ID: 1190823300

View in Genome Browser
Species Human (GRCh38)
Location X:53994456-53994478
Sequence TTGAATAAGATGAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 328}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190823300_1190823304 0 Left 1190823300 X:53994456-53994478 CCTCCCACCTTCATCTTATTCAA 0: 1
1: 0
2: 1
3: 42
4: 328
Right 1190823304 X:53994479-53994501 AGCAGTTATGCTTTGAATATTGG 0: 1
1: 0
2: 0
3: 15
4: 164
1190823300_1190823305 1 Left 1190823300 X:53994456-53994478 CCTCCCACCTTCATCTTATTCAA 0: 1
1: 0
2: 1
3: 42
4: 328
Right 1190823305 X:53994480-53994502 GCAGTTATGCTTTGAATATTGGG 0: 1
1: 0
2: 1
3: 17
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190823300 Original CRISPR TTGAATAAGATGAAGGTGGG AGG (reversed) Intronic
900573020 1:3368804-3368826 TTGAAAAAGACAAAGATGGGAGG - Intronic
901723572 1:11220609-11220631 TTTAATAAGATGGAGGAAGGGGG + Intronic
902620417 1:17647525-17647547 ATGAATAAAAGGAAGGAGGGAGG - Intronic
902640173 1:17762046-17762068 TTGAGTAAGGTGAAGGTTAGGGG - Intronic
903814965 1:26058211-26058233 ATCAGTAAGAGGAAGGTGGGGGG + Intronic
905531601 1:38683796-38683818 AAGAATAAGAAGAAGCTGGGGGG - Intergenic
907251046 1:53139717-53139739 TTAGATAATATGGAGGTGGGTGG - Intronic
907613559 1:55899373-55899395 ATAAATAAGATGAAGCTGGATGG - Intergenic
907686284 1:56615057-56615079 GGGAATAAGAGGAAGGTTGGAGG - Intronic
907882812 1:58566804-58566826 TTGAGAGAGATGGAGGTGGGGGG + Intergenic
909468893 1:76004171-76004193 TTGATGTAGATGATGGTGGGTGG - Intergenic
910368165 1:86488313-86488335 TTGAATAAGATTAGGACGGGAGG - Intronic
911658385 1:100471548-100471570 TTGAATAAGATCAAAGCTGGAGG + Intronic
911985292 1:104615352-104615374 TTGAACAACGTGAAGGTGAGAGG + Intergenic
912339251 1:108895032-108895054 TTGAATGATATTAGGGTGGGTGG + Intronic
913483024 1:119307515-119307537 TTGAATAAGAACAAAGTTGGAGG - Intergenic
913714706 1:121521633-121521655 ATCAATAAGATGAATGGGGGAGG + Intergenic
914351900 1:146847230-146847252 TTGAAGAAGGAAAAGGTGGGAGG - Intergenic
914687067 1:149989746-149989768 AAGAAGAAGAAGAAGGTGGGGGG + Intronic
915248853 1:154574377-154574399 TGGATTAGGATGAGGGTGGGGGG - Intronic
916472944 1:165141631-165141653 TGGAATAGGAGGAAGGAGGGTGG - Intergenic
917670647 1:177270480-177270502 ATGAACAAGATGATGGTGGGGGG + Intronic
918096686 1:181341902-181341924 GTGAACAAGATAAAGGTGGGAGG + Intergenic
920975276 1:210780042-210780064 TTGAGAAAGCTGAAGGTGGGTGG + Intronic
923608088 1:235463525-235463547 TTGAAAAAGAACAAGGTTGGAGG + Intronic
924055172 1:240118003-240118025 CTGAATGAGATGAAGGAGTGAGG + Intronic
924226332 1:241924887-241924909 TTGAATAACATGGGGGTGAGGGG - Intergenic
924457426 1:244229892-244229914 TTGAAAGAGATGAGGCTGGGTGG + Intergenic
1063186929 10:3660194-3660216 TGATATAAGATGGAGGTGGGAGG + Intergenic
1063558720 10:7106175-7106197 TTGAATTTGATGAGGCTGGGTGG + Intergenic
1064960884 10:20963992-20964014 GTAAATAGGATGAAAGTGGGTGG - Intronic
1065951852 10:30659469-30659491 TTGAAGCAGAGGAAGGGGGGTGG + Intergenic
1067485584 10:46646795-46646817 TAGAATTAGAAGAAGATGGGAGG - Intergenic
1067516686 10:46953448-46953470 TTGAATAAGAGGAAAGGGAGTGG + Intronic
1067609175 10:47694857-47694879 TAGAATTAGAAGAAGATGGGAGG + Intergenic
1067645563 10:48098383-48098405 TTGAATAAGAGGAAAGGGAGTGG - Intergenic
1070285066 10:75076988-75077010 ATGAATTAAATGAAGGTTGGTGG + Intergenic
1071624763 10:87156503-87156525 TAGAATTAGAAGAAGATGGGAGG + Intronic
1071795896 10:89005434-89005456 TTGAATATGATGATGTGGGGAGG - Intronic
1072828591 10:98633746-98633768 TTGAATAACATGAGGGTTAGAGG - Intronic
1073102648 10:101014824-101014846 TTGAGTAAGATGAAGGGTGAGGG + Intronic
1073208009 10:101778837-101778859 TTTGATAAGATAAAGGAGGGAGG - Intronic
1074486154 10:113883102-113883124 TTGAAAAAGAAGAAAGTGGGAGG - Intronic
1074835262 10:117286027-117286049 TTGAAAAAGATGAATGTGATGGG - Intronic
1075316130 10:121455114-121455136 TTAAATGAGAAGAAGGTGTGGGG - Intergenic
1075516983 10:123117496-123117518 TTGAAGAAAATGAAATTGGGTGG - Intergenic
1076439605 10:130472048-130472070 TTGAATAAAATGAATGAGGGAGG + Intergenic
1077480965 11:2814395-2814417 CTGAATAAAAGGATGGTGGGTGG + Intronic
1080597582 11:33788163-33788185 GGAAATAAGATGAAGGGGGGTGG - Intergenic
1081326827 11:41754973-41754995 TTTAATAAAATGAATGAGGGAGG - Intergenic
1081706642 11:45185906-45185928 CTTAATAAGAGGGAGGTGGGAGG + Intronic
1084941491 11:72615601-72615623 ATGAAGCAGCTGAAGGTGGGAGG - Intronic
1086170003 11:83825645-83825667 GTGAACAAGATGGAGGTAGGAGG + Intronic
1086877038 11:92109814-92109836 TTGAATAAGAAGAAATTGGCAGG - Intergenic
1087013372 11:93533748-93533770 TTAAAAGGGATGAAGGTGGGAGG - Intronic
1087656597 11:100930655-100930677 ATGAATAAGATGAAGGTACCAGG + Intronic
1088236772 11:107733179-107733201 TGCAAAAAGATGAAGGTGGTGGG + Intergenic
1088296576 11:108303369-108303391 TTGAATAAGAAAAAGGAGTGGGG + Intronic
1089058360 11:115606243-115606265 TGGAATAAGTGGAAGGTGGAGGG - Intergenic
1090337288 11:125980000-125980022 TTTAATAAACTGAAGATGGGGGG + Intronic
1090470391 11:126975842-126975864 TGTAATATGAGGAAGGTGGGAGG - Intronic
1091690247 12:2591337-2591359 CTGTATAAGATGAAGGTGAAGGG - Intronic
1092166529 12:6346123-6346145 ATGAATAAGACTAAGGTGGCAGG + Intergenic
1092231273 12:6776939-6776961 CTGAATAAGATAAATGTGGCCGG + Intronic
1093240095 12:16659449-16659471 TTGAAGAAAATGAAAGTTGGAGG + Intergenic
1094050027 12:26209005-26209027 AAGAATAAAATGAAGGAGGGTGG - Intronic
1095391262 12:41709439-41709461 TCTACTAATATGAAGGTGGGGGG - Intergenic
1095598994 12:43993548-43993570 TTGGAGAAGATGGAGGGGGGTGG + Intronic
1095862694 12:46936173-46936195 TTAAATAAGAGGAATGTGGGGGG - Intergenic
1095932885 12:47646831-47646853 TTTAGAAAGATGAAGGTGGAGGG - Intergenic
1096427083 12:51513069-51513091 TTAGATAAAATGATGGTGGGTGG + Exonic
1098523861 12:71464294-71464316 TTGAATAAGAGGAAGAAAGGAGG + Intronic
1099170087 12:79353589-79353611 CTGAAGAAGATGGATGTGGGTGG + Exonic
1099356797 12:81646882-81646904 GGGAAGGAGATGAAGGTGGGGGG + Intronic
1102150736 12:110687967-110687989 TTGAGTAAGACCAAGGTGAGGGG - Exonic
1102279318 12:111606274-111606296 TTGAAGAGGATGAATTTGGGGGG - Intergenic
1103095667 12:118130586-118130608 TTGAATTGGATGAAGGTGGGAGG + Intronic
1103163207 12:118748155-118748177 TTGAAGAACATGGAGGTTGGAGG + Intergenic
1105046409 12:133007541-133007563 GTGAGAAAGAGGAAGGTGGGAGG + Intronic
1105428784 13:20318295-20318317 TGGAATAGTATGACGGTGGGTGG - Intergenic
1106752758 13:32791879-32791901 TTGAATAACAGGAAGTGGGGAGG - Intergenic
1107574073 13:41697883-41697905 TTGAATAAGAGGGAAGTAGGAGG - Intronic
1107767491 13:43752804-43752826 TTAAAAAAGAAGAAGGTTGGAGG - Intronic
1109549023 13:63868059-63868081 TTGAAAAAGATGAATCTGAGAGG - Intergenic
1111052053 13:82897465-82897487 ATGAATAAGATCAAGTTGGTTGG + Intergenic
1111952403 13:94719764-94719786 TTGAATAAGATGAAAATGATGGG - Intergenic
1112354254 13:98661014-98661036 TGCAGTAAGATGAAGGTGAGAGG - Intergenic
1112581741 13:100682132-100682154 TTGATTAAGATGAAGGTCGTTGG + Intergenic
1112750621 13:102579683-102579705 TAGAATAAAATGAAAATGGGGGG + Intergenic
1115475554 14:33809901-33809923 TTGAGAAAGATGGAGGTGGGGGG + Intergenic
1116067531 14:40003044-40003066 TTGAATACGTGGAAGGTTGGGGG + Intergenic
1116147347 14:41091525-41091547 ATGAATAATAATAAGGTGGGAGG - Intergenic
1116383024 14:44296157-44296179 TGGGAGAAGGTGAAGGTGGGTGG + Intergenic
1116525543 14:45899864-45899886 ATGGACAAAATGAAGGTGGGAGG + Intergenic
1116829145 14:49700674-49700696 TTGAAAAGAATGAAGGTGGAAGG + Intronic
1117961296 14:61165163-61165185 TTGAAAAAGATAAAAGTTGGAGG - Intergenic
1118452396 14:65915855-65915877 TTGCTTAGGATGGAGGTGGGGGG + Intergenic
1118677150 14:68199636-68199658 CGGAATGAGATGAAGGAGGGAGG - Intronic
1118723591 14:68610715-68610737 TTGAATAAGGTGCTGATGGGTGG - Intronic
1120944282 14:89979397-89979419 GTGAATCAGTTGAAGCTGGGAGG - Intronic
1121179499 14:91918079-91918101 TAGAATAAGGTAAAGGTGGGAGG + Intronic
1122437980 14:101712211-101712233 TGGGATGAGATGACGGTGGGTGG - Intergenic
1122437991 14:101712251-101712273 TGGGATGAGATGACGGTGGGTGG - Intergenic
1122438002 14:101712291-101712313 TGGGATGAGATGACGGTGGGTGG - Intergenic
1122438079 14:101712571-101712593 TGGGATGAGATGACGGTGGGTGG - Intergenic
1122438305 14:101713395-101713417 TGGGATGAGATGACGGTGGGTGG - Intergenic
1122958071 14:105081541-105081563 TTTAAAAAGAGGAAGTTGGGAGG - Intergenic
1124151475 15:27182615-27182637 TTGAATGAGATGACGGGAGGGGG + Intronic
1124956531 15:34363990-34364012 GTGAATAAAATGATAGTGGGTGG - Intronic
1125402529 15:39319633-39319655 TTGAATCATAGGAAGGTGAGAGG - Intergenic
1126452243 15:48821003-48821025 TTTAAAAAGAACAAGGTGGGAGG - Intergenic
1126986842 15:54321348-54321370 TTGAAAAAGATCTTGGTGGGTGG - Intronic
1127070907 15:55287803-55287825 TTGAAAAAGAACAAGGTTGGAGG + Intronic
1130958245 15:88642223-88642245 TTGAAAAAGAGGAAGTTGGCTGG - Intronic
1133291769 16:4727142-4727164 TTGAATAAGAAGAATGGTGGTGG - Exonic
1133564483 16:6980583-6980605 TTTAATAAAATGGAGGTGGCAGG + Intronic
1136417848 16:30114333-30114355 TTGAATGAGATGAGGGGGGCAGG + Exonic
1137923728 16:52519274-52519296 AAGAATAAGATGAAAGTGGTTGG - Intronic
1137933981 16:52616266-52616288 TTGAATGAGATGGAGTTGGAAGG + Intergenic
1139982133 16:70868306-70868328 TTGAAGAAGGAAAAGGTGGGAGG + Intronic
1140609612 16:76582216-76582238 TTGAAGAAGAGCAAGGTAGGAGG - Intronic
1141313376 16:82936572-82936594 TTAAAAATGCTGAAGGTGGGGGG - Intronic
1141870280 16:86780602-86780624 TTGAGTGAGATGAATGTTGGGGG - Intergenic
1142099974 16:88265876-88265898 TTGGTTTAGATGAAGGTGGTTGG + Intergenic
1143024667 17:3934611-3934633 TTGAATCACATGAACCTGGGAGG - Intronic
1143308096 17:5964684-5964706 TTGAATAAGAATAAGGTTAGGGG - Intronic
1144288500 17:13803106-13803128 TTTAATAAAATGAAGGTGAAAGG - Intergenic
1145792578 17:27637216-27637238 CTGAGAGAGATGAAGGTGGGGGG + Intronic
1146110352 17:30083985-30084007 TTGCATATGATGAGAGTGGGTGG + Intronic
1146564493 17:33900731-33900753 TTGAAGAAGTTGGAGGTGGGAGG + Intronic
1149755544 17:59182691-59182713 TTGACTAAGGTGAAGGAAGGGGG - Intronic
1150014280 17:61538122-61538144 ATGAATAATAAGAAAGTGGGAGG + Intergenic
1151056236 17:71034700-71034722 TAGAATAACAGGAAGGTAGGTGG + Intergenic
1151160781 17:72163702-72163724 CAGGATAAGCTGAAGGTGGGTGG - Intergenic
1151891259 17:76951763-76951785 TTTAATAAGCTCCAGGTGGGCGG + Intergenic
1153245763 18:3071716-3071738 TGGAGTACGATGAAGGTGGTGGG + Intronic
1153861675 18:9216532-9216554 TTGAACAAGGTGAAGGTTAGGGG - Intronic
1155113245 18:22737277-22737299 TTGAATAGGCTGTGGGTGGGTGG - Intergenic
1155775036 18:29751125-29751147 TTTCAGAAGATGAAGGTGGCTGG + Intergenic
1156086396 18:33410035-33410057 TTGCATCAAATGATGGTGGGTGG + Intronic
1157120742 18:44908629-44908651 TTGAAAAAGAACAAGGTTGGAGG - Intronic
1157593935 18:48852457-48852479 TAGAAAAAGTTGGAGGTGGGGGG - Intronic
1157671113 18:49529518-49529540 TTGAAGAAGCTGGTGGTGGGGGG - Intergenic
1157941568 18:51934438-51934460 ATGGATAAGAGGGAGGTGGGAGG + Intergenic
1159333818 18:67037113-67037135 TTGAAGAAGAATAAGTTGGGAGG - Intergenic
1161558714 19:4958655-4958677 TTTAAAAAGATCAAGGTGGAAGG - Intronic
1162975998 19:14207177-14207199 TTGGATTAGATAAAGATGGGAGG + Intergenic
1163219468 19:15904613-15904635 TTGAATAGGATGAAAGAGAGGGG + Intergenic
1164436576 19:28235794-28235816 TTGAAGAAGAAGTAAGTGGGTGG + Intergenic
1165400719 19:35598046-35598068 GTGAATGACATAAAGGTGGGGGG + Intergenic
1167276521 19:48543445-48543467 ATGAGCAAGATGAGGGTGGGAGG + Intergenic
925277192 2:2658718-2658740 TGGAATAAAATGAAGGTGATTGG - Intergenic
925319595 2:2951988-2952010 TGGAATCAGAGGAGGGTGGGGGG - Intergenic
925852566 2:8097089-8097111 TAGCTTAAAATGAAGGTGGGGGG + Intergenic
926695713 2:15769099-15769121 TAGAATGAAATGAAGGTGTGCGG - Intergenic
927157776 2:20231470-20231492 TTGAATAATATGGAGGAGGTGGG + Intergenic
928180724 2:29066586-29066608 CTGAACAAGATCGAGGTGGGTGG + Intronic
928985861 2:37181049-37181071 GTAAATAACATGAAAGTGGGAGG + Intronic
929018136 2:37522340-37522362 TTGAATCAGATGAATGTGGATGG + Intergenic
929418941 2:41771329-41771351 TTGAATCAGCTGAAGGTGACTGG - Intergenic
930558165 2:52926548-52926570 TTGAATAAAGTTATGGTGGGTGG - Intergenic
932069440 2:68603188-68603210 TTGAAAAAGATCAAGGCTGGAGG + Intronic
932911207 2:75807897-75807919 TTGAAGAAGAGAAAGGAGGGTGG + Intergenic
936272923 2:111065057-111065079 TTGAAAAAGAATAAAGTGGGAGG + Intronic
936943443 2:117909408-117909430 ATGACTAAGATGGAGTTGGGAGG + Intergenic
937672889 2:124557746-124557768 TTAAATAACATGATGGTGGCAGG + Intronic
939983088 2:148804137-148804159 TTGAAAAAGATGAAAGTTGGAGG - Intergenic
940460972 2:153962417-153962439 TTGAAAAAGATGGAGATAGGTGG + Intronic
940502898 2:154516626-154516648 CTAAATATGAAGAAGGTGGGTGG - Intergenic
940506950 2:154567656-154567678 TAAAAGAAGATGGAGGTGGGTGG + Intergenic
940934958 2:159482375-159482397 TTCAAGAAGATGTAGTTGGGAGG + Intronic
944092597 2:195929691-195929713 TTGTATATGATGAAAGTTGGGGG - Intronic
944124530 2:196278267-196278289 TTGACTCAGAGGAAGGTGAGAGG - Intronic
944812099 2:203337686-203337708 TTGAATAAGAACAAAGTTGGAGG + Intronic
946281210 2:218666833-218666855 CAGAATAGAATGAAGGTGGGTGG - Intronic
947387187 2:229602926-229602948 TTGAATAAGAACAATGTGGGAGG + Intronic
948071093 2:235126774-235126796 TTGCAGAAGACGATGGTGGGTGG + Intergenic
1169043122 20:2512369-2512391 TTGAAAAAGAATAAGGTTGGAGG + Intronic
1169833009 20:9845874-9845896 TTCAAGAAGAATAAGGTGGGAGG + Intergenic
1171982053 20:31635169-31635191 TAAAATAAAATGAAGGTGGGAGG - Intergenic
1173185053 20:40834204-40834226 TTGAGTAAGAGGGAGGTGGACGG + Intergenic
1173342772 20:42167847-42167869 TTGAATAACATGGAGGTTAGGGG + Intronic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1174426519 20:50435491-50435513 GTGCATGAGATGAGGGTGGGGGG + Intergenic
1174830792 20:53810547-53810569 GTGAAGGAGATGAGGGTGGGAGG + Intergenic
1179126657 21:38596895-38596917 GTGACTGAGTTGAAGGTGGGTGG - Intronic
1179806560 21:43841876-43841898 TTGAAAAAGAAGAAAGTTGGGGG - Intergenic
1182031956 22:27166157-27166179 TATAATAAAATGAAGATGGGGGG + Intergenic
1182505777 22:30781365-30781387 TGGAAAGAGAGGAAGGTGGGGGG - Intronic
1183846305 22:40543887-40543909 TTGAACAAGAACAAGGTGGGAGG + Intronic
1184019716 22:41812822-41812844 TTGGATAACATGTCGGTGGGGGG + Intronic
1184579821 22:45408424-45408446 TTAGTTAAGATGAAGGAGGGAGG - Intronic
949654332 3:6199704-6199726 TGGGAAAAGATAAAGGTGGGTGG + Intergenic
949669722 3:6385430-6385452 TTGAATATTATGAATGTGTGTGG + Intergenic
950079292 3:10209668-10209690 TTGAATCAGACGAAGTGGGGAGG - Exonic
951459805 3:22938889-22938911 TTGAAAAAGAGGAAGTTAGGGGG + Intergenic
951768887 3:26232406-26232428 TAGAGGAAGATGAGGGTGGGAGG - Intergenic
953700450 3:45191513-45191535 TGGAATAAGATATAGGTGGAAGG - Intergenic
954889470 3:53911251-53911273 TTGAAAAAGAACAAGGTTGGGGG + Intergenic
955018035 3:55090722-55090744 TTGAAGGAGATGGAGGTGGGGGG - Intergenic
955570241 3:60297082-60297104 TTGAAAAAGAATAAGGTGGTAGG - Intronic
955874997 3:63479598-63479620 TTGATTAAGATTGAGGTGGCAGG + Intronic
956616713 3:71179460-71179482 TGGAAGAAGATGAAGAGGGGAGG + Intronic
958605933 3:96358474-96358496 TTGAATAGGAATGAGGTGGGAGG + Intergenic
958912073 3:100005322-100005344 TTGAAAAAGGTGAAGCTGGGAGG + Intronic
958970516 3:100605710-100605732 ATCAATAGGATGAGGGTGGGGGG - Intergenic
959545266 3:107588457-107588479 TGGAATGAGATGCAGGTGGAAGG + Intronic
959699124 3:109281783-109281805 GTGGATAAGATACAGGTGGGAGG + Intergenic
959967094 3:112368542-112368564 TTGAACTGGATGCAGGTGGGAGG + Intergenic
960141043 3:114152213-114152235 TTGCATCAGATGAAGGGGAGTGG - Intronic
961993157 3:131213829-131213851 TTCAATATGATGAATCTGGGGGG - Intronic
962141411 3:132794433-132794455 TTGAAAAAGAAGAAAGTTGGAGG + Intergenic
963148534 3:142019650-142019672 TTGTATAAGAAGATGTTGGGGGG - Intronic
963301172 3:143598683-143598705 TTTAATAACATGTAGGTAGGAGG - Intronic
964821424 3:160774567-160774589 TTGAATAAGATAAAGGAGCCAGG - Intronic
964893325 3:161562847-161562869 GTTAATAAAATGAAGGTGGATGG - Intergenic
965795818 3:172437703-172437725 TGGAAGAAGATGTAGGTAGGAGG - Intergenic
966011729 3:175087221-175087243 TTGACTTTGAGGAAGGTGGGGGG + Intronic
967956963 3:194884773-194884795 GTGAATAGGATGCAGCTGGGTGG + Intergenic
968008292 3:195257476-195257498 GTTAATCAGATGAAGATGGGAGG + Intronic
968383624 4:116692-116714 TTGCATAAGATGAAGATTTGAGG + Intergenic
969673824 4:8604014-8604036 CTGAAGCGGATGAAGGTGGGCGG - Exonic
971296532 4:25398505-25398527 TTGAATGAGAGTAAGGTAGGAGG + Intronic
971505777 4:27365225-27365247 ATGAAGACAATGAAGGTGGGGGG - Intergenic
972418283 4:38863813-38863835 TGGAATTGGGTGAAGGTGGGAGG - Intergenic
974294292 4:59975803-59975825 GTGAAGAAGATGAATGTGAGTGG - Intergenic
975786856 4:77899355-77899377 TTGAATCAAATGAAGGTGCGGGG - Intronic
975996039 4:80316764-80316786 TTAAAAAAGAAGAAAGTGGGAGG + Intronic
976230186 4:82834569-82834591 CTGAATAAGTTAAAGGAGGGTGG + Intronic
976480238 4:85534550-85534572 TTGGAGAAGATGAAGTGGGGTGG + Intronic
976842744 4:89451001-89451023 TTGCATAAGATGAAGAAGGAAGG + Intergenic
979095059 4:116537583-116537605 TTGAATAAGTGGAAGATGTGGGG - Intergenic
980119638 4:128714413-128714435 TAGAATTAGATGAAGTTGGTCGG - Intergenic
980201465 4:129660522-129660544 TTGAAGAAGAAGAAAGTTGGAGG - Intergenic
980511215 4:133790136-133790158 ATGAAGATGGTGAAGGTGGGTGG + Intergenic
980512342 4:133811178-133811200 TTGAATAAGAGCAAAGTTGGAGG - Intergenic
981016857 4:139982826-139982848 TTAAATAAGTAGATGGTGGGAGG - Intronic
982694678 4:158585857-158585879 TCAAATAAGATTAATGTGGGTGG - Intronic
983026871 4:162748691-162748713 TTGAATAAAATGAAGGTGTTAGG - Intergenic
983270787 4:165559208-165559230 TTAAATAACAAGAAGGTAGGTGG - Intergenic
983952088 4:173654291-173654313 TTGTAAATGATGAAGGTGGCTGG + Intergenic
986228586 5:5840721-5840743 TTGCAAAGGATGCAGGTGGGCGG + Intergenic
986381676 5:7192807-7192829 TTGAATAAGTTAAAGGTTGGAGG + Intergenic
986706931 5:10460305-10460327 TTGAGCAAGTTGGAGGTGGGAGG + Intronic
989963030 5:50438842-50438864 ATCAATAAGATGAATGGGGGAGG - Intronic
989963676 5:50444484-50444506 ATCAATAAGATGAATGGGGGAGG - Intergenic
990138001 5:52670528-52670550 TTGATTAAGAAGAAAGTCGGAGG + Intergenic
990521179 5:56582840-56582862 TTGAACAAGTTGAAGTTGGTAGG - Intronic
990784259 5:59401531-59401553 GTGAATAAGATGGGGGAGGGTGG + Intronic
993158363 5:84256752-84256774 TTGAATCAGATGGAGGAGGTTGG + Intronic
993838414 5:92844698-92844720 TTTAATAAGTTGAAGGTGCTGGG + Intergenic
993909697 5:93666242-93666264 CTGAATAAGATGTAGGTGAAAGG - Intronic
994570617 5:101508554-101508576 TTGAGTAGGCTGAAGGTGGGGGG - Intergenic
995698211 5:114903455-114903477 TTGCATATGATGAAAGTAGGGGG + Intergenic
996066061 5:119080530-119080552 TTGTATAAGAAAAATGTGGGAGG - Intronic
996858487 5:128038128-128038150 TTGAATGAAATGCAGATGGGTGG + Intergenic
997291708 5:132741162-132741184 TTGAAAAAGAAGAAAGTTGGAGG - Intergenic
998241545 5:140450458-140450480 TAGTATAAGATACAGGTGGGAGG - Intronic
998756196 5:145381998-145382020 TTGAATAACTTTAAAGTGGGGGG + Intergenic
998927288 5:147140676-147140698 TTGAACAGGCTGAAGGTGGCTGG + Intergenic
999644878 5:153707802-153707824 TTAAATAAGAAGACAGTGGGGGG + Intronic
1000019249 5:157304409-157304431 TTTAATAAGAAGAAGGTGAGAGG - Intronic
1000155448 5:158546953-158546975 TGGATTCAGATGAAGCTGGGAGG + Intergenic
1000933045 5:167275299-167275321 TTAAAAAAGAAGAAAGTGGGAGG - Intergenic
1001170735 5:169416762-169416784 ATGAATGGGTTGAAGGTGGGCGG + Intergenic
1001201391 5:169720818-169720840 GAGAATCAGTTGAAGGTGGGAGG - Intronic
1001405033 5:171470229-171470251 TTGAGGATGATGAGGGTGGGAGG - Intergenic
1003214255 6:4094763-4094785 TTGAATAACATGGAGGTTAGGGG - Intronic
1004961602 6:20796537-20796559 TTGAATAAGAATAAGGTTGGAGG + Intronic
1005261842 6:24069595-24069617 ATGAATAAGATAAAGTTGGCAGG + Intergenic
1006479883 6:34283545-34283567 TTGATTAATTTGAAGGTGAGAGG + Exonic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007268596 6:40618068-40618090 ATCAATAAGATCAAGGTGGCTGG + Intergenic
1007639247 6:43324142-43324164 TTGAAAAAGAACAAGGTTGGTGG + Intronic
1007822624 6:44571846-44571868 GGGAATAAGACAAAGGTGGGTGG + Intergenic
1010242113 6:73625813-73625835 TTGAATAGGTTGTGGGTGGGTGG + Intronic
1010770726 6:79826466-79826488 TTGAAGAAAATCAAAGTGGGAGG + Intergenic
1012052771 6:94363939-94363961 TTAAAGAAGATGAAAGTGGTTGG - Intergenic
1012270174 6:97199446-97199468 TTGATTTAAATGGAGGTGGGGGG - Intronic
1012634639 6:101522612-101522634 TTCAAGAAGAAGAAGGTTGGTGG + Intronic
1012825849 6:104145672-104145694 TTGCATAAGATTAGGGTTGGGGG + Intergenic
1012849498 6:104429841-104429863 TGAAATAAGATGAAGGCAGGAGG + Intergenic
1014307897 6:119765394-119765416 TTGGATAAGGGGAAGGAGGGTGG + Intergenic
1014412268 6:121140276-121140298 TTAAATGAGATCAGGGTGGGGGG - Intronic
1015436472 6:133195378-133195400 CTGAAAAAGTGGAAGGTGGGAGG + Intergenic
1016316155 6:142789694-142789716 TTGAATAAGAGGAAGTAGTGTGG - Intronic
1016606915 6:145940098-145940120 TTGAATAAGATTAAGGTAGAAGG + Intronic
1017586717 6:155934823-155934845 TTGAACAACATGAAGGTTAGGGG - Intergenic
1019754065 7:2755204-2755226 TTGAAAAAGAATAAAGTGGGAGG - Intronic
1020045548 7:5037665-5037687 TTGACTAAGACGAAGGAAGGGGG - Intronic
1020290946 7:6721859-6721881 TTGACTAAGATGAAGGAAGGGGG - Intergenic
1020692210 7:11369485-11369507 TGGAAGAAGATGAAAGGGGGAGG + Intergenic
1021054129 7:16026140-16026162 TTGAAAAAGTTGAAGGTGTAAGG - Intergenic
1022016619 7:26355260-26355282 TTGAAAAAGAATAAAGTGGGAGG - Intronic
1022788165 7:33659905-33659927 CTGTATAAGATGAAGGTGCAAGG - Intergenic
1023824528 7:44000145-44000167 TTGACTAAGACGAAGGAAGGGGG + Intergenic
1024393834 7:48844118-48844140 TTCAATAAGATTTTGGTGGGAGG - Intergenic
1024401413 7:48928297-48928319 TTCAATAAGATTTTGGTGGGAGG + Intergenic
1026021630 7:66712030-66712052 TTGAATAAGAATAAAGTTGGAGG - Intronic
1026088078 7:67278909-67278931 TTGACTAAGACGAAGGAAGGGGG + Intergenic
1026726164 7:72871364-72871386 TTGACTAAGACGAAGGAAGGGGG - Intergenic
1026748018 7:73027779-73027801 TTGACTAAGATGAAGGAAGGGGG - Intergenic
1026751666 7:73055924-73055946 TTGACTAAGATGAAGGAAGGGGG - Intergenic
1026755315 7:73084051-73084073 TTGACTAAGATGAAGGAAGGGGG - Intergenic
1026758965 7:73112065-73112087 TTGACTAAGATGAAGGAAGGGGG - Intergenic
1027034222 7:74913093-74913115 TTGACTAAGATGAAGGAAGGGGG - Intergenic
1027088441 7:75281408-75281430 TTGACTAAGATGAAGGAAGGGGG + Intergenic
1027092084 7:75309336-75309358 TTGACTAAGATGAAGGAAGGGGG + Intergenic
1027095727 7:75337303-75337325 TTGACTAAGATGAAGGAAGGGGG + Intergenic
1027117679 7:75494243-75494265 TTGACTAAGACGAAGGAAGGGGG + Intergenic
1027274124 7:76541242-76541264 TTGACTAAGACGAAGGAAGGGGG - Intergenic
1027323613 7:77030383-77030405 TTGACTAAGATGAAGGAAGGGGG - Intergenic
1027327567 7:77060295-77060317 TTGACTAAGACGAAGGAAGGGGG - Intergenic
1029395829 7:100308027-100308049 TTGACTAAGACGAAGGAAGGGGG + Intronic
1029719819 7:102355806-102355828 TTGACTAAGACGAAGGAAGGGGG - Intergenic
1029752794 7:102553451-102553473 TTGACTAAGACGAAGGAAGGGGG + Intronic
1029770745 7:102652544-102652566 TTGACTAAGACGAAGGAAGGGGG + Intronic
1031459336 7:122026655-122026677 TCGAATAAGAGAAAGGTGAGTGG - Intronic
1031866437 7:127042392-127042414 TTGATTAAGATGAAGTGGGGAGG + Intronic
1032124052 7:129178922-129178944 TTGACAAAGATTAAAGTGGGAGG - Intergenic
1034848203 7:154467333-154467355 TTGAATGAGAGGCTGGTGGGAGG + Intronic
1035023572 7:155812636-155812658 TTTCCTAAGATAAAGGTGGGCGG + Intergenic
1035944728 8:3949590-3949612 TTGAAGAACATGAGGGTGGGTGG + Intronic
1036475234 8:9087202-9087224 AAAAATAAGATGAAGGTGGGGGG - Intronic
1037240225 8:16768959-16768981 TTGAAAAAGAAGAAAGTTGGAGG - Intergenic
1038150594 8:24939935-24939957 TTTAATCTGCTGAAGGTGGGGGG - Intergenic
1038567209 8:28629622-28629644 TGTTATGAGATGAAGGTGGGCGG + Intronic
1040525915 8:48225220-48225242 TTGCATAAGATTAGGGTGGGTGG + Intergenic
1042171838 8:65999198-65999220 TAGAATAAGGAGAAAGTGGGAGG - Intergenic
1042823071 8:72952815-72952837 ACAAAAAAGATGAAGGTGGGAGG + Intergenic
1043012770 8:74901098-74901120 TTAAGTAATATAAAGGTGGGTGG - Intergenic
1043118800 8:76294962-76294984 TTGAATGACAGGTAGGTGGGAGG - Intergenic
1044753999 8:95443111-95443133 TTAAATAAGGTGAAGATGGGAGG - Intergenic
1046730736 8:117723273-117723295 GTGAATAGGATGAAGGAGGGAGG - Intergenic
1046807384 8:118494608-118494630 GTGAATAAGAGGAAGGTGTTTGG - Intronic
1048601639 8:135924496-135924518 AAGTATCAGATGAAGGTGGGAGG - Intergenic
1050193511 9:3055487-3055509 TAGAATAAGATAAAGAAGGGAGG + Intergenic
1050826334 9:9951105-9951127 TAGAATAAGATGTAGGAGGAGGG + Intronic
1050920156 9:11190129-11190151 TTGCATAGGATGAAGGGTGGCGG + Intergenic
1051866323 9:21687292-21687314 TTGAACAAAATCAAGTTGGGAGG + Intergenic
1054965489 9:71022094-71022116 TTGAAAAAGATTTAAGTGGGAGG + Intronic
1054976690 9:71154778-71154800 TTGAATAAGATCAAATTGGTTGG - Intronic
1055067963 9:72137773-72137795 TTGTAACAGTTGAAGGTGGGGGG - Intronic
1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG + Intronic
1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG + Intergenic
1057606559 9:96502057-96502079 TTCAATAAGATTTGGGTGGGAGG - Exonic
1057792601 9:98134050-98134072 TTGGATAAAAGGGAGGTGGGGGG - Intronic
1058808263 9:108614220-108614242 TTGACCAAGATGAAGATGGCAGG + Intergenic
1058895621 9:109398191-109398213 TTGAATCACTTGAACGTGGGAGG + Intronic
1059639209 9:116200117-116200139 TTGAGGAAGATGAAGCTGGAGGG - Intronic
1061810605 9:133160707-133160729 TGGAATAAGATGATGGTGACCGG + Intronic
1186029253 X:5348921-5348943 TTGAAAAACATGAGGGTTGGGGG - Intergenic
1186797243 X:13058826-13058848 TTGAATGGGGTGAAGGTGGGAGG + Intergenic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1187473405 X:19589047-19589069 TGGAGTATGCTGAAGGTGGGCGG - Intronic
1187671463 X:21670074-21670096 TTGAAGAAGAAGAATGTTGGAGG - Intergenic
1187910600 X:24107772-24107794 TTGAAAAAGATCAAAGTTGGAGG - Intergenic
1188718726 X:33497434-33497456 TTGAATAAGATGAAGAGGTATGG + Intergenic
1190823300 X:53994456-53994478 TTGAATAAGATGAAGGTGGGAGG - Intronic
1192530733 X:71882074-71882096 ATGAAGAAGAACAAGGTGGGAGG + Intergenic
1193058595 X:77180851-77180873 ACGAATAAGATGGAGGGGGGAGG - Intergenic
1193503671 X:82311495-82311517 TTGAAGAAGATCAAAGTTGGAGG - Intergenic
1193750973 X:85343029-85343051 TTGAAAAAGCTGGGGGTGGGGGG + Intronic
1194571191 X:95556158-95556180 TTGAATAGAGTGGAGGTGGGTGG - Intergenic
1195020614 X:100823414-100823436 ATGAAACAAATGAAGGTGGGAGG + Exonic
1195584344 X:106547399-106547421 TTGAAAAAGAATAAAGTGGGAGG - Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1198009043 X:132531530-132531552 TTCCATAACATGAAGCTGGGAGG + Intergenic
1198432763 X:136584419-136584441 GGGTATAAGAAGAAGGTGGGGGG - Intergenic
1198810783 X:140534179-140534201 TGGAAGAAGAGGAAGGAGGGAGG + Intergenic
1200177059 X:154124468-154124490 TTAAATAAGTTGAAGTTGTGGGG + Intergenic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic