ID: 1190824232

View in Genome Browser
Species Human (GRCh38)
Location X:54002189-54002211
Sequence CCAACAGATGGTCTCAAAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190824227_1190824232 -1 Left 1190824227 X:54002167-54002189 CCAGGATGTGCTTTCCCACATAC 0: 1
1: 0
2: 1
3: 7
4: 162
Right 1190824232 X:54002189-54002211 CCAACAGATGGTCTCAAAGTTGG 0: 1
1: 0
2: 0
3: 10
4: 139
1190824226_1190824232 12 Left 1190824226 X:54002154-54002176 CCGCGAAAGATGTCCAGGATGTG 0: 1
1: 0
2: 1
3: 16
4: 335
Right 1190824232 X:54002189-54002211 CCAACAGATGGTCTCAAAGTTGG 0: 1
1: 0
2: 0
3: 10
4: 139
1190824224_1190824232 17 Left 1190824224 X:54002149-54002171 CCATACCGCGAAAGATGTCCAGG 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1190824232 X:54002189-54002211 CCAACAGATGGTCTCAAAGTTGG 0: 1
1: 0
2: 0
3: 10
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190824232 Original CRISPR CCAACAGATGGTCTCAAAGT TGG Exonic
900239279 1:1606935-1606957 CCAGCAGCTGGTCACTAAGTAGG - Intergenic
903189290 1:21647816-21647838 CCAACAAATGGTGACAAAGTTGG + Intronic
904269168 1:29338058-29338080 CCCAGAGATGGTCTCATGGTGGG + Intergenic
904496979 1:30892540-30892562 AGAAAAGATGGACTCAAAGTTGG + Intronic
905647631 1:39635419-39635441 CCAACAGATGGTCCCAGCGGAGG - Intronic
905684622 1:39900079-39900101 CCCACAGATTGCCACAAAGTAGG + Intronic
908407816 1:63831856-63831878 CAGACAGATGGTCTGAAATTGGG - Intronic
911565269 1:99456676-99456698 CCAACAGATGGAAGCAAAATGGG - Intergenic
917815376 1:178704650-178704672 CCAACAGAAGATCTGAAAGATGG + Intergenic
918077967 1:181184737-181184759 TCAACAGATGTGCTCTAAGTGGG + Intergenic
918389095 1:184039280-184039302 CCAACAGATGGCCTCAGCATTGG + Intergenic
919359891 1:196579275-196579297 ACAACAGATGGACACAAAGAAGG + Intronic
920820155 1:209372948-209372970 GCAACAGAAGGTCCCCAAGTGGG - Intergenic
921905572 1:220492227-220492249 CCAACAGATTGTGGCAAAGATGG + Intergenic
923380327 1:233411184-233411206 TCAACAGATGGGCCCAAACTTGG - Intergenic
1063422463 10:5924201-5924223 AGAGCAGATGGTCTTAAAGTGGG - Intronic
1065939616 10:30552548-30552570 CCAAAAGAGAGTCTCCAAGTGGG - Intergenic
1067021815 10:42806984-42807006 TCAACAGATTGTATCAATGTTGG - Intronic
1067140655 10:43653592-43653614 CCCACAGATGGGCTCCACGTGGG + Intergenic
1071733828 10:88275712-88275734 CATACATATGGTATCAAAGTAGG + Intronic
1075316692 10:121458984-121459006 CCATCAGACTGTATCAAAGTGGG - Intergenic
1076493737 10:130882899-130882921 ACAAAAGATTGTCTCCAAGTTGG - Intergenic
1076922509 10:133461960-133461982 CCAGCAGATGGTCTGACAGCCGG - Intergenic
1077368251 11:2169929-2169951 CCCACAGCTGGTCCCACAGTCGG + Intronic
1079123228 11:17699652-17699674 CCAGCAGCTGGTCACAAAGCTGG + Intergenic
1079493203 11:21012261-21012283 CTAACATATGCTCTCAAGGTTGG - Intronic
1080320397 11:31002475-31002497 CCAACAGTTGGACTCACAGCAGG - Intronic
1082267701 11:50137496-50137518 ACAGCATATGGTATCAAAGTGGG + Intergenic
1083622509 11:64056149-64056171 CCAAAAGATGGGAGCAAAGTGGG - Intronic
1089812496 11:121143425-121143447 CCCACACCTGGTCTCAAAGGAGG - Intronic
1091023917 11:132125130-132125152 CAAACGGATGGGCTCACAGTGGG + Intronic
1091237043 11:134029034-134029056 CCAAGAATTGGTCTCAAAGAGGG - Intergenic
1095036320 12:37379644-37379666 CCAAAAGACGGTTTCAAAGCTGG + Intergenic
1101670680 12:106869364-106869386 CCAACCGAAAGTCTCAAAGACGG + Intronic
1104230127 12:126876644-126876666 GCAACAGATGATCACTAAGTTGG + Intergenic
1106547394 13:30742603-30742625 CCTACAGATACACTCAAAGTGGG + Intronic
1107007906 13:35635400-35635422 GCAACAAATGATCACAAAGTGGG + Intronic
1107250274 13:38351228-38351250 CAAACAGCTGGTTTCAGAGTTGG - Intronic
1111657097 13:91167380-91167402 CAAAGAGATGGTCTCAAACCTGG + Intergenic
1114947289 14:27699585-27699607 CCATCAGATTGTCTCAACTTAGG + Intergenic
1115681198 14:35740287-35740309 CCAACACTTGTTCTCAATGTGGG + Intronic
1122121099 14:99553899-99553921 TCAAGAGATGGGCTCAAACTTGG + Intronic
1202839626 14_GL000009v2_random:109963-109985 CCAACAGAAGGTGACAAAGGTGG + Intergenic
1202908998 14_GL000194v1_random:100103-100125 CCAACAGAAGGTGACAAAGGTGG + Intergenic
1202884260 14_KI270722v1_random:89126-89148 CCAACAGAAGGTGACAAAGGTGG - Intergenic
1130250818 15:82299428-82299450 CAAACAGAGGTTCTCAAAATGGG - Intergenic
1130314874 15:82786611-82786633 CCAACAGAGGATCACAAAGAAGG + Intronic
1132232987 15:100198695-100198717 CCTACAGATGGTCACAACCTGGG + Intronic
1133489483 16:6253338-6253360 CCCACAGCTTGTGTCAAAGTAGG - Intronic
1137438826 16:48481781-48481803 CCAAGGGATGGTTACAAAGTGGG + Intergenic
1138770719 16:59660489-59660511 GCAACAGATTATCACAAAGTTGG + Intergenic
1142422148 16:89978199-89978221 CCTACAGAAGGACTCCAAGTGGG - Intergenic
1146831399 17:36072431-36072453 CCAACAGTGGTTCTCAAACTTGG - Intergenic
1150273736 17:63882690-63882712 CCAACAGAGAATCTCAAAGTTGG + Intergenic
1150275889 17:63897337-63897359 CCAACAGAGAATCTCAAAGTTGG + Intergenic
1150278030 17:63912039-63912061 CCATCAGAGAATCTCAAAGTTGG + Intronic
1152280081 17:79380027-79380049 CTAACAGAGGGACTCAAAGAGGG - Intronic
1158227177 18:55213461-55213483 CCAAAATATGGACTCAAAATTGG - Intergenic
1158907299 18:62026301-62026323 TCAACAGATAATCTGAAAGTTGG + Intergenic
1160394225 18:78559885-78559907 CCACCAGGTGGTCTCAGAGAAGG - Intergenic
1165223543 19:34337825-34337847 CCAACAAATGCTCTCCTAGTGGG + Intronic
1165718542 19:38062915-38062937 ACAACAGATGTTCTCAAATGGGG + Intronic
1166487970 19:43230142-43230164 CCAAGAGAAGGTCTCCAATTTGG + Intronic
1166494789 19:43292007-43292029 CCAAGAGAGGGTCTCCAATTTGG + Intergenic
1202633417 1_KI270706v1_random:20599-20621 CCAACAGAAGGTGACAAAGGGGG - Intergenic
1202652459 1_KI270707v1_random:19468-19490 CCAACAGAAGGTGACAAAGGTGG + Intergenic
1202659676 1_KI270708v1_random:56256-56278 CCAACAGAAGGTGACAAAGGTGG - Intergenic
926964563 2:18396004-18396026 CCCAGAGAAGGTCTCATAGTTGG + Intergenic
929592148 2:43154302-43154324 CTAACAGATGGACTGAAAGATGG + Intergenic
929592169 2:43154472-43154494 CTAACAGATGGACTGAAAGATGG + Intergenic
930611180 2:53545706-53545728 ACAGCAGATTGTCTGAAAGTAGG - Intronic
931151472 2:59578916-59578938 TCAACATATGTTCTCAAACTTGG + Intergenic
933841800 2:86292880-86292902 CCGACACATGCACTCAAAGTTGG - Intronic
939761907 2:146192947-146192969 CCACCAGATTGTTTCAAAGAAGG + Intergenic
940791430 2:158033586-158033608 CCAGCAGTTGGTCTCCATGTAGG + Intronic
944395977 2:199266630-199266652 CTAACACAAGGTCTCAAAGTGGG - Intergenic
946577008 2:221086676-221086698 CCACGAGATGGTGTCAAAGGAGG - Intergenic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1174207526 20:48851591-48851613 CCAAGGGATGGTCACAAAGGAGG - Intergenic
1175080770 20:56418520-56418542 GCAACAGATGGGCTGTAAGTAGG + Intronic
1175667545 20:60873132-60873154 CCAACAGAGGGCCTCAAAATAGG - Intergenic
1176599689 21:8780184-8780206 CCAACAGAAGGTGACAAAGGTGG - Intergenic
1176628358 21:9114815-9114837 CCAACAGAAGGTGACAAAGGTGG + Intergenic
1176645634 21:9346462-9346484 CCAACAGAAGGTGACAAAGCTGG - Intergenic
1178468276 21:32869053-32869075 CCAACAGGTGGTCACAATGAGGG + Intergenic
1179539768 21:42076511-42076533 ACAGCAGAGGTTCTCAAAGTGGG - Intronic
1179679727 21:43010661-43010683 CCAACATCTGGTCTCGATGTTGG + Intronic
1180327146 22:11439818-11439840 CCAACAGAAGGTGACAAAGGTGG - Intergenic
1180367294 22:11952691-11952713 CCAACAGAAGGTGACAAAGGTGG + Intergenic
1180378790 22:12118645-12118667 CCAACAGAAGGTGACAAAGGTGG - Intergenic
1180418744 22:12794674-12794696 CCAACAGAAGGTGACAAAGGTGG + Intergenic
1183507078 22:38215161-38215183 CCAACAGCTGTTCTCTAAGCCGG - Exonic
1184003689 22:41693680-41693702 ACAAAAGATGGGCTCAGAGTGGG - Exonic
1184093808 22:42305846-42305868 CCCTCAGATGCTCTCAAAGCTGG + Intronic
950435671 3:12978285-12978307 CCAACAGTTGTCCTCAAAGTGGG + Intronic
953770808 3:45777583-45777605 CCCACAGCTGGTCTCCAAGAGGG - Intronic
957094576 3:75767049-75767071 CCAACAGAAGGTGACAAAGGTGG + Intronic
960094652 3:113677622-113677644 CCAACGGATGGTCCCCAAGAGGG + Intronic
962948907 3:140199822-140199844 CCATCAGGTGGACTCAGAGTTGG + Intronic
963658423 3:148090274-148090296 CCAACAGATGGGGCCAAATTAGG + Intergenic
965462192 3:168979588-168979610 CCAACAGATGCTAACAAGGTTGG - Intergenic
1202741255 3_GL000221v1_random:58605-58627 CCAACAGAAGGTGACAAAGGTGG + Intergenic
973363045 4:49182603-49182625 CCAACAGAAGGTGACAAAGGTGG - Intergenic
973398050 4:49614253-49614275 CCAACAGAAGGTGACAAAGGTGG + Intergenic
975496536 4:75041726-75041748 CCAACAAGTGGTCACCAAGTAGG + Intronic
980857840 4:138461803-138461825 CCAAAAGATGTTCTCAAATTGGG + Intergenic
982030372 4:151294563-151294585 CCAACAGATGCACTCAGTGTTGG + Intronic
1202760408 4_GL000008v2_random:104115-104137 CCAACAGAAGGTGACAAAGGTGG - Intergenic
986304323 5:6504276-6504298 ATAACAGATGGTCACAAACTGGG + Intergenic
986968851 5:13308168-13308190 CACACACATGGTCTCAAAGTTGG - Intergenic
989525184 5:42445441-42445463 GCTACAGATGATCTCAGAGTGGG - Intronic
989767172 5:45101182-45101204 CCATCAGCTGGTCTCTAGGTTGG + Intergenic
991434452 5:66582931-66582953 CAAACAGATGGTTTCAAAAACGG - Intergenic
991949696 5:71935413-71935435 TCACCAGATAGACTCAAAGTTGG - Intergenic
996610156 5:125369161-125369183 CCAACAGAAAATCCCAAAGTCGG - Intergenic
998092085 5:139377327-139377349 CCAACAGATGGCCTCTGAGCTGG - Intronic
998418896 5:141965760-141965782 AGAACACATGGTCACAAAGTGGG + Intronic
1000123111 5:158216822-158216844 ACAACCAATGCTCTCAAAGTAGG - Intergenic
1000900351 5:166904747-166904769 CCAGCAGATGGTCGCCATGTGGG + Intergenic
1001233325 5:170008795-170008817 CCAACAGATGGTCTTTAAGAAGG - Intronic
1003725569 6:8759092-8759114 CAGACTGAAGGTCTCAAAGTAGG - Intergenic
1005927387 6:30454746-30454768 ACAACAAATGCCCTCAAAGTTGG + Intergenic
1007088431 6:39166952-39166974 CCTCCAGGTGTTCTCAAAGTGGG + Intergenic
1012421976 6:99075659-99075681 CCAACATGTGGTCTGGAAGTTGG - Intergenic
1014853846 6:126375138-126375160 CCATCAGATCATCTCAAAGCTGG - Intergenic
1016648944 6:146441826-146441848 GCAACAGATGGTGTGAAAGAAGG + Intergenic
1019902592 7:4034140-4034162 ACATCAGATGGACTCAAACTAGG + Intronic
1021692393 7:23243242-23243264 CCAACACATGGTCAGAAACTTGG - Intronic
1022120805 7:27306268-27306290 CCAGCAGAAGGTCACAAGGTTGG + Intergenic
1022183415 7:27943543-27943565 TCCACAGATGATCTCAAATTAGG + Intronic
1024044084 7:45575525-45575547 CCCACAGAGGGACTGAAAGTGGG + Intronic
1034170360 7:149058207-149058229 CCATCACAAGGTCTCACAGTAGG - Intergenic
1037229612 8:16640736-16640758 ACAAAAGATGATCTCCAAGTAGG - Intergenic
1041804456 8:61834866-61834888 CCAACAGATGGTATCAGAAGTGG + Intergenic
1044492213 8:92832891-92832913 CCAAAAAATGGTCCCAAAGTAGG - Intergenic
1048444674 8:134484455-134484477 CCCCCAGATGATCTGAAAGTAGG + Intronic
1051609502 9:18947596-18947618 CTAACAGAATGTCTCAAATTGGG + Intronic
1052185318 9:25586929-25586951 ACTACAGATGGACTCAAAGAAGG + Intergenic
1053347826 9:37390961-37390983 TCAACAGCTGGACTCAGAGTTGG - Intergenic
1053364507 9:37512984-37513006 GCAACAGAGTGTCTCAAAGCGGG - Intronic
1061265423 9:129502013-129502035 ACATAAGAAGGTCTCAAAGTGGG + Intergenic
1203751203 Un_GL000218v1:82498-82520 CCAACAGAAGGTGACAAAGGTGG + Intergenic
1203482783 Un_GL000224v1:21856-21878 CCAACAGAAGGTGACAAAGGTGG - Intergenic
1203709892 Un_KI270742v1:88531-88553 CCAACAGAAGGTGACAAAGCTGG + Intergenic
1203541183 Un_KI270743v1:89008-89030 CCAACAGAAGGTGACAAAGGTGG - Intergenic
1188999648 X:36930081-36930103 CTCACAGATAGTCTCAAAGGAGG + Intergenic
1189338853 X:40188735-40188757 CCAACACATGGTCTGACAATGGG + Intergenic
1190824232 X:54002189-54002211 CCAACAGATGGTCTCAAAGTTGG + Exonic
1191056416 X:56245890-56245912 CCCACAGAAGGTCTTAAAGAAGG - Intronic
1193777107 X:85656995-85657017 CAAAAAGATGGTCTGAAATTGGG + Intergenic