ID: 1190845158

View in Genome Browser
Species Human (GRCh38)
Location X:54183957-54183979
Sequence CCAATTAAGAAAGACGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190845153_1190845158 15 Left 1190845153 X:54183919-54183941 CCCTTAGTGGAAAGATAATATTT No data
Right 1190845158 X:54183957-54183979 CCAATTAAGAAAGACGTAACTGG No data
1190845152_1190845158 16 Left 1190845152 X:54183918-54183940 CCCCTTAGTGGAAAGATAATATT No data
Right 1190845158 X:54183957-54183979 CCAATTAAGAAAGACGTAACTGG No data
1190845154_1190845158 14 Left 1190845154 X:54183920-54183942 CCTTAGTGGAAAGATAATATTTA No data
Right 1190845158 X:54183957-54183979 CCAATTAAGAAAGACGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190845158 Original CRISPR CCAATTAAGAAAGACGTAAC TGG Intergenic
No off target data available for this crispr