ID: 1190835208

View in Genome Browser
Species Human (GRCh38)
Location X:54094463-54094485
Sequence GCTAATCTTTAGAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 257}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190835205_1190835208 2 Left 1190835205 X:54094438-54094460 CCTGGACCTCTAGGGGATTTAGT 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1190835208 X:54094463-54094485 GCTAATCTTTAGAATGAGGATGG 0: 1
1: 0
2: 1
3: 23
4: 257
1190835199_1190835208 19 Left 1190835199 X:54094421-54094443 CCTGGGCAACTAAATCCCCTGGA 0: 1
1: 0
2: 0
3: 1
4: 103
Right 1190835208 X:54094463-54094485 GCTAATCTTTAGAATGAGGATGG 0: 1
1: 0
2: 1
3: 23
4: 257
1190835197_1190835208 20 Left 1190835197 X:54094420-54094442 CCCTGGGCAACTAAATCCCCTGG 0: 1
1: 0
2: 1
3: 9
4: 101
Right 1190835208 X:54094463-54094485 GCTAATCTTTAGAATGAGGATGG 0: 1
1: 0
2: 1
3: 23
4: 257
1190835204_1190835208 3 Left 1190835204 X:54094437-54094459 CCCTGGACCTCTAGGGGATTTAG 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1190835208 X:54094463-54094485 GCTAATCTTTAGAATGAGGATGG 0: 1
1: 0
2: 1
3: 23
4: 257
1190835206_1190835208 -4 Left 1190835206 X:54094444-54094466 CCTCTAGGGGATTTAGTTTGCTA 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1190835208 X:54094463-54094485 GCTAATCTTTAGAATGAGGATGG 0: 1
1: 0
2: 1
3: 23
4: 257
1190835203_1190835208 4 Left 1190835203 X:54094436-54094458 CCCCTGGACCTCTAGGGGATTTA 0: 1
1: 0
2: 1
3: 10
4: 100
Right 1190835208 X:54094463-54094485 GCTAATCTTTAGAATGAGGATGG 0: 1
1: 0
2: 1
3: 23
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190835208 Original CRISPR GCTAATCTTTAGAATGAGGA TGG Intronic
902853283 1:19178927-19178949 GATAATGTTTAGAGTGGGGAGGG - Intronic
903113961 1:21162629-21162651 GCTACTCTGTAGGCTGAGGAAGG + Intronic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
906261933 1:44399178-44399200 GTTATTCTTCAGAATGAGGATGG + Intergenic
906369949 1:45245045-45245067 GCTCATCTTTAGAAGGGAGAGGG - Intronic
906860611 1:49355023-49355045 GCACATCTTTGGGATGAGGAAGG + Intronic
907394646 1:54180687-54180709 CCTAATCTCTAGAATGAGGGTGG - Intronic
907708813 1:56858203-56858225 GTTGGTCTTTAGAATTAGGAAGG + Intronic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908818102 1:68054425-68054447 GCTACTCTTAAGGCTGAGGAGGG + Intergenic
908921315 1:69196697-69196719 GCTCATCTTTAAATTGAAGATGG + Intergenic
908957174 1:69646968-69646990 TGTAATCTTTAGAATGACGTAGG - Intronic
911371199 1:96996835-96996857 GCTGAACTTTGGAATGCGGAAGG - Intergenic
912585093 1:110755484-110755506 GCTAAACTTTAAAAAGATGAGGG - Intergenic
912774940 1:112500658-112500680 GCTAATCGGGAGACTGAGGAGGG + Intronic
913037964 1:114991730-114991752 CCTAATATTAAGAATGAGGCAGG + Intronic
913271282 1:117096056-117096078 GCTAACCTTAAGAATGATGAGGG + Intronic
914679964 1:149932118-149932140 TCTGCTCTTTAGAAGGAGGAGGG - Intronic
914791424 1:150880607-150880629 GCTAATCTAGAGGCTGAGGAGGG + Intergenic
916963765 1:169914528-169914550 ACATATCTTCAGAATGAGGAAGG - Intergenic
917068212 1:171120964-171120986 GCTAATCTTAAGACATAGGAGGG + Intergenic
917429711 1:174953356-174953378 GCTAATATTGAGAAAGAGTAAGG + Intronic
918843988 1:189584703-189584725 GCTACTCTGGAGACTGAGGAGGG + Intergenic
919533442 1:198754968-198754990 GCTAGTCTTCTGGATGAGGAGGG - Intronic
919690700 1:200526246-200526268 GCTACTCTGGAGAATGAGGCAGG - Intergenic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
923906526 1:238391456-238391478 CTGAATCTTTAGAATAAGGAAGG - Intergenic
924212424 1:241784548-241784570 GAAAATGTTTAGAATGTGGAAGG + Intronic
924588905 1:245384585-245384607 CCTTATCTTTAAAATGAGAATGG - Intronic
1063747361 10:8899713-8899735 GCTACTCTGTAGGATGAGGCAGG - Intergenic
1064272151 10:13875210-13875232 GCTAATCGTCTGAGTGAGGATGG + Intronic
1067185708 10:44025344-44025366 GCCCCTCTGTAGAATGAGGATGG + Intergenic
1067471070 10:46538290-46538312 CTTCATCTATAGAATGAGGATGG - Intergenic
1068131595 10:52901943-52901965 GCACATCTTTGGAATGTGGAAGG + Intergenic
1068604219 10:58987989-58988011 GACAATCTTTAGAATCAGGTTGG + Intergenic
1069649368 10:70033550-70033572 GCTAATCTTTAGAATGTGTGCGG - Intergenic
1072121826 10:92411420-92411442 GCTACTCTTAAGGATGAGGCAGG + Intergenic
1073166583 10:101459396-101459418 TCTACTCTTTAGTATTAGGAGGG + Intronic
1073497558 10:103907573-103907595 GAACATGTTTAGAATGAGGAAGG + Intronic
1074291945 10:112144278-112144300 TCTAATCTTTTGAACCAGGAGGG - Intergenic
1078569726 11:12447260-12447282 GCTAATCTTAAAAGTGAGGGTGG + Intronic
1078796203 11:14594073-14594095 GCTAATGTTAATAATGAGAATGG + Intronic
1078910772 11:15729896-15729918 GCAAATATTTACAAAGAGGATGG - Intergenic
1079148673 11:17877483-17877505 GCTCATCTTTAAAATGGGGAGGG - Intronic
1080561757 11:33470538-33470560 GCTACTCTGTAGGGTGAGGAGGG - Intergenic
1080733531 11:34985954-34985976 GCAAATCTTTTCAAAGAGGAGGG - Intronic
1082013207 11:47464889-47464911 GCTCATCTGTAAAACGAGGATGG + Intergenic
1082846730 11:57732199-57732221 GCAAAACTTTAGAAGGTGGAGGG + Intronic
1085105245 11:73836701-73836723 GCCGATATTTGGAATGAGGATGG + Intronic
1085483839 11:76845154-76845176 TCTTATCTATAAAATGAGGATGG + Intergenic
1085913491 11:80856894-80856916 GGAAATCTATAGAAAGAGGATGG - Intergenic
1086156795 11:83676105-83676127 CCTAAGCTTTAGAATGGGGCTGG + Intronic
1086400136 11:86454601-86454623 CCCAATCTGTAAAATGAGGATGG - Intronic
1086622743 11:88907141-88907163 CCTCATCTATATAATGAGGATGG + Intronic
1086746620 11:90435998-90436020 ACTATTCTTTATACTGAGGATGG - Intergenic
1086842820 11:91708606-91708628 GTCAATCTGTAGAATGAGTAAGG - Intergenic
1087224806 11:95586643-95586665 GTTAGTATTGAGAATGAGGAAGG - Intergenic
1087920237 11:103858587-103858609 TGTAATCTGTAAAATGAGGAAGG + Intergenic
1087971998 11:104495642-104495664 GCAAATCTTTAGAATGAATTAGG - Intergenic
1093357245 12:18180644-18180666 GCTACTCTTGAGGCTGAGGAGGG + Intronic
1094038867 12:26102045-26102067 CCTTATCTATAGAATGGGGATGG - Intergenic
1094117727 12:26935802-26935824 GCCAATTCTTAGACTGAGGAAGG - Intronic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1097318507 12:58199699-58199721 GCTTCTCTTTTGAATGGGGAGGG - Intergenic
1098269748 12:68758306-68758328 GCTACTCAGGAGAATGAGGAAGG + Intronic
1098599688 12:72316298-72316320 GCTCATTTTTAAAATGAGAAGGG - Intronic
1098720454 12:73891147-73891169 TCTAATCTATAAAATGAGAATGG + Intergenic
1099256151 12:80315479-80315501 GCAAATCTATTTAATGAGGAAGG + Intronic
1100687837 12:97005907-97005929 GCTAATCGATATAATGAGAATGG - Intergenic
1102188977 12:110971538-110971560 GCTTATCATTTGAATCAGGATGG - Intergenic
1102546136 12:113657139-113657161 ACCAATCTTATGAATGAGGAAGG + Intergenic
1103292670 12:119859926-119859948 GCTACTCTGGAGAATGAGGTGGG - Intronic
1103598479 12:122038804-122038826 TTTAATCTGTAGAATGGGGATGG + Intronic
1104204940 12:126629938-126629960 ACTAATCAAAAGAATGAGGAAGG - Intergenic
1106103628 13:26715351-26715373 GCTACTCTGGAGACTGAGGAGGG + Intergenic
1106516484 13:30459258-30459280 ACTAATCTTCAGATTGAAGAGGG + Exonic
1106893633 13:34274338-34274360 TGTAATCTTTGCAATGAGGAGGG + Intergenic
1107425229 13:40286345-40286367 TCTAAACTTTAAAAGGAGGATGG + Intergenic
1107571895 13:41670291-41670313 ACTAATTTGAAGAATGAGGAAGG - Intronic
1108275554 13:48805926-48805948 ACAAGTTTTTAGAATGAGGAAGG + Intergenic
1108335843 13:49441453-49441475 GCTACTCTTGAGGCTGAGGAGGG + Intronic
1109272523 13:60270447-60270469 TCAAATCTTTATAATTAGGAAGG + Intergenic
1112740541 13:102467994-102468016 GATAATTTTTGGAAGGAGGAAGG + Intergenic
1113069501 13:106406684-106406706 ACTAATCTTTACAATCAGCAGGG - Intergenic
1114267215 14:21079942-21079964 CCTCATCTATAGAATGCGGATGG + Intronic
1114869537 14:26639607-26639629 GCTACTCTGGAGACTGAGGAGGG + Intergenic
1115301622 14:31892100-31892122 TCTAAACTTCAGAATGAGGAGGG + Intergenic
1115425519 14:33254422-33254444 CCAAGTCTTAAGAATGAGGATGG - Intronic
1115658678 14:35468484-35468506 GCTGATCTGCAGAATGATGAAGG + Intergenic
1115737377 14:36348358-36348380 GCTACTCTTGAGGATGAGGCAGG + Intergenic
1116135063 14:40912515-40912537 CCTAATCTATAAAATGAGAATGG + Intergenic
1116607566 14:47021287-47021309 GCTTCTGTTTAGAATGAGGATGG - Intronic
1116823755 14:49651558-49651580 GCTAATCCCTAGAATGGGGTAGG - Intronic
1117662884 14:58026715-58026737 CCTAAAATTGAGAATGAGGAGGG - Intronic
1118916235 14:70108993-70109015 GATAAACTTTAGATTGAGAAGGG - Intronic
1121096920 14:91223853-91223875 GCTTATCTGTAAAATGGGGAGGG - Intronic
1124952796 15:34338605-34338627 GCTATTCCTTAGACTGAGGCAGG + Intergenic
1125563939 15:40660849-40660871 GCTAATCTTGAGGCTGAGGTGGG + Intronic
1125965054 15:43867618-43867640 GCTACTGCTTAGAATGAAGAAGG + Exonic
1126987213 15:54326065-54326087 GCTAGCCTTTAGAATGAGAAAGG + Intronic
1128546913 15:68574469-68574491 GCTACTCTACAGAGTGAGGAGGG - Intergenic
1128890646 15:71328920-71328942 CCTGATCTGTAGAATGAGGCTGG + Intronic
1130097520 15:80867078-80867100 GCAAATCTGTAAAATGGGGAGGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133793005 16:9023725-9023747 GTTACTCTTTAGACTGAGGTGGG + Intergenic
1134324021 16:13190336-13190358 TTTAGTCTTTAGAATGATGATGG + Intronic
1134537337 16:15036570-15036592 GCTTATGTTTAGAAAGAGCAAGG - Exonic
1135497764 16:22967412-22967434 TCTAATCTCTACAGTGAGGAGGG + Intergenic
1135609818 16:23856633-23856655 GCTACTCATGAGAATGAGGTGGG - Intronic
1136067209 16:27767267-27767289 CCTCATCTATAAAATGAGGAGGG + Intronic
1141302099 16:82826346-82826368 TCTAATTTTTATAATGAGTAGGG + Intronic
1141885483 16:86889090-86889112 GCTAATCTTTAGCAGGAGGCTGG + Intergenic
1141901980 16:86996877-86996899 CCTCATCTTTAGAGTGGGGATGG + Intergenic
1145377071 17:22360622-22360644 GCTACTCTGGAGAATGAGGCAGG - Intergenic
1145779188 17:27550819-27550841 TCTAGTCTTGAGAAGGAGGATGG + Intronic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146744540 17:35315663-35315685 GCAAATATTTAGAATGATAATGG - Intergenic
1147838856 17:43355962-43355984 GCTCATCTTTTAAATGTGGACGG + Intergenic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148979238 17:51557250-51557272 GCTAATCTTGAGGGTGTGGAGGG + Intergenic
1153265393 18:3263732-3263754 GCTAATGTGTAGAATGAGGAAGG - Intronic
1153466088 18:5389374-5389396 GCTGATCTGTAAAATCAGGAAGG + Intergenic
1155403240 18:25461169-25461191 GCTAATCTGTAGGCTGAGGTGGG + Intergenic
1158551493 18:58439905-58439927 GCTACTCTGGAGACTGAGGAAGG - Intergenic
1160134430 18:76260597-76260619 GCAAATCTTCAGAATCAGAAAGG + Intergenic
1166246651 19:41532287-41532309 GGAAGTCTTAAGAATGAGGAAGG - Intergenic
1166625868 19:44355639-44355661 GCTTATCTTTAAAATGGGAATGG + Intronic
1168387779 19:55980211-55980233 GCTAATCTATAAAATTGGGATGG + Intronic
928216691 2:29367411-29367433 GCTAATCTGTAAAATGAGGGAGG + Intronic
929523712 2:42679683-42679705 GCCATTCTTTAAAATGAAGAAGG - Intronic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
936139462 2:109926696-109926718 GCTACTCTGGAGACTGAGGATGG + Intergenic
936205234 2:110444790-110444812 GCTACTCTGGAGACTGAGGATGG - Intronic
937649090 2:124299808-124299830 GCTAAGCTTTAGATGAAGGAAGG - Intronic
939034124 2:137110583-137110605 TCTAACATTTAGAATGAGCAGGG + Intronic
939195096 2:138961794-138961816 GCTACTCTTGAGACTGAGGCAGG - Intergenic
940086764 2:149868102-149868124 GCTACTCTTGAGACTGAGGCAGG + Intergenic
940409021 2:153338179-153338201 GCTACTCTGGAGGATGAGGAGGG + Intergenic
941498181 2:166233968-166233990 GCTAATCTTTAGAAATTGTAGGG - Intronic
941724132 2:168842530-168842552 ACTAATTTTTAGAATGAGTCTGG - Intronic
942592737 2:177562846-177562868 GATAAACTCTAGAATGTGGAAGG + Intergenic
942822436 2:180130945-180130967 GATAATGTTTAAAATGAGGAAGG - Intergenic
944337196 2:198549389-198549411 ATTAATCTTTTGAATGAAGAAGG + Intronic
944991588 2:205243481-205243503 TCTCATCTGTAGAATGAGAATGG + Intronic
946080553 2:217114861-217114883 GCTGATTTTTAGAAAGAGAAGGG - Intergenic
946770629 2:223085109-223085131 GCTGCTATTTAGAATGAGAAAGG + Intronic
947914846 2:233824447-233824469 GTAAATCTTCAAAATGAGGATGG + Intronic
948216369 2:236236580-236236602 GCCAGTCTTGAGAAAGAGGAAGG - Intronic
1169150973 20:3289098-3289120 GCTACTTTGTAGAATGAGGTGGG + Intronic
1172131563 20:32659495-32659517 GCTCATCTGTACAATGAAGATGG - Intergenic
1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG + Intergenic
1174584265 20:51595369-51595391 TCTAATCTATATACTGAGGATGG + Intergenic
1174947516 20:55004436-55004458 GCTAATCTTTCAAATAAAGATGG + Intergenic
1177070896 21:16506335-16506357 GCTATTGTTTATAATGAGGATGG - Intergenic
1177535182 21:22417329-22417351 CCTAATTTTAAAAATGAGGAAGG - Intergenic
1181013446 22:20055369-20055391 GCTAATCTGGAGACTAAGGAGGG - Intronic
1182131039 22:27850864-27850886 TCTCATCTATACAATGAGGATGG + Intergenic
1184143763 22:42596062-42596084 GCTCATCTGTAGAATGGGGGTGG + Intronic
949501977 3:4688641-4688663 GCAAATCTATAGAGGGAGGAGGG + Intronic
951245789 3:20340293-20340315 ACCAATCTTTAGAATGTGGTAGG + Intergenic
951278770 3:20721417-20721439 TCTCATCTCTAGAATGGGGATGG + Intergenic
952733950 3:36669271-36669293 GCTAATTGTAAGAATGAGGCAGG + Intergenic
954336110 3:49918712-49918734 GCTCATCTTTAGTAAGAAGAGGG - Intronic
954685163 3:52366324-52366346 CCTCATCTATAAAATGAGGATGG - Intronic
955259809 3:57376085-57376107 GCTTATCTGTAAAATGAGGTTGG + Intronic
956553009 3:70482952-70482974 GCAAATCTGGAGAATGAGAAAGG + Intergenic
956935378 3:74095015-74095037 GCTAATATCTATAATGAGCAAGG + Intergenic
957263508 3:77930413-77930435 GCTACTCTTGAGACTGAGGCAGG - Intergenic
959351044 3:105263678-105263700 ACTAATTTTTAGGAGGAGGATGG - Intergenic
960272181 3:115687276-115687298 GCTGATCTTCACAATGAGTATGG + Intronic
960997238 3:123348281-123348303 GCTCGTCTGTAAAATGAGGATGG + Intronic
961020962 3:123506539-123506561 GCTACTCTTGAGACTGAGGTGGG - Intronic
962394356 3:135001802-135001824 GCAACTCTTTATAATGAGGCAGG - Intronic
962468195 3:135680064-135680086 GCCAAGCTTCTGAATGAGGAAGG + Intergenic
963935872 3:151052708-151052730 CCTAATCGTTAGAATGATGAGGG - Intergenic
966385061 3:179387681-179387703 GCTACTCACTTGAATGAGGAAGG - Intronic
966530404 3:180972342-180972364 GCTACTCTTGAGACTGAGGCAGG + Intronic
966581171 3:181565702-181565724 GATAACCTTCAGAATGATGAGGG + Intergenic
967230168 3:187330462-187330484 TCTAATCTTTAAAATGAAAAAGG + Intergenic
967328288 3:188264553-188264575 GCTGATTTTTAAAATGAGGTAGG + Intronic
970022883 4:11588887-11588909 TCTAATGTATAGCATGAGGATGG - Intergenic
971586933 4:28416204-28416226 GCAAAACTTTAGAAGGAAGAGGG + Intergenic
971734720 4:30432175-30432197 GCCAATTTTTAGAGTGGGGAAGG + Intergenic
972897980 4:43646167-43646189 GCTACTCTGGAGAATAAGGAGGG + Intergenic
973061599 4:45733145-45733167 TCTGATTTCTAGAATGAGGAAGG - Intergenic
976208090 4:82640834-82640856 GGAAATCTCTAAAATGAGGAAGG - Intronic
977785385 4:101027414-101027436 GCTAACCTTTAAAATGCAGAGGG - Intronic
979270556 4:118755620-118755642 GCTGATCTTTTGAAAAAGGAAGG - Intronic
979711229 4:123781829-123781851 TCTGATCTTTAGGAGGAGGAAGG + Intergenic
979992018 4:127386253-127386275 GGTAATCTCTAAAATTAGGAAGG - Intergenic
980112535 4:128648538-128648560 GCTAAGCCTTATAATGAGGCTGG - Intergenic
983405895 4:167329375-167329397 GCTAATCTGGAGACTGAGGTGGG + Intergenic
987919536 5:24261272-24261294 TCTGATCGCTAGAATGAGGAGGG + Intergenic
989661426 5:43802486-43802508 ACTAACCTGCAGAATGAGGAAGG + Intergenic
989669075 5:43892632-43892654 GCACATCTTTAGGATGTGGAAGG + Intergenic
990714938 5:58626171-58626193 GCTAAAAATTAGAATGAGAAAGG - Intronic
991006850 5:61836434-61836456 TCTCATCTTTAAAATGAGAAAGG + Intergenic
992175105 5:74142303-74142325 GCTCAGCTTTAGGATGTGGATGG + Intergenic
992438828 5:76780581-76780603 GCTACTCTGGAGAATGAGGTGGG + Intergenic
993451790 5:88080706-88080728 GCTACTCTTTAGAAAGGGCACGG - Intergenic
993729959 5:91410673-91410695 GCACATCTTTGGAATGTGGAAGG + Intergenic
999158893 5:149478604-149478626 GCTATTCTTTAGGCTGAGGTGGG - Intergenic
999453154 5:151693685-151693707 ACTCATCTTTAAAATGAGAATGG - Intergenic
999640050 5:153663303-153663325 CCTAATCCTTAGAATGGGAAAGG - Intronic
1001526863 5:172435355-172435377 GGTAAGATTGAGAATGAGGATGG + Intronic
1002262151 5:178000947-178000969 GCTCATTTTGCGAATGAGGAAGG - Intergenic
1003134638 6:3424949-3424971 GCTAATGCTCAGAATGAGGGAGG + Intronic
1003843179 6:10143833-10143855 GCTAATATTTACAATGAAGAAGG - Intronic
1004149087 6:13097951-13097973 GCTAATCTTTAAAAAGCAGAGGG - Intronic
1004339122 6:14792547-14792569 GATAATCTTTTGAATGTGGAGGG - Intergenic
1004839826 6:19570177-19570199 GCCATTCTTTAGAATGAGGTTGG - Intergenic
1007139975 6:39562309-39562331 GCAAGTCTTTAGAATGAAAAGGG + Intronic
1007643348 6:43361451-43361473 GCTACTCTTTAGACTGAGCTGGG + Intronic
1007723205 6:43898249-43898271 GCTAATCTTGAGAGTTAGGAGGG - Intergenic
1008391722 6:50959694-50959716 GCCAATCTTTAGAATCATGTGGG - Intergenic
1008947693 6:57116851-57116873 GCTACTCTGTAGGATGAGGTGGG + Intronic
1011986964 6:93459229-93459251 CCTAATCTATAAAATGAGGTTGG + Intergenic
1015000577 6:128209542-128209564 TTTAATGTGTAGAATGAGGAGGG - Intronic
1015080279 6:129216374-129216396 GATGTTCTTTGGAATGAGGATGG + Intronic
1015797510 6:137027728-137027750 ACTAAGCTGTAAAATGAGGATGG - Intronic
1016354638 6:143204751-143204773 GATTATCTTTAGAATGGGGGAGG + Intronic
1017804465 6:157931816-157931838 CCTAATCCTCAGCATGAGGATGG + Intronic
1020220526 7:6233110-6233132 GAGAACATTTAGAATGAGGAAGG - Intronic
1020818091 7:12931144-12931166 TTTAATCTTTAGAATGAAGGTGG + Intergenic
1020901456 7:14008512-14008534 GCTACTTTTTGGAATGAGGAAGG + Intergenic
1022311601 7:29201366-29201388 GCTACTCTTTAGGATGAGCCAGG - Intronic
1024803666 7:53110686-53110708 CCTATTCTATAAAATGAGGAAGG + Intergenic
1024906191 7:54383741-54383763 GGTAAACTTTAAAATGAGGATGG + Intergenic
1026610051 7:71850325-71850347 GCTACTCTTGAGGATGAGGCAGG - Intronic
1027895793 7:84042709-84042731 GACTATCTTTAGAATGAGGCAGG - Intronic
1028579595 7:92394142-92394164 TCTCATCTTTACAATGTGGATGG + Intronic
1028660017 7:93260805-93260827 GCTATTCTGGAGAATGAGGCAGG - Intronic
1029527266 7:101102622-101102644 CCTCATCTTTAAAACGAGGATGG - Intergenic
1030260127 7:107555284-107555306 GCAAATCTTTAGAATAATGCAGG + Intronic
1031071277 7:117164872-117164894 GCTCATCTGTAAAGTGAGGAGGG + Intronic
1031356050 7:120788438-120788460 TCTATGCTTTAAAATGAGGATGG - Exonic
1032544874 7:132733658-132733680 GCTACTCTGGAGACTGAGGATGG + Intergenic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035638830 8:1167022-1167044 GCTAATCTGTAGGCTGAGGTGGG + Intergenic
1035905851 8:3509497-3509519 CCTCATCTTTAAAATGAAGAAGG + Intronic
1036793863 8:11741696-11741718 TCTAATCTTGACAATGATGAAGG + Intronic
1036936798 8:13010652-13010674 ATACATCTTTAGAATGAGGAGGG - Intronic
1038327617 8:26584382-26584404 GCTTCTTTTTAGAATGAGGATGG + Intronic
1039906932 8:41793266-41793288 GCTAATCTGGAGGCTGAGGAAGG + Intronic
1042636123 8:70877414-70877436 TGTAATCTGTAAAATGAGGATGG - Intergenic
1045524405 8:102929597-102929619 GCTAATGTTTAAACAGAGGAGGG - Intronic
1046048659 8:108993995-108994017 GTTTAGCTTTAGAATCAGGAGGG - Intergenic
1047156512 8:122325417-122325439 CCTCATCTTTAAAATGAGGATGG + Intergenic
1047411596 8:124628794-124628816 CCCCATCTTTAAAATGAGGATGG - Intronic
1047473566 8:125203342-125203364 ACTAATATCTAGAAAGAGGAAGG + Intronic
1049450036 8:142655652-142655674 GCTCATCTGTACAATGGGGATGG + Intergenic
1052963951 9:34324734-34324756 ACTAAACTGTAGAGTGAGGAAGG - Intronic
1053011146 9:34634354-34634376 GCTACTCTGGAGACTGAGGAAGG + Intergenic
1055309959 9:74968349-74968371 GCTAATCTGGAGGCTGAGGAGGG + Intergenic
1056071103 9:82987793-82987815 TCTAATCTGTAAAATGAGGGAGG - Intronic
1056574510 9:87844568-87844590 GTTTGTCTTTAGAATGAAGAAGG + Intergenic
1057615201 9:96583506-96583528 GCTACTCTTGAGACTGAGGCAGG - Intronic
1058657271 9:107234602-107234624 GGAAATCTTAAGAATGAGTATGG + Intergenic
1059327342 9:113512224-113512246 GATGATCTTGAGACTGAGGATGG + Intronic
1061676279 9:132217744-132217766 TCTAATCTGTAAAATAAGGATGG - Intronic
1062487871 9:136789815-136789837 GCTACTCTTCAAAATGTGGAAGG - Intergenic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1188796471 X:34472262-34472284 GCACAACTTTAGAATGTGGAAGG + Intergenic
1188906794 X:35800131-35800153 GTGAATCTTTAGCATAAGGAGGG + Intronic
1189312625 X:40030627-40030649 GCTACTCTGTAGGCTGAGGAGGG + Intergenic
1190835208 X:54094463-54094485 GCTAATCTTTAGAATGAGGATGG + Intronic
1191797664 X:65038566-65038588 GATGATCTTTGGAAAGAGGAGGG + Intergenic
1191797997 X:65043382-65043404 GCTTCTCCTTAAAATGAGGAGGG - Intergenic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1194549154 X:95274403-95274425 GAGAAGCTTTAGTATGAGGAGGG - Intergenic
1194918570 X:99734788-99734810 GCTACTCTGTAGGCTGAGGAAGG + Intergenic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1199902520 X:152190427-152190449 GCTCATCTTCAGAATGAACATGG + Intronic
1200331143 X:155299498-155299520 GTTAATCTTTAAAATGAAAATGG + Intronic
1200409969 Y:2851295-2851317 GTTACTCTTTTAAATGAGGATGG + Intronic
1201753959 Y:17466851-17466873 GTTAATATTTAGCATTAGGATGG + Intergenic
1201847593 Y:18439134-18439156 GTTAATATTTAGCATTAGGATGG - Intergenic