ID: 1190832586

View in Genome Browser
Species Human (GRCh38)
Location X:54072724-54072746
Sequence CTGACAGCTACTGCCTTACT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190832581_1190832586 25 Left 1190832581 X:54072676-54072698 CCAAAGCTAGAGCTTTTCTATAG 0: 1
1: 0
2: 1
3: 11
4: 132
Right 1190832586 X:54072724-54072746 CTGACAGCTACTGCCTTACTAGG 0: 1
1: 0
2: 0
3: 12
4: 136
1190832583_1190832586 0 Left 1190832583 X:54072701-54072723 CCTTATGTGATGATACCCAATTT 0: 1
1: 0
2: 1
3: 11
4: 132
Right 1190832586 X:54072724-54072746 CTGACAGCTACTGCCTTACTAGG 0: 1
1: 0
2: 0
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190832586 Original CRISPR CTGACAGCTACTGCCTTACT AGG Exonic