ID: 1190832586 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:54072724-54072746 |
Sequence | CTGACAGCTACTGCCTTACT AGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 149 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 12, 4: 136} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1190832581_1190832586 | 25 | Left | 1190832581 | X:54072676-54072698 | CCAAAGCTAGAGCTTTTCTATAG | 0: 1 1: 0 2: 1 3: 11 4: 132 |
||
Right | 1190832586 | X:54072724-54072746 | CTGACAGCTACTGCCTTACTAGG | 0: 1 1: 0 2: 0 3: 12 4: 136 |
||||
1190832583_1190832586 | 0 | Left | 1190832583 | X:54072701-54072723 | CCTTATGTGATGATACCCAATTT | 0: 1 1: 0 2: 1 3: 11 4: 132 |
||
Right | 1190832586 | X:54072724-54072746 | CTGACAGCTACTGCCTTACTAGG | 0: 1 1: 0 2: 0 3: 12 4: 136 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1190832586 | Original CRISPR | CTGACAGCTACTGCCTTACT AGG | Exonic | ||