ID: 1190836316

View in Genome Browser
Species Human (GRCh38)
Location X:54104241-54104263
Sequence AGGTTGATACAGTTTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190836316_1190836322 12 Left 1190836316 X:54104241-54104263 CCCTCCTCAAACTGTATCAACCT 0: 1
1: 0
2: 1
3: 8
4: 158
Right 1190836322 X:54104276-54104298 TCAATTTCTCTAGGACATCTAGG 0: 1
1: 0
2: 2
3: 18
4: 309
1190836316_1190836321 3 Left 1190836316 X:54104241-54104263 CCCTCCTCAAACTGTATCAACCT 0: 1
1: 0
2: 1
3: 8
4: 158
Right 1190836321 X:54104267-54104289 CTAGAAGACTCAATTTCTCTAGG 0: 1
1: 0
2: 1
3: 12
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190836316 Original CRISPR AGGTTGATACAGTTTGAGGA GGG (reversed) Intronic
902475680 1:16685173-16685195 ATTTTGATACAATTTGAGGGAGG - Intergenic
908946310 1:69502002-69502024 AGGGTGATACAGTATGAGTTTGG + Intergenic
912132122 1:106616460-106616482 AAATGCATACAGTTTGAGGAGGG + Intergenic
912401843 1:109399676-109399698 AAGCTGATACAGTTTGAAGAAGG - Exonic
917070332 1:171143342-171143364 AGATACATACAGTTTGAGGTAGG + Exonic
919396685 1:197058548-197058570 AGGTTGAAATGTTTTGAGGAAGG - Intronic
919412523 1:197264117-197264139 AGGTTGAGGGAGTTGGAGGAGGG - Intergenic
919632270 1:199970978-199971000 AGGTAGTTACAGTGTGATGAGGG - Intergenic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
921621628 1:217331914-217331936 AGGATGAAATACTTTGAGGACGG - Intergenic
921961592 1:221040870-221040892 AGGTTGAGACAGTTCAGGGATGG + Intergenic
921988645 1:221340070-221340092 AGGTTGGTAAAGGTGGAGGAAGG + Intergenic
923356857 1:233165345-233165367 TGGTTTTTACAATTTGAGGAAGG + Intronic
1063666736 10:8065651-8065673 AGGTTGAGAAAGTTGGAGAAGGG - Intronic
1065763155 10:29002019-29002041 ATGTTGCTACACTTTGAGGATGG + Intergenic
1066688403 10:38002972-38002994 AGATTGACCCAGTTTGAAGATGG + Intergenic
1067005454 10:42656581-42656603 AGATTGACCCAGTTTGAAGATGG - Intergenic
1068388666 10:56363271-56363293 AGGTTGAGAGAGTATGGGGAGGG + Intergenic
1069244015 10:66179348-66179370 TGGTTGACACTGGTTGAGGAAGG + Intronic
1070255487 10:74810097-74810119 ATGTTGATAATGTTTGCGGAAGG + Intergenic
1071178090 10:82950765-82950787 AGGTAGATACAGGTTAAGAAAGG + Intronic
1072544554 10:96425624-96425646 AGTTTGATACACTTTTATGATGG - Intronic
1073230141 10:101962464-101962486 AGGTGAATGTAGTTTGAGGAAGG - Intronic
1074313349 10:112341274-112341296 AGGTTGAAAGAGTCTGGGGAGGG - Intergenic
1079436344 11:20455960-20455982 AGGTTTATAAACTTGGAGGAAGG + Intronic
1079469544 11:20765288-20765310 AGGTTCATACAGGTTCAGAAGGG + Intronic
1081305099 11:41502131-41502153 AGTTTAATACATTTTGAGTATGG + Intergenic
1081627020 11:44662179-44662201 AGGTTCTTGCAGTTTCAGGAAGG + Intergenic
1081800876 11:45858544-45858566 AGGTTCAGAAAGTTTGAGGAGGG - Intronic
1084994866 11:72966835-72966857 AATATGATATAGTTTGAGGAAGG + Intronic
1088069409 11:105763117-105763139 AGTTTAATACTGTTTGAGGAAGG + Intronic
1088354218 11:108925194-108925216 AGGTTGCTACACATTGGGGAAGG + Intronic
1088391489 11:109319708-109319730 AGGGTGATAACTTTTGAGGATGG + Intergenic
1088605778 11:111529924-111529946 TGGTGAATACAGTTTGAGGGAGG - Intronic
1089004126 11:115076650-115076672 AGGGTGAGACAGTTTGAGGAAGG - Intergenic
1089335222 11:117718245-117718267 AGGCTGACACAGCCTGAGGATGG + Intronic
1094161261 12:27393373-27393395 AGATTGAATCAGTTTGAGGTGGG + Intronic
1097470229 12:59981551-59981573 ATGTTGATACAATGTGATGACGG + Intergenic
1100649222 12:96566539-96566561 ACGTGGATACAGATTGAGTAGGG + Intronic
1101535884 12:105616083-105616105 AGGCTGATACAGTTAAAGGCAGG + Intergenic
1107934464 13:45333863-45333885 AGGTGGAAAAAGTTTTAGGAAGG - Exonic
1109451850 13:62525319-62525341 AGTCTGATTCACTTTGAGGAGGG + Intergenic
1109471216 13:62806828-62806850 AGGCTGAAACAATTTGAGCAAGG + Intergenic
1112913260 13:104515945-104515967 AGGTTGATACAGAATGAGATGGG - Intergenic
1116726587 14:48568357-48568379 AGGTTGATCTAGTAAGAGGATGG - Intergenic
1117027779 14:51638935-51638957 AGTTTGAATCAGTTTGAGCAGGG + Intronic
1121660917 14:95634339-95634361 AGGCTGATATGGTTGGAGGAGGG + Intergenic
1126898948 15:53291563-53291585 AGGTTGGTACATTTGGAAGATGG - Intergenic
1128565209 15:68696617-68696639 AAGTTGGTAGAGTCTGAGGAAGG - Intronic
1129640522 15:77372466-77372488 AGATTCAAACAGATTGAGGATGG - Intronic
1134567967 16:15267225-15267247 TGGTTGATACAGTTAGTGAAGGG - Intergenic
1134734468 16:16489128-16489150 TGGTTGATACAGTTAGTGAAGGG + Intergenic
1134932998 16:18222778-18222800 TGGTTGATACAGTTAGTGAAGGG - Intergenic
1134933016 16:18222964-18222986 TGGTTGATACAGTTAGTGAAGGG - Intergenic
1134933034 16:18223150-18223172 TGGTTGATACAGTTAGTGAAGGG - Intergenic
1135134041 16:19874661-19874683 GGGTTGTCACAGTTGGAGGAGGG - Intronic
1135564271 16:23499807-23499829 AGGTTTCTACACTGTGAGGAAGG - Intronic
1137451882 16:48583388-48583410 AGGCTGGCACAGTTTGGGGAAGG + Intronic
1143924461 17:10357566-10357588 ATTGTGATACACTTTGAGGAAGG - Intronic
1144028329 17:11297978-11298000 AGGTTATTAGAGGTTGAGGATGG + Intronic
1148161056 17:45450375-45450397 AGGAGGAAAGAGTTTGAGGATGG - Intronic
1149187587 17:54017544-54017566 ACGTTGACACAGTCTGGGGAAGG - Intergenic
1150392288 17:64797021-64797043 AGGAGGAAAGAGTTTGAGGATGG - Intergenic
1151100814 17:71553447-71553469 AGTTTGAGACAGGTTGAGGAGGG + Intergenic
1162620831 19:11842313-11842335 AGTTTGATAATGTTTGAAGAAGG + Intergenic
1163297475 19:16421651-16421673 AGGCTGAGACAGGTTGAGGCTGG + Intronic
1165890480 19:39109223-39109245 AGGGTCACACAGTTGGAGGACGG + Intronic
1167903627 19:52640418-52640440 GGATTGATACAATTCGAGGAAGG + Intronic
929220808 2:39463209-39463231 AAGTTGTTACATTTTGAGTAAGG - Intergenic
929393799 2:41499382-41499404 AGATGGCTACAGTTAGAGGATGG + Intergenic
930889827 2:56371636-56371658 AGGATTATACAGTTTGGTGATGG + Intronic
935703721 2:105837747-105837769 AGGTTGATAATGTGTTAGGAAGG - Intronic
936937333 2:117850940-117850962 AGGTTAAAACAGTTTTATGAAGG + Intergenic
939239837 2:139543435-139543457 GGGTTGTTTCAGTTTGAGGTTGG - Intergenic
939825783 2:147014117-147014139 AGGTTGCTATAGTTTGTGGATGG - Intergenic
940467523 2:154050795-154050817 AGGTTGATTGATTTTGAAGATGG - Intronic
943007234 2:182400696-182400718 AGTTTAATACAGTAAGAGGAAGG + Intronic
943345844 2:186735549-186735571 AGGCAGTTACATTTTGAGGAAGG + Intronic
946015869 2:216603322-216603344 GGGTGAATACAGTGTGAGGAAGG + Intergenic
946904633 2:224404813-224404835 AGGTGGAGGCAGTTTGGGGAAGG - Intergenic
1170869110 20:20188360-20188382 AGGTAGATACAGTATGACCATGG + Intronic
1172942831 20:38666315-38666337 ACCTTGTTACAGTGTGAGGATGG - Intergenic
1173159093 20:40639181-40639203 AGGTTGAAGGAGTTAGAGGAAGG - Intergenic
1175655556 20:60766675-60766697 CACTTGATACAGTTAGAGGAAGG + Intergenic
1176457076 21:6923214-6923236 AAGATGATAAAGTATGAGGAAGG - Intergenic
1176835249 21:13788296-13788318 AAGATGATAAAGTATGAGGAAGG - Intergenic
949449603 3:4170947-4170969 AAGTTGAAAAAGTTTGAAGAAGG + Intronic
951084861 3:18499928-18499950 AGGTTTATACAGTTTGGGTTGGG + Intergenic
952078750 3:29731382-29731404 ATGGTGATTCAGTTAGAGGAAGG - Intronic
952838871 3:37627683-37627705 ATGCTGCTACAGTTTGTGGATGG + Intronic
953465536 3:43116128-43116150 TGCTTGATCCAGTTTGAGTAAGG + Intergenic
959294581 3:104519758-104519780 ATCTTGATACTCTTTGAGGAAGG - Intergenic
962433454 3:135342443-135342465 ATTTTGATACTTTTTGAGGAAGG - Intergenic
965034193 3:163415667-163415689 AGATTGATACTCTTTGAGGCAGG - Intergenic
967347808 3:188477963-188477985 ATTTTGATGCAGATTGAGGATGG + Intronic
967935168 3:194721656-194721678 ATGTGGACACAGTTTAAGGAAGG + Intergenic
971158424 4:24107840-24107862 AGGGTGATAGAGTTTCAGAATGG + Intergenic
971360097 4:25930132-25930154 ATGATGAGACATTTTGAGGATGG + Intergenic
975981608 4:80167003-80167025 AGGTGCATACAGATTGAAGATGG + Intergenic
976268152 4:83204739-83204761 TGGTTGATACCTTTTCAGGATGG + Intergenic
978776072 4:112508207-112508229 AGGTGGATTCAATATGAGGAAGG - Intergenic
979686762 4:123519029-123519051 AGCTTGATATAGTTAGATGAAGG - Intergenic
982936881 4:161490215-161490237 AGCATCATACAGTTTGAAGATGG + Intronic
984963579 4:185121518-185121540 GTGTTGATACAGTTTGAATATGG + Intergenic
993664510 5:90679050-90679072 AGGGTGATCAAGTTTGAGAATGG + Intronic
993940826 5:94056935-94056957 AGGCTCATACAAATTGAGGAGGG - Intronic
994656295 5:102597337-102597359 AAATTGATTCAGTATGAGGAAGG + Intergenic
994753452 5:103766449-103766471 AGGCTGATCAAGTTTGAAGAAGG + Intergenic
995033166 5:107502650-107502672 AGTTTGATACACTTCGAGCACGG - Intronic
995722036 5:115146172-115146194 AGACTGACACAGTTTGAGAAAGG + Intronic
996857111 5:128020565-128020587 AGTGTGTTACAGTTTGAGGCAGG - Intergenic
997594221 5:135095522-135095544 AGATGGAGACAGTTTCAGGAAGG - Intronic
998619993 5:143783110-143783132 AAGGTGATGCAATTTGAGGAGGG + Intergenic
998631689 5:143905592-143905614 AGTGTGATATAGTTTGAGGTTGG + Intergenic
999138591 5:149341266-149341288 AGGGTGATAAAGTTTGAGTGAGG - Exonic
999768585 5:154757715-154757737 AGGTTGCTTCATTTGGAGGAGGG + Intronic
1003512358 6:6792069-6792091 AGGTATATAGGGTTTGAGGAAGG - Intergenic
1004023361 6:11795108-11795130 ATTTTCACACAGTTTGAGGATGG - Intronic
1004408142 6:15354225-15354247 GGAGTGATGCAGTTTGAGGATGG + Intronic
1005127557 6:22465439-22465461 AGTTTGATTCAGCTTGAGGAGGG + Intergenic
1005201414 6:23348917-23348939 TGGCTGATATAGTTTGGGGAAGG + Intergenic
1007823410 6:44579156-44579178 AGGTTGAGACAGAGAGAGGAGGG - Intergenic
1007885916 6:45230139-45230161 AGCTTTATCCAGTTTGTGGATGG - Intronic
1008338562 6:50336534-50336556 AGGTTGAGAGATTTTGAGAAAGG + Intergenic
1008643295 6:53486735-53486757 TGGTTGCTAGAGTTTCAGGATGG - Intergenic
1010289204 6:74115858-74115880 AGATTCATACAGTTGAAGGAAGG + Intergenic
1010939573 6:81900433-81900455 GTGTTTATACAGTTTTAGGAGGG + Intergenic
1011216589 6:85012340-85012362 TGGTTGATACAGTCTGGGAAGGG - Intergenic
1013445221 6:110219258-110219280 TGCTTAATACATTTTGAGGAAGG - Intronic
1013767598 6:113593007-113593029 TGGGTGATACATTTTGAGGGTGG + Intergenic
1015847891 6:137540223-137540245 TGATTGACATAGTTTGAGGAGGG + Intergenic
1024329608 7:48142958-48142980 GGGTTGATACCTGTTGAGGAAGG - Intergenic
1024969935 7:55059638-55059660 TGGTTGCCACAGTTTGGGGAGGG - Intronic
1027924046 7:84436951-84436973 AGTTTAAGACTGTTTGAGGAAGG - Intronic
1028973538 7:96886834-96886856 AGATTGGTTCAGTTTGGGGAGGG - Intergenic
1028977359 7:96929020-96929042 AGGTTGAGGCAATTAGAGGATGG - Intergenic
1030105539 7:105983912-105983934 AGGGTGATGCTGTTTGAGGTGGG - Intronic
1032054512 7:128673603-128673625 AGGTGGGAACAGTTTGAGGTGGG + Intronic
1032471659 7:132183418-132183440 AAGTTAATAAAGTCTGAGGATGG - Intronic
1038848874 8:31255040-31255062 AGGAAGACACAGTTTGAGAAAGG - Intergenic
1039228277 8:35414379-35414401 AGGAAGCTACAGTCTGAGGATGG - Intronic
1041431374 8:57784476-57784498 AAGTTGATACAATTTGGGAATGG - Intergenic
1041569815 8:59324744-59324766 ATGCTGATACAGATTGAAGAGGG + Intergenic
1044040453 8:87361540-87361562 ATGTTTATATAGTTTTAGGAAGG + Intronic
1044337145 8:90999821-90999843 AGCTATATACAATTTGAGGAAGG - Intronic
1044828918 8:96225970-96225992 TGGTTGTTACAGTTGGAGGCAGG + Intronic
1047372907 8:124270813-124270835 AGGGTGGTACAGATTGAGGAAGG + Intergenic
1049652199 8:143775984-143776006 AGGTTGAAAAAAATTGAGGAGGG + Intergenic
1050547969 9:6725050-6725072 AGATTGAAACAATGTGAGGAAGG - Intronic
1051154913 9:14131761-14131783 AGGCTGCTACAGACTGAGGAAGG - Intronic
1051768147 9:20546837-20546859 AGGTGGAGACTGTTAGAGGAGGG + Intronic
1055840118 9:80493562-80493584 AGATTGAGACAGTGAGAGGATGG + Intergenic
1056035928 9:82605522-82605544 TGGTTGTTACAGGTTGGGGAAGG - Intergenic
1057272272 9:93657904-93657926 AGGGTGAGACAGTGGGAGGATGG + Intronic
1059738574 9:117127349-117127371 AGGCTGATACAGATACAGGAAGG + Intronic
1059759508 9:117324837-117324859 AGATTTAAACAGTTTAAGGAGGG + Intronic
1060846338 9:126840456-126840478 AGCTTGATGCAGTTACAGGAAGG + Intergenic
1061056705 9:128226582-128226604 AGTGTGATTCAGTTTTAGGAAGG + Intronic
1061774146 9:132949397-132949419 AGGCTGGTTCAGTGTGAGGAAGG - Intronic
1062729300 9:138100259-138100281 AGGCTGAGACCGTTTGAGAAAGG + Intronic
1187534535 X:20127863-20127885 ATTTTGATACAATTTGAGGGAGG - Exonic
1188233381 X:27695111-27695133 AGGTTAATTAAGTTTTAGGAGGG - Intronic
1188752645 X:33923036-33923058 ATCTTGATACAGGTTGAGAAGGG + Intergenic
1189205130 X:39231423-39231445 TGGAGGATACAGTGTGAGGATGG - Intergenic
1190836316 X:54104241-54104263 AGGTTGATACAGTTTGAGGAGGG - Intronic
1191648474 X:63509323-63509345 AGGTTGATCCATTTCCAGGAGGG - Intergenic
1199924497 X:152448670-152448692 AGGTTCATACAGTATGCAGAAGG - Intronic