ID: 1190825892

View in Genome Browser
Species Human (GRCh38)
Location X:54017681-54017703
Sequence CTCACAGTGAATGATGGCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190825887_1190825892 -2 Left 1190825887 X:54017660-54017682 CCAACATAGTGTTCAACATCCCT 0: 1
1: 0
2: 1
3: 5
4: 104
Right 1190825892 X:54017681-54017703 CTCACAGTGAATGATGGCGAGGG 0: 1
1: 0
2: 0
3: 10
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190825892 Original CRISPR CTCACAGTGAATGATGGCGA GGG Exonic
901280137 1:8027042-8027064 CGGACAGTGAAGGATGGCAAGGG + Intergenic
902674151 1:17996830-17996852 CTCACAGTTAAGCATGGCTAGGG + Intergenic
903693646 1:25192082-25192104 CTCACAGTGAATGTTTGCAGGGG + Intergenic
906098244 1:43238717-43238739 CTCACATAGTATGATGGCCAAGG - Intronic
906824626 1:48965716-48965738 CCCACAGTGAAAGATGCAGAAGG - Intronic
910047788 1:82938781-82938803 CTCACAGCAAATTATGGAGATGG - Intergenic
911004650 1:93206840-93206862 CTCACAGTAAATGGTAGGGAAGG - Intronic
912217134 1:107627230-107627252 CTCACAGAGAGTGATGGAGATGG - Intronic
912438549 1:109680084-109680106 CTCACACTGAATGATACCGCTGG + Intronic
912441067 1:109698538-109698560 CTCACACTGAATGATACCGCTGG + Intronic
912493537 1:110076470-110076492 CTTACAGGGAATGCTGGCCAGGG + Intergenic
917074295 1:171187811-171187833 CTCAGAGTTAATGAGGGAGAAGG + Intronic
923608829 1:235470869-235470891 GTGACAGTGAATGATGGAGGGGG - Exonic
1063003545 10:1946657-1946679 CTCACAGTGAATACTGGCTTTGG + Intergenic
1064623679 10:17240769-17240791 CTCACAGTGACAGATGGAAAAGG + Intergenic
1065671895 10:28128186-28128208 CTAAGAGTGAAGGATGGCAAGGG + Intronic
1081686798 11:45048654-45048676 CCCACAGTGAACAATGGCGGGGG - Intergenic
1084271529 11:68031781-68031803 CTCTCAGTGCATGCTGGCGGGGG + Intronic
1087450914 11:98323403-98323425 CTCACAGTGAAAGGTGGTCAAGG - Intergenic
1091639953 12:2228888-2228910 CTAACAGTGAGTGATTGAGATGG + Intronic
1097067684 12:56333083-56333105 CTCAAAGTTCATGATGACGATGG + Exonic
1097752548 12:63372346-63372368 ATCACAATGAATGATAGGGAGGG + Intergenic
1100063771 12:90614637-90614659 CTCACATTGCATGAGGGCTATGG + Intergenic
1103142950 12:118566507-118566529 CTACCATTGAATGATGGAGAAGG + Intergenic
1106227636 13:27796973-27796995 CTGACACTGAGTGCTGGCGAAGG - Intergenic
1106570745 13:30924947-30924969 CTCCCAGTGAAAGATGGCACAGG - Exonic
1111749557 13:92311546-92311568 CTCACAGTGAAGCATGGCTGGGG + Intronic
1122248648 14:100422712-100422734 CTAACAGCAAATGATGGAGAGGG - Intronic
1122313062 14:100809461-100809483 ATCACAGGGAATGATGGTGCAGG - Intergenic
1122444421 14:101758975-101758997 AACACAGTGAATGATGAGGAAGG - Intergenic
1122520800 14:102342132-102342154 GTCACAGTGACTGATGCAGAGGG + Exonic
1126340528 15:47636151-47636173 CTCACACTGAATTGTGGTGATGG + Intronic
1128818943 15:70635020-70635042 CTAAAACTGGATGATGGCGATGG - Intergenic
1132691698 16:1184497-1184519 CTCACAGAGGATGAGGGTGAGGG - Intronic
1138099803 16:54243687-54243709 GCCACAGTGAATGCTGGGGAAGG - Intergenic
1143981071 17:10870356-10870378 CTCACAGTAAATGAAGGCATTGG + Intergenic
1144499757 17:15775684-15775706 CTCACTTTGAATCAAGGCGATGG - Intergenic
1144573632 17:16415885-16415907 CTGACAGTGAATGATGGGGTGGG + Intronic
1145886880 17:28388116-28388138 CTGACAGTGAGTGATGCGGAGGG + Intronic
1146300260 17:31683291-31683313 GGCACAGTGAATGATAGAGATGG + Intergenic
1149233908 17:54569086-54569108 CTAAAAGTGAATGATTGTGAAGG + Intergenic
1149412619 17:56424386-56424408 CACACTGTGAATGAATGCGAGGG - Intronic
1149436240 17:56635773-56635795 CTCACAGTTTCTGATGGTGATGG - Intergenic
1154103744 18:11501559-11501581 CACACAGTGGATGATGGAGCAGG - Intergenic
1158007524 18:52690153-52690175 CTCACAGTCTATGAAGGCCAGGG - Intronic
1159313733 18:66743367-66743389 CTCACAGTGAATGACGCCAAAGG + Intergenic
1161406554 19:4094436-4094458 CTCACAGTGAGTGATGCCAGCGG - Exonic
1166297835 19:41897408-41897430 CTCACAGGGAGTGAAGGGGAGGG - Intronic
1167693055 19:50999099-50999121 TTCACTGTGAAGGAAGGCGAGGG + Intronic
925107127 2:1301186-1301208 CTCTCAGTGGATGGTGGGGAAGG + Intronic
932024517 2:68119854-68119876 GTCACAGTGAATGTTGGCATTGG - Intergenic
932488561 2:72103867-72103889 CTCACAGTGTATGGGGGCCATGG - Intergenic
935012898 2:99152684-99152706 GTCTAAGTGAATGATGGTGATGG + Intronic
935805085 2:106737642-106737664 CTCACAGTTACTCATGGCGGGGG - Intergenic
938026641 2:127955078-127955100 CCCACAGTGACTGATGGAGGTGG + Exonic
941463952 2:165803072-165803094 CTTACAGTGAAGGAAGGAGATGG - Intergenic
944131278 2:196350038-196350060 CTCACAATGAATGAGGGGGTGGG + Intronic
946700444 2:222407292-222407314 TTCACAGTGAATGTTGGCCCAGG + Intergenic
1171043851 20:21791990-21792012 TTCACAGTGACTCATGGCAAGGG + Intergenic
1174395219 20:50243074-50243096 CTCACAATGAACGAAGGCCAAGG - Intergenic
1177540807 21:22491833-22491855 CTGAAAATGAATGATGGTGATGG + Intergenic
1183269226 22:36850274-36850296 CTCAGAGTGCATGCTGGGGAAGG + Intergenic
950114542 3:10442130-10442152 CTCACAGTAAATGAGAGCCAGGG + Intronic
952897438 3:38087150-38087172 CTCACAGTGAATCCTGGCCCTGG - Intronic
955814314 3:62825855-62825877 CTCAGAATGAATGATGGCTGAGG - Intronic
958836119 3:99147412-99147434 CTCACAGTGCAGCATGGCTAGGG - Intergenic
960686466 3:120299358-120299380 TTCTTAGTGAATGATGGTGATGG + Intergenic
962729821 3:138271041-138271063 CTCACAGTTAATAATGGAAATGG + Intronic
965957474 3:174388817-174388839 CTCACAGTCTAGGATGGCCAGGG + Intergenic
967278850 3:187803017-187803039 CTGACAGTGGGTGATGGTGATGG + Intergenic
968945551 4:3661732-3661754 CACACAGTGTCTGATGGAGAGGG + Intergenic
969716633 4:8871204-8871226 CTGACAGTGAGTGAGGGCGCGGG - Exonic
971461615 4:26904813-26904835 CTCACAGTGAATTGTTGCCACGG - Intronic
972966791 4:44520252-44520274 CTCACAGTTAAGCATGGCTAGGG + Intergenic
974019850 4:56683160-56683182 GTCACAGTGAATGGTGGGGGTGG + Intergenic
977957144 4:103042124-103042146 CCCACAGTGAATGCTGTCTATGG + Intronic
980022887 4:127730535-127730557 CTCACGATGCATGATGGAGAAGG - Exonic
990607158 5:57422714-57422736 TTCATCATGAATGATGGCGAGGG + Intergenic
997857211 5:137383100-137383122 CTCACAGTAAATGACAGTGATGG - Intronic
1000044471 5:157510498-157510520 CTAACACTGGATGATGGCGATGG - Intronic
1000209089 5:159095109-159095131 TTCAAAGGGAATGATGGTGAAGG - Intronic
1001435491 5:171696108-171696130 CTCAAACTGAATGATGTCCAAGG + Intergenic
1001475098 5:172044816-172044838 TTCACAGAGAATGAAGGAGAAGG + Exonic
1005527730 6:26667745-26667767 CTCACAGTTCAGGATGGCTAGGG + Intergenic
1005543065 6:26833933-26833955 CTCACAGTTCAGGATGGCTAGGG - Intergenic
1008076799 6:47154127-47154149 CCCACAGAGAATGATGGAGATGG - Intergenic
1009013883 6:57876103-57876125 CTCACAGTTCAGGATGGCTAGGG - Intergenic
1011647540 6:89474232-89474254 CTCACAGTGAAGGGTGTTGATGG + Intronic
1011702096 6:89965255-89965277 ATCACAGTGAAATATGGCTATGG - Intronic
1016103936 6:140138606-140138628 CAGACAGTGAACAATGGCGAAGG - Intergenic
1017214191 6:151890851-151890873 AACACAGAGAATGAAGGCGAAGG - Intronic
1018900668 6:168050297-168050319 CTCACACTAAACGATGGCCAGGG - Intergenic
1019969436 7:4528292-4528314 AACACTGTGAATGATGGCGAGGG + Intergenic
1024703423 7:51929414-51929436 CCCACAGTGAATGATGCAGCTGG + Intergenic
1030369690 7:108684805-108684827 CTCACCATGAATCATGGTGAAGG - Intergenic
1031517499 7:122719143-122719165 CTCTCAGTGACTGATGCCCATGG - Intronic
1032808822 7:135386966-135386988 CTAACACTGAATGCTGGAGAAGG + Intronic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1038257686 8:25965790-25965812 CCCACAGTGAAAGATGGGGAGGG + Intronic
1039295374 8:36145549-36145571 CTCACAGTTAAGCATGGCTAGGG - Intergenic
1040733073 8:50473327-50473349 CTCACAGTGCAGCATGGCTAGGG - Intronic
1045992384 8:108324198-108324220 CTCACAATGAAGGATGGCAAAGG + Intronic
1047733591 8:127746730-127746752 ATCACTGGGAATGATGGAGAAGG - Intergenic
1048701878 8:137100636-137100658 GTCAAAGTAAATGATGGCTATGG - Intergenic
1055001883 9:71460450-71460472 CTCACAGTTCATAATGGCTAGGG + Intergenic
1055795821 9:79973921-79973943 CTCACTCTGAATGATGGCCAAGG - Intergenic
1056817882 9:89814932-89814954 CTCATAGTGAATAATGGCCCCGG - Intergenic
1057310745 9:93941449-93941471 CTCAGAGTAAATGATGCAGAAGG + Intergenic
1057540380 9:95962389-95962411 CGCACAGTGAAGGATGACAAGGG + Intronic
1059297028 9:113280343-113280365 CACACAGTGAATGATGCCATGGG - Intronic
1060839453 9:126782235-126782257 CACACAGTGAATGCAGGTGAGGG - Intergenic
1185706513 X:2271354-2271376 CTCACAGAGAATGGTGGCAGGGG + Intronic
1186734836 X:12450974-12450996 CTCACAGTGAATGGTCGACAAGG + Intronic
1188678269 X:32970034-32970056 TCCATAGTCAATGATGGCGATGG + Intronic
1190825892 X:54017681-54017703 CTCACAGTGAATGATGGCGAGGG + Exonic
1193531611 X:82661019-82661041 GTCACAGTGAATGAGGATGAGGG + Intergenic
1196501575 X:116389338-116389360 CTGACATTTAATGATGGAGATGG + Intergenic
1199505061 X:148552273-148552295 CTCACAGAGAGTGATGGGGAAGG + Intronic
1200071979 X:153533742-153533764 CCCACAGTGACTCATGGGGAGGG - Intronic