACGTCAGGGGATGGAGGATGG + Intergenic
993360593 5:86970596-86970618 TGAAGAAAGGGGAAGATGAAAGG + Intergenic
993554678 5:89321227-89321249 TGAGGGAAGGGGAAGGGGAAAGG + Intergenic
993658370 5:90600295-90600317 TGAGGTGGGGGGAAGGGGGAGGG - Intronic
993754724 5:91714328-91714350 AGAAGCAAGAGAAAGGTGGAGGG + Intergenic
993997560 5:94741009-94741031 TGAAGTTAGAGGAAGCTGGTGGG + Intronic
994825002 5:104702022-104702044 TGGAGTAGGGGGAGGGGGGAGGG - Intergenic
995767709 5:115636855-115636877 TGCAGGATGGTGAAGGTGGATGG + Intergenic
995966451 5:117913004-117913026 TGAACTAAGTGGGAGGTGGGTGG + Intergenic
996117963 5:119639554-119639576 AGTAGTAAGGGGAAGTTGGCTGG + Intergenic
996189494 5:120521812-120521834 TGGGGTAAGGGAAAGGGGGAGGG - Intronic
996250033 5:121318093-121318115 AAAAGTAAAGGGATGGTGGAAGG + Intergenic
996495606 5:124151544-124151566 TGGAGTTAGGGGAAAGGGGATGG + Intergenic
996630601 5:125626782-125626804 TGGGGTAAGGGGAGGGGGGAGGG + Intergenic
996819861 5:127614547-127614569 TGGGGTAGGGGGAAGGGGGACGG + Intergenic
997082141 5:130752989-130753011 TGGGGTGAGGGGAAGGGGGAGGG - Intergenic
997968392 5:138379316-138379338 TGAGGCAAGGGGGAGTTGGAGGG + Intronic
998243359 5:140471425-140471447 TGAAATAGGGGTAAGGTGGCAGG + Intronic
998392280 5:141795110-141795132 TGAGGTCTGCGGAAGGTGGATGG - Intergenic
999026376 5:148236427-148236449 TGGAGTGGGGGGAAGGGGGAGGG + Intergenic
999100702 5:149023517-149023539 TCAAGGAAAGGGAAGTTGGAAGG + Intronic
999558879 5:152776833-152776855 TGGAGTGAGGGGATGGAGGAGGG + Intergenic
999765539 5:154737902-154737924 TGAAGCAAGGGGAATGTTCAGGG - Intronic
999972996 5:156883589-156883611 TGGTGTAAGGGGCAGGTGAAGGG - Intergenic
1000101602 5:158022227-158022249 AGAAGGAAGGGGAAGGTGAAGGG - Intergenic
1000443217 5:161287095-161287117 TGTAGTCAGGGGAAGGTGGGAGG - Intergenic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1002458041 5:179356943-179356965 TGAAGTGAGGGAAAGGAGGTAGG + Intergenic
1002726843 5:181304395-181304417 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1002728500 5:181317553-181317575 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1002923640 6:1592107-1592129 TGAAGTCAGTGGAAGCTGCATGG - Intergenic
1003364536 6:5459784-5459806 GGAAGAAATAGGAAGGTGGAGGG - Intronic
1003463125 6:6351065-6351087 TGAAAAAAGGGGAAGGTGGCTGG + Intergenic
1003980948 6:11389334-11389356 TGATGTGATGGGAAGGTGAAGGG - Intergenic
1004582733 6:16970058-16970080 GGAAGAGAGGGGAAGGTAGATGG + Intergenic
1004902833 6:20209962-20209984 AGAAGTAGGGGGCAGCTGGAGGG - Intronic
1005173456 6:23015061-23015083 AGGAGGAAGTGGAAGGTGGAAGG + Intergenic
1005223856 6:23619787-23619809 GGAAGGAAGGGGAAGGAGAAGGG + Intergenic
1005777624 6:29153400-29153422 GGAAGGAAGGGGAAGGGGAAGGG - Intergenic
1006193694 6:32224184-32224206 GGAAGTAGGGGGAAGTAGGACGG + Intergenic
1006268523 6:32945638-32945660 TGAGGTAAGGGGTAGATGGCAGG - Intronic
1006746403 6:36345884-36345906 TGACGTTTGGGGAATGTGGAGGG + Intergenic
1006827414 6:36946348-36946370 TGAAGTTAGGGGAGGGTGAGAGG - Intergenic
1007360396 6:41351407-41351429 TGAGGGAAGGGGACAGTGGAGGG + Intergenic
1007465229 6:42047129-42047151 TGAGGGAAGGGGAAGCCGGAAGG + Intronic
1008385851 6:50888947-50888969 TGAAGTAGGGGGAGGGTAGAGGG + Intergenic
1008405869 6:51117939-51117961 TGAAGTAAGAGGTGGGTAGAAGG - Intergenic
1009929275 6:70157008-70157030 AAAAGTAAGGGAAAGGAGGAAGG + Intronic
1011116323 6:83897051-83897073 TGAGGTAGGGGGACGGGGGAGGG - Intronic
1011329879 6:86192337-86192359 GGAAGTAAGAGAAAGGTGGGTGG - Intergenic
1012546265 6:100423212-100423234 TGAAGCAAGGGGTAGATGAAGGG - Intronic
1012671985 6:102064226-102064248 AGAAGAAAGGGAAAGCTGGAGGG - Intronic
1012740391 6:103008868-103008890 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1013088219 6:106874956-106874978 AGAAGTAAGGGCAGGGTGGAGGG + Intergenic
1013269635 6:108534005-108534027 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
1013269647 6:108534061-108534083 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
1013282644 6:108653243-108653265 TGAATTAATGGGAAGGGGGCAGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013710265 6:112888810-112888832 TGGATTAAGGGGAAAGTGGGTGG - Intergenic
1014163498 6:118197227-118197249 TGAAGGAAGGGAGAGATGGAAGG - Intronic
1014358232 6:120438557-120438579 TGGGGTGAGGGGAAGGAGGAGGG + Intergenic
1014416416 6:121190282-121190304 GGAAGAAAGGATAAGGTGGAGGG - Intronic
1015974497 6:138775284-138775306 TAAAGTAAGGGGATTGTGTAGGG + Intronic
1016926386 6:149353281-149353303 AGAAGTAAGGGGAAGGAGTAAGG - Intronic
1017306457 6:152923731-152923753 TGGAGTAGGGGGAGGGGGGAGGG - Intergenic
1018083514 6:160278928-160278950 TGAGGAACGGGGAAGGGGGAAGG - Intergenic
1018623884 6:165758688-165758710 AGAAGGAAGGAGAAGGAGGAGGG + Intronic
1018699590 6:166416103-166416125 TGAAGGATGGTGAGGGTGGATGG - Intronic
1019374476 7:682029-682051 TGAAGTAAGGGGAGGGAGGGAGG + Intronic
1019388355 7:771250-771272 TGAAGTAAGGGCAAGAAGCATGG + Intronic
1019512903 7:1426887-1426909 TGGAGTCAGGGGCTGGTGGAGGG + Intergenic
1019806463 7:3129929-3129951 GGAAGTGAGGGGAAGGAGGGAGG + Intergenic
1019870292 7:3754668-3754690 CTAAGTAAGGGGAAGGGGGGTGG + Intronic
1019971477 7:4544380-4544402 GGCATTAAGGGGAAGGTGGCAGG - Intergenic
1020990032 7:15184630-15184652 GGAAGGAAGGGAAAGGAGGAAGG + Intergenic
1020990051 7:15184686-15184708 GGAAGGAAGGGAAAGGAGGAAGG + Intergenic
1021095367 7:16529192-16529214 TGAAGTAAAAGGCATGTGGAAGG - Intronic
1021294134 7:18882867-18882889 TGAAGAAAATGGAAGGAGGATGG + Intronic
1022237619 7:28477266-28477288 TGAAGAAAGGGGAAGGGAAAAGG - Intronic
1022528059 7:31051151-31051173 TCAAGAAGGGGGAAGGAGGAGGG - Intergenic
1022694974 7:32696105-32696127 TGGAGTGAGGGGAGGGGGGAGGG - Intergenic
1022839060 7:34145305-34145327 TGGAGTCAGAGGAAGGTGAAAGG - Intronic
1023399631 7:39782955-39782977 GGAGGAAAGGGGGAGGTGGAGGG + Intergenic
1024071736 7:45792008-45792030 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1024072567 7:45798759-45798781 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1024650765 7:51401423-51401445 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1025054886 7:55757003-55757025 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1025132959 7:56387229-56387251 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1025257775 7:57397245-57397267 GGAAGGAAGGGGAAGGGGAAGGG - Intergenic
1025909519 7:65817114-65817136 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1025911032 7:65828837-65828859 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1025982788 7:66420964-66420986 CGAAGTAAGGGGTGGGGGGACGG - Intergenic
1027163737 7:75820569-75820591 TGAATTAATGGGTAGGTGGATGG - Intronic
1028306244 7:89269204-89269226 TGGGGTAGGGGGAAGGGGGAGGG - Intronic
1028505502 7:91566068-91566090 TGAGGAAAGTGGAAGGAGGAAGG - Intergenic
1029020215 7:97357234-97357256 AGGAGTGGGGGGAAGGTGGAAGG + Intergenic
1029418864 7:100461618-100461640 GGTTGTTAGGGGAAGGTGGAGGG - Intronic
1029567729 7:101350085-101350107 GGAAGGTAGAGGAAGGTGGAAGG - Intergenic
1029987370 7:104934500-104934522 GGAATTAAGGAGAAGGTGGGTGG - Intergenic
1030103482 7:105967095-105967117 TGGGGTGAGGGGAAGGAGGAGGG - Intronic
1030423092 7:109333903-109333925 GGAAGGAAGGGGAAGAAGGAAGG - Intergenic
1030974956 7:116110076-116110098 TGGAGTGGGGGGAAGGGGGAGGG + Intronic
1031058175 7:117017539-117017561 TGAAGGAAGGGCAAGGTTGCAGG + Intronic
1032048353 7:128629614-128629636 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1032049954 7:128642437-128642459 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1032204072 7:129846468-129846490 TCAAGTCAGGGGCAGGTGGATGG + Intronic
1032438794 7:131925163-131925185 TGAACTGAGGGGCAGGTGGTTGG + Intergenic
1032438948 7:131926956-131926978 TGAACTGAGGGGCAGGTGGTTGG + Intergenic
1032467286 7:132153963-132153985 TGAAGAAAGGAAAGGGTGGAAGG + Intronic
1032506071 7:132435573-132435595 TGAAGAAAGTGGAAAGTGAAAGG + Intronic
1032506098 7:132435767-132435789 TGTAGGAAGGGGAAGGGAGATGG - Intronic
1032610465 7:133407284-133407306 CAAAGTAAGAGGATGGTGGATGG - Intronic
1033045969 7:137962450-137962472 TCAGGGAAGGGGAAGGAGGATGG - Intronic
1033496581 7:141903316-141903338 TGAAATAAGGTGAAGGTAGAAGG + Intergenic
1033804404 7:144937635-144937657 GGAAGGAAGGGGAAGGGGAAAGG - Intergenic
1033888655 7:145980058-145980080 TGGAGTGGGGGGAAGGGGGAGGG + Intergenic
1033973892 7:147075772-147075794 TGGGGTAGGGGGAAGGGGGAGGG - Intronic
1033991369 7:147291311-147291333 TGGAGTGAGGGGAAAGGGGAGGG - Intronic
1035000486 7:155608879-155608901 TGTTGTGAGGGAAAGGTGGAGGG + Intergenic
1036505035 8:9347450-9347472 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
1036633691 8:10532791-10532813 TGAAGGAAGGGGATGGGGGCTGG + Intronic
1037571813 8:20164389-20164411 TGAAGGGAGGAGAATGTGGATGG + Intronic
1037587934 8:20290811-20290833 TGAAGCAGGAGGAAGGAGGAAGG + Intronic
1037900522 8:22685619-22685641 TGAAGTAGGGAGAAGGTGGAGGG - Intergenic
1037916492 8:22776260-22776282 TGAAGAAAGGGGAAAGGGAAGGG - Intronic
1038020921 8:23551303-23551325 TGAAGAAAGGTGAATGGGGAGGG + Intronic
1038039225 8:23709981-23710003 TGAAGTAGGAGGAGGGAGGAGGG - Intergenic
1038513525 8:28162943-28162965 AGAAGGAAGGGGAAGGTCTAAGG + Intronic
1038721196 8:30037078-30037100 TGGAGTCAGGGGAGGGAGGATGG - Intergenic
1038943150 8:32328057-32328079 TGAAGTCAGAGGAAGGAGCATGG + Intronic
1039127627 8:34220915-34220937 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
1041547225 8:59059226-59059248 TGAAGGAAGGGGAATGAGAAAGG - Intronic
1041962343 8:63632998-63633020 TGAGGGGAGGGGAAGGGGGAGGG + Intergenic
1042122618 8:65505231-65505253 TAAAGTAAAGGGCAGGGGGAAGG - Intergenic
1042335530 8:67626247-67626269 TGAAGTAAGGCTAATATGGAGGG + Intronic
1042435236 8:68756488-68756510 TGAAGTAACGGGTAGGGGGTGGG + Intronic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1043655193 8:82655802-82655824 TGGAGTTGGGGGAAGGGGGAGGG - Intergenic
1043751967 8:83948910-83948932 GGAAGGAAGGGGAAGAGGGAAGG + Intergenic
1043777745 8:84291161-84291183 AGAAGTAAGGGAAAAGAGGACGG + Intronic
1044812360 8:96076401-96076423 TGGGGTAGGGGGAAGGGGGAAGG + Intergenic
1044933814 8:97275372-97275394 AGAAGGAAGGGGAAGGCAGAAGG + Exonic
1045166582 8:99613433-99613455 TGAAGTAAGGGACAGGTGAATGG - Intronic
1045247197 8:100453397-100453419 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
1045247236 8:100453594-100453616 GGAAGGAAGGGGAAGGGGAAGGG + Intergenic
1045915091 8:107459784-107459806 TGAAGTAGAGGGAAAGTGGTAGG + Intronic
1046089242 8:109479324-109479346 TGAAGAAAGGGGTAGAAGGATGG - Intronic
1046318399 8:112537019-112537041 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1046592730 8:116225450-116225472 AGAAATAAATGGAAGGTGGAAGG - Intergenic
1046739411 8:117812540-117812562 AGAACTGAGGGGAAGGGGGAGGG - Intronic
1047105287 8:121724699-121724721 TGAAGTAGGCGGCAGGGGGAGGG + Intergenic
1047123349 8:121931164-121931186 AAAAGTAAGGGGAAGTTGAAGGG + Intergenic
1047779918 8:128102734-128102756 TGAGGAAAGGGGAAAGTGGGTGG - Intergenic
1048232845 8:132660590-132660612 TGAATTAAAGGGAAGAGGGAAGG - Intronic
1048422178 8:134288020-134288042 TGAAACAATGGGAAGGTAGATGG + Intergenic
1048574138 8:135677783-135677805 TGCAGTGAGGGGTAGGTGAAAGG + Intergenic
1049014226 8:139908247-139908269 TGGAGGAAGGGGCAGGTGCATGG - Intronic
1049282701 8:141758616-141758638 TGAAGGAAAGGGAAGATGGCAGG - Intergenic
1049359557 8:142205810-142205832 GGATGTGAGGGGAAGGGGGAAGG + Intergenic
1049952465 9:658848-658870 TTAACTAGGGGAAAGGTGGAAGG - Intronic
1051295050 9:15586777-15586799 TTAATTAAAGGGAAGCTGGAAGG - Intronic
1051472147 9:17456006-17456028 TGAAGGTAGGGAAAGGTTGACGG + Intronic
1051977046 9:22963045-22963067 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1052655120 9:31349146-31349168 GGAAGAAAGGGGAGGGTTGAGGG + Intergenic
1052854062 9:33396102-33396124 TGGAGTTTGGGGAAGGTGGCGGG + Intronic
1053682077 9:40492266-40492288 TGGAGTTTGGGGAAGGTGGCGGG + Intergenic
1053788924 9:41672310-41672332 TGCAGTAGTGAGAAGGTGGAAGG + Intergenic
1053796661 9:41732781-41732803 TGAAGCATGGAGAAGATGGAGGG + Intergenic
1053932064 9:43120592-43120614 TGGAGTTTGGGGAAGGTGGCGGG + Intergenic
1054148522 9:61582080-61582102 TGAAGCATGGAGAAGATGGAGGG - Intergenic
1054185074 9:61944856-61944878 TGAAGCATGGAGAAGATGGAGGG + Intergenic
1054281636 9:63132666-63132688 TGGAGTTTGGGGAAGGTGGCGGG - Intergenic
1054295174 9:63327763-63327785 TGGAGTTTGGGGAAGGTGGCGGG + Intergenic
1054393194 9:64632269-64632291 TGGAGTTTGGGGAAGGTGGCGGG + Intergenic
1054427843 9:65137479-65137501 TGGAGTTTGGGGAAGGTGGCGGG + Intergenic
1054468276 9:65513175-65513197 TGAAGCATGGAGAAGATGGAGGG - Intergenic
1054502533 9:65884059-65884081 TGGAGTTTGGGGAAGGTGGCGGG - Intronic
1054653435 9:67643640-67643662 TGAAGCATGGAGAAGATGGAGGG - Intergenic
1055063143 9:72091515-72091537 TGAACTACTGGGAAAGTGGAAGG + Intergenic
1055660069 9:78494385-78494407 GAAAGAAAGAGGAAGGTGGAAGG - Intergenic
1056096005 9:83254115-83254137 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1056471379 9:86907311-86907333 TGATATAAGGAGGAGGTGGAGGG + Intergenic
1056686540 9:88768262-88768284 TCAAGTAAATGGATGGTGGATGG - Intergenic
1056837525 9:89968966-89968988 TGTGGTTAGGGGCAGGTGGAGGG + Intergenic
1057109000 9:92448937-92448959 TTAAGGAAAGGGAAGATGGAGGG + Intronic
1057175375 9:92993606-92993628 TGGGGTAAGGGGAGGGAGGAGGG - Intronic
1058554651 9:106153871-106153893 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1058897590 9:109413576-109413598 TGAAGAAAGGGGCAGGATGAGGG + Intronic
1059027125 9:110646748-110646770 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
1059355308 9:113694658-113694680 TGAAGGAAGGGCAATGTGGCTGG + Intergenic
1059518062 9:114914096-114914118 TGAGGGAAGTGGAAAGTGGAGGG + Intronic
1059540579 9:115126435-115126457 AGAAGGAAAGGGAAGTTGGAGGG + Intergenic
1060057865 9:120431112-120431134 TGGGGTGAGGGGAAGGGGGAGGG + Intronic
1060165438 9:121410200-121410222 TTAAGTAAATGGATGGTGGATGG - Intergenic
1060967669 9:127720871-127720893 GGGAGGAAGGGGAAGGGGGAGGG - Intronic
1061331885 9:129899794-129899816 GGAAGGAAGGGGAAGGGGAAGGG + Intronic
1061383213 9:130272032-130272054 TAAAGTAAAGGGATGGTGGGTGG - Intergenic
1062050630 9:134444725-134444747 AGAAGGAAGGAGAAGGGGGAAGG - Intergenic
1062096450 9:134706314-134706336 TGCAGGAAGGGGAAGGCAGAGGG + Intronic
1062751961 9:138261871-138261893 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1062753563 9:138274652-138274674 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1203576075 Un_KI270745v1:9431-9453 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1185479231 X:433746-433768 GGAAGGAAGGGGAAGGAGGGAGG + Intergenic
1186481906 X:9902348-9902370 TGGAGGCATGGGAAGGTGGATGG + Intronic
1186791828 X:13007218-13007240 AGAAGAAATGGGAGGGTGGAGGG + Intergenic
1187480178 X:19648228-19648250 TGAAGGGATGGGTAGGTGGAAGG + Intronic
1188110053 X:26186194-26186216 TGGGGTAAGGGGAGGGGGGAGGG + Intergenic
1188360912 X:29252115-29252137 TGGGGTAAGGGGAGGGGGGAGGG + Intronic
1188487139 X:30694411-30694433 TGAAGTAAGTGCTAAGTGGAAGG - Exonic
1188839018 X:34991966-34991988 TGGGGTAAGGGGAGGGGGGAGGG + Intergenic
1189385229 X:40531553-40531575 TGGAGGAAGGGGAAGGGGGTTGG + Intergenic
1189634007 X:42985674-42985696 GGAGGTAATGGGAAGGTGCAGGG + Intergenic
1189892964 X:45624651-45624673 AGAAGTGAGGGGAAAGTGGCTGG + Intergenic
1190469991 X:50769212-50769234 GGAAGAAAGGGGAAGGAGGGAGG + Intronic
1190801882 X:53796710-53796732 TGAAGTAAGGGGAAGGTGGAGGG - Intergenic
1190976101 X:55402504-55402526 TGGGGTCAGGGGAAGGGGGAGGG + Intergenic
1191704377 X:64079001-64079023 TGCCGTAGGGGGAGGGTGGAGGG - Intergenic
1192065300 X:67879019-67879041 TAAGGTAAGTGGAAGGAGGAAGG + Intergenic
1192221968 X:69203522-69203544 GGAAGTGAGGGGGAGGTGCAGGG - Intergenic
1192234180 X:69285615-69285637 TGGAGAAGGGGGAAGGAGGAGGG + Intergenic
1192302622 X:69921519-69921541 TCAAGTAAATGGATGGTGGATGG - Intronic
1192347951 X:70327463-70327485 TGAAACAAGGGGAAGGATGAAGG + Intronic
1192557994 X:72105512-72105534 TGAGGTAGGCGGAAGTTGGAGGG + Intergenic
1192589405 X:72347350-72347372 GGAAGTAAGGAGGAGGAGGAGGG - Intronic
1192722319 X:73712055-73712077 TCAACTAAAGGGAAGGAGGATGG + Intergenic
1192903931 X:75529474-75529496 TGAGGTAGTGGGAGGGTGGAGGG - Intergenic
1192941939 X:75921713-75921735 TGGGGTGAGGGGAAGGTGAAGGG - Intergenic
1193084432 X:77436727-77436749 TGAATTTAGGGGATGGTTGAGGG - Intergenic
1193595759 X:83442914-83442936 TGGGGTGAGGGGAAGGGGGAGGG + Intergenic
1193802213 X:85949878-85949900 TGAAGGAAGGGGAATGTCCATGG + Intronic
1194576909 X:95624546-95624568 TAAAGTAAGGGGTAGGTAGCAGG - Intergenic
1194950047 X:100114880-100114902 TGAGGTAGGGGGATGGGGGAGGG + Intergenic
1195123362 X:101780093-101780115 TGAAGTAAGTGCTAAGTGGAAGG + Intergenic
1195433004 X:104810264-104810286 TGGGGTGAGGGGAAGGGGGAGGG + Intronic
1195451107 X:105014021-105014043 TGAAGTACCTGGAATGTGGATGG + Intronic
1195579461 X:106484861-106484883 TAAATTAAGGGGAAGGTAAATGG - Intergenic
1196072890 X:111544983-111545005 GGAAATAAGGGGTAGGTGCATGG - Intergenic
1196171787 X:112596118-112596140 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
1196316909 X:114237818-114237840 TGGGGTAAGGGGCAGGGGGAGGG - Intergenic
1196490296 X:116257357-116257379 TGAGGTAGGGGGAGGGGGGAGGG + Intergenic
1197260477 X:124312071-124312093 GGAAGAAAGGGGATGGTGGTGGG + Intronic
1197373953 X:125659269-125659291 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
1197753665 X:129981291-129981313 TGAAGAAGGGGGAAGGCGGTGGG - Intronic
1198295878 X:135285946-135285968 TGACGTCAAGGGAAGTTGGAAGG - Exonic
1198553101 X:137765072-137765094 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1200153768 X:153964486-153964508 TGAGGCAAGCGGGAGGTGGAAGG - Intronic
1201305911 Y:12550401-12550423 TGGAGGCATGGGAAGGTGGATGG + Intergenic
1201710941 Y:16990914-16990936 TGGGGTGAGGGGAAGGAGGAGGG + Intergenic
1201916308 Y:19185269-19185291 TGCAGTGGGGGGAAGGGGGAGGG - Intergenic
1202373982 Y:24217102-24217124 TGAGGTGGGGGGAGGGTGGAGGG + Intergenic
1202496799 Y:25453018-25453040 TGAGGTGGGGGGAGGGTGGAGGG - Intergenic