ID: 1190806800

View in Genome Browser
Species Human (GRCh38)
Location X:53845442-53845464
Sequence TCCTATTTAAATATCCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190806796_1190806800 20 Left 1190806796 X:53845399-53845421 CCTGAGTTTTATCATAACTTGAA 0: 1
1: 0
2: 2
3: 40
4: 535
Right 1190806800 X:53845442-53845464 TCCTATTTAAATATCCTGGTGGG 0: 1
1: 0
2: 3
3: 8
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190806800 Original CRISPR TCCTATTTAAATATCCTGGT GGG Intergenic
908540005 1:65113400-65113422 TACTATCTAAGTACCCTGGTTGG + Intergenic
908706482 1:66962237-66962259 TCCTATTTAATTATATTTGTGGG + Intronic
911211358 1:95141901-95141923 TCTTATTACGATATCCTGGTTGG + Intronic
916068122 1:161152739-161152761 TTTAATTTAAATATCCTGTTTGG - Intergenic
916821865 1:168407157-168407179 TCCTTTTTAAATATATTGTTTGG - Intergenic
917037708 1:170767496-170767518 TTCCAAGTAAATATCCTGGTAGG + Intergenic
917106414 1:171496910-171496932 TCCTGCTTCAATCTCCTGGTTGG + Intronic
920110080 1:203581652-203581674 TACTCTTTAAATAACCTTGTGGG + Intergenic
920808690 1:209260573-209260595 ACTTATTTAAATATCTAGGTGGG + Intergenic
924660756 1:246014691-246014713 TCCTATTAAAATACCCAGGAAGG + Intronic
1063108135 10:3011791-3011813 TCATTCTTAAATATCCTGTTGGG + Intergenic
1064000990 10:11663666-11663688 TCCTATTTACAAAGCCAGGTAGG - Intergenic
1065753033 10:28905854-28905876 TCCTAATTAAAAATGCTGATGGG - Intergenic
1067134111 10:43593246-43593268 TCCTATTAAAGTATACAGGTTGG + Intergenic
1068117499 10:52750924-52750946 TCCTATGTTAATGTCCTGGATGG + Intergenic
1071327176 10:84529051-84529073 TAATATTTAAATCTCCTGTTAGG + Intergenic
1071677021 10:87664220-87664242 TCCTTATTAAATATTCTGGCTGG - Intronic
1073623234 10:105070643-105070665 TCCTATTTAACTATCAAGGGAGG - Intronic
1080289053 11:30650365-30650387 TCCTATTTAAAGATCTTTCTTGG + Intergenic
1080572222 11:33566787-33566809 AGCTATTTCCATATCCTGGTAGG + Intronic
1081330741 11:41796707-41796729 TATTATTTTAATATCCTGGATGG - Intergenic
1087044127 11:93830179-93830201 CCCTATTTGAACATCCTCGTGGG - Intronic
1088178381 11:107080730-107080752 TCATATTTAAAGTTCCTTGTAGG + Intergenic
1090446614 11:126770007-126770029 TCCCATTAAAATATCCTGGTTGG + Intronic
1093376991 12:18441423-18441445 TGCTTTTTAAATATACTGGTGGG + Intronic
1093439337 12:19175523-19175545 TTCTATATAAAAATTCTGGTAGG + Intronic
1095456782 12:42395068-42395090 TCAAATTTAAATATTCTGCTTGG + Intronic
1097396916 12:59086365-59086387 TCCTGTTTACATTTCCTGGATGG + Intergenic
1097416104 12:59318285-59318307 TTCTATCTATATATCCTGTTAGG + Intergenic
1098302442 12:69068071-69068093 TATTATTTAATTATCCTGGTTGG + Intergenic
1099473753 12:83082903-83082925 TCATATTCACATGTCCTGGTAGG + Intronic
1101228466 12:102713779-102713801 TGGTATTTACATATCATGGTGGG + Intergenic
1102131813 12:110537114-110537136 TCCTTTTAAAATATACTGATAGG - Intronic
1103347574 12:120261620-120261642 TCCTATTTAGTCATCCTGCTTGG - Intronic
1103462367 12:121115155-121115177 TCCAATTTAACTAGCCAGGTAGG - Intergenic
1107007324 13:35628548-35628570 TCCTATTTAAATATTCAGCTAGG - Intronic
1108772324 13:53718772-53718794 TGCTATTTCATTATCCTTGTTGG + Intergenic
1108792722 13:53991800-53991822 TGCTATTTTAATATTCTGCTAGG + Intergenic
1110828456 13:80001030-80001052 TCCTATTTAGATTTCTTGGAAGG - Intergenic
1111124358 13:83894644-83894666 TCCTATGTTAATATGCTGCTTGG + Intergenic
1111297215 13:86295904-86295926 TAATAATTTAATATCCTGGTTGG + Intergenic
1111587575 13:90302407-90302429 TCCTCTTTAAATTTCCAGATGGG + Intergenic
1112680006 13:101753502-101753524 TCTTATTAAAATTTCCTTGTTGG + Intronic
1113668905 13:112161891-112161913 TGATATTTAATTATACTGGTAGG + Intergenic
1114925228 14:27389015-27389037 TCCTATTTAATTATCCTCTCTGG + Intergenic
1117430195 14:55650260-55650282 TGCTATTTTTATATCTTGGTGGG + Intronic
1117584834 14:57190598-57190620 TGATAATTAAATGTCCTGGTTGG + Intergenic
1118870590 14:69737785-69737807 TCCTATTAAAAAATTATGGTGGG + Intronic
1118933668 14:70265758-70265780 TCCTTTTTCATTATCCTTGTTGG - Intergenic
1120810746 14:88801054-88801076 TTCTTTTTAAATATACTTGTTGG + Intergenic
1127927792 15:63563981-63564003 TACTATTTAAATCTCCTGTCAGG + Intronic
1130317460 15:82809039-82809061 TTGTATTTAAACACCCTGGTTGG + Intergenic
1130391698 15:83461713-83461735 TCATATTTAAAAATTCTTGTAGG + Intronic
1135566648 16:23516362-23516384 TCCTAGATATATATCCTGTTGGG + Intronic
1135695419 16:24582261-24582283 ACTTATTTGAATATCCTGGGAGG - Intergenic
1138039322 16:53645674-53645696 TCCTATGTAAATATTCTCCTGGG + Exonic
1139669443 16:68482369-68482391 TCTTTTTTAAAAATCCTGCTAGG + Intergenic
1141287089 16:82682640-82682662 TCCTATTTGAATTTCCTAGGGGG - Intronic
1144118961 17:12131080-12131102 TCATATTTAAATTTCATGATGGG + Intronic
1146898008 17:36559528-36559550 TCCTATTTAGAGATGGTGGTAGG + Intronic
1149259468 17:54863336-54863358 GGCTATTTAAATATGCTGTTTGG + Intergenic
1149629186 17:58107150-58107172 TCTTATTTAAATTTCTTGGCTGG - Intergenic
1152670515 17:81601948-81601970 TCCTATTTAGATAACCTGCCTGG - Intronic
1156045473 18:32872593-32872615 ACATATTTAAATATCCTGAGAGG - Intergenic
1157519099 18:48332973-48332995 TACTATTTAATTATGCTGATTGG - Intronic
1158011041 18:52728146-52728168 TCCTATTTAATTATGATTGTGGG + Intronic
1160614745 18:80116554-80116576 TTCTTTATAGATATCCTGGTGGG + Intronic
1162883393 19:13677577-13677599 TTCTTTTTATTTATCCTGGTTGG - Intergenic
1164049528 19:21572698-21572720 GTCTATTTACATATCCAGGTAGG + Intergenic
925158815 2:1667472-1667494 TCCTATTTGAATACCCTCTTAGG - Intronic
926236208 2:11046101-11046123 ACCAATGTCAATATCCTGGTTGG + Intergenic
926863029 2:17328756-17328778 TCCTATTTCAATGCCCTGATTGG + Intergenic
928653772 2:33428164-33428186 TCCTAGTTAACTATCATGATGGG + Intergenic
930629434 2:53736304-53736326 TTCATTTTAAATATTCTGGTGGG - Intronic
934607684 2:95709596-95709618 TCCATTTTAAATATACTGTTTGG + Intergenic
941158177 2:162003669-162003691 TCAAATTTAAGTATTCTGGTTGG + Intronic
942031230 2:171962280-171962302 TTCTAGTTAGATATTCTGGTAGG - Intronic
942845790 2:180423622-180423644 TCCTATATTTATATCCTGCTAGG - Intergenic
947208433 2:227683658-227683680 TCGTATTTTAATTTACTGGTGGG + Intergenic
948004298 2:234594629-234594651 TCCTAATGGAATATCCTAGTGGG + Intergenic
949010104 2:241673376-241673398 TCCTGTTTACATTTCCTAGTGGG - Exonic
1169165878 20:3423680-3423702 TCCTTTTAAAATATTCTGTTGGG - Intergenic
1170229812 20:14033508-14033530 TTCTATTAAAACATCCTGTTGGG + Intronic
1170252836 20:14304401-14304423 TTCTTTTTAAAAATACTGGTTGG - Intronic
1170835871 20:19884108-19884130 TCCTATTTAAAAACTCTTGTTGG - Intergenic
1175938916 20:62528621-62528643 TCATATTCAAATATCATAGTTGG + Intergenic
1177709587 21:24755261-24755283 TCTTATTTAAATATGCTTGAAGG - Intergenic
1177925442 21:27208534-27208556 TCCCTTTCAAATATTCTGGTAGG + Intergenic
1184577568 22:45383846-45383868 TCTTATATCAATATCCGGGTTGG + Intronic
951363690 3:21754487-21754509 TTGTATTAAAATATCATGGTTGG + Intronic
955020587 3:55117087-55117109 TCCTATTTAAAGAAACTGTTGGG + Intergenic
955352535 3:58204435-58204457 TCCTTTTTAAAAATCCTGGCTGG - Intronic
956714497 3:72066606-72066628 TCCTGTTTAAAAATCCTTGAAGG - Intergenic
956987698 3:74722177-74722199 TACTATCTAAATAGCCTGGGAGG - Intergenic
959532510 3:107449823-107449845 TCTTATTTTAATATCCAGATAGG - Intergenic
960273925 3:115705205-115705227 TCCTATTTATATCTACTGCTTGG - Intronic
963734607 3:149005877-149005899 TCCAATGTCAATCTCCTGGTTGG - Intronic
964733699 3:159894144-159894166 TCTTATTTAATTATCCTTGTGGG + Intronic
965901998 3:173652962-173652984 TCTTGTTTAAATATGCTGCTAGG + Intronic
967328717 3:188268601-188268623 TCCTGTTTACACATCCTGTTAGG + Intronic
967401091 3:189061668-189061690 TGCTTTTTAAATATGCTTGTTGG - Intronic
970519324 4:16866076-16866098 TCCTCTGTAGATATCCTGTTAGG - Intronic
970531081 4:16984991-16985013 TTCTATTTAAAAATCCTGGTGGG - Intergenic
974145425 4:57941724-57941746 TCCTATTTAAAAATTATGGCTGG - Intergenic
974598829 4:64049556-64049578 ATTTATTTAAATATCCTTGTAGG + Intergenic
974734210 4:65908433-65908455 TCTTCATTAAATATCTTGGTAGG - Intergenic
976766105 4:88599363-88599385 TGCTATTTAATTCTCTTGGTGGG + Intronic
976995621 4:91430110-91430132 TCCTCTTAAAATATCTTGGTTGG + Intronic
977112281 4:92973285-92973307 TTCTATTTAAACATCAAGGTGGG - Intronic
978349561 4:107807564-107807586 CTCAATTTAGATATCCTGGTGGG - Intergenic
980753746 4:137128730-137128752 TCATATTTAAATTTCTTTGTGGG - Intergenic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
981271278 4:142848882-142848904 TCCTTTTGAAATATCTTTGTAGG + Intergenic
981851614 4:149237778-149237800 TACAATTTAAATATCATTGTGGG + Intergenic
983115691 4:163813360-163813382 AACTATTTTATTATCCTGGTTGG + Intronic
985076182 4:186217178-186217200 ACCTATTTAAATATGCTTCTAGG - Intronic
986582615 5:9281117-9281139 TAATATTTAATGATCCTGGTAGG + Intronic
986998164 5:13631108-13631130 TTTTATTTAAATATGCTTGTTGG - Intergenic
990621881 5:57568764-57568786 ACACATTTAAATATCCTGGAAGG + Intergenic
991502758 5:67293556-67293578 TCCCCTATAAAAATCCTGGTGGG + Intergenic
994132887 5:96250727-96250749 TCCTCTTTAAATATCCCCTTTGG + Intergenic
994284846 5:97952238-97952260 GCTTTTTTAAATATCCTTGTTGG + Intergenic
994318915 5:98366734-98366756 TCATATATGAATATCCTAGTGGG + Intergenic
996067504 5:119095798-119095820 TCCTATATAAATATCCATGATGG - Intronic
996716961 5:126595756-126595778 TCCTCTATAAATATCCTGCCTGG + Intergenic
999567678 5:152883621-152883643 TGCTATTTAAAGATCCAGTTGGG + Intergenic
999982919 5:156975165-156975187 TCCCCTGGAAATATCCTGGTTGG + Intergenic
1003210927 6:4065935-4065957 TCTTATTTAAAGATAATGGTGGG + Intronic
1003310113 6:4963327-4963349 TCCTATTTAAAGATCTGGGCTGG + Intergenic
1004565860 6:16796899-16796921 TGCCATCTATATATCCTGGTTGG - Intergenic
1006964417 6:37968026-37968048 TCCCATTTAGATATTCTAGTTGG - Intronic
1009460474 6:63906866-63906888 TCATATTGAAATATCTTGGATGG + Intronic
1011671951 6:89692275-89692297 CCCTATTTAACTATCATGTTTGG - Intronic
1011781177 6:90790928-90790950 GCCTAGTTAAATATCCTTTTGGG - Intergenic
1012573215 6:100758057-100758079 TCCTATTTAAATCTCCTGGGTGG - Intronic
1013676309 6:112466927-112466949 GTCTATTTATATATCCTGTTAGG - Intergenic
1015115093 6:129639356-129639378 TCCTCTATAAATATGATGGTTGG - Intronic
1015180628 6:130358160-130358182 TGATTTTTAAATATCCTGCTAGG - Intronic
1017863975 6:158425989-158426011 GCCTTTTTAAATATGCTTGTTGG + Intronic
1017931227 6:158957375-158957397 TCCCATTTAAACATCCTGCTGGG + Intergenic
1023975509 7:45026901-45026923 ACTTAATTAAATATTCTGGTTGG - Intronic
1025965372 7:66265049-66265071 TCCTGTTCAAATCTCCTGATGGG - Intronic
1028285770 7:88996873-88996895 TCCAACCTAAATGTCCTGGTAGG - Intronic
1030995880 7:116357884-116357906 TCCCATTAAACTGTCCTGGTTGG + Intronic
1033422125 7:141212963-141212985 TCTTATTTCACTACCCTGGTAGG + Intronic
1034817877 7:154189215-154189237 TTCTACTAAACTATCCTGGTTGG - Intronic
1043028388 8:75100559-75100581 TCTTATTTTAACATGCTGGTTGG + Intergenic
1043277931 8:78424087-78424109 TCCTAATTAAATCTCCTTATTGG + Intergenic
1043374353 8:79631715-79631737 TCCCATTTAAAAATCCTTTTGGG - Intronic
1044688646 8:94854320-94854342 GCCTTTTTAAATATCCTTTTAGG - Intronic
1046107235 8:109680983-109681005 TCCAGCTTAAATATCCTGATGGG + Intronic
1053286579 9:36853329-36853351 TTCTATTAATATATCTTGGTAGG - Intronic
1058970139 9:110073885-110073907 AGCTGTGTAAATATCCTGGTGGG - Intronic
1060717564 9:125946876-125946898 TCCTATTTATTTATTCTGTTTGG - Intronic
1190806800 X:53845442-53845464 TCCTATTTAAATATCCTGGTGGG + Intergenic
1191139765 X:57104603-57104625 TCCTTTTTAAATATCATGCAAGG + Intergenic
1196072119 X:111537057-111537079 TCCTATTTTATTTTCCTTGTTGG - Intergenic
1201394326 Y:13532084-13532106 TCCTATTTAAAAATGGTGTTGGG - Intergenic