ID: 1190850897

View in Genome Browser
Species Human (GRCh38)
Location X:54240507-54240529
Sequence ATGTAGTAACTGGATCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190850895_1190850897 6 Left 1190850895 X:54240478-54240500 CCACTGAAATTACAGAAAAGAAT 0: 1
1: 0
2: 3
3: 64
4: 759
Right 1190850897 X:54240507-54240529 ATGTAGTAACTGGATCAAGATGG 0: 1
1: 0
2: 0
3: 9
4: 154
1190850894_1190850897 7 Left 1190850894 X:54240477-54240499 CCCACTGAAATTACAGAAAAGAA 0: 1
1: 1
2: 3
3: 110
4: 949
Right 1190850897 X:54240507-54240529 ATGTAGTAACTGGATCAAGATGG 0: 1
1: 0
2: 0
3: 9
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190850897 Original CRISPR ATGTAGTAACTGGATCAAGA TGG Intronic
901108872 1:6779436-6779458 ATGTAATAGCTGGATGATGAGGG + Intergenic
908045597 1:60164761-60164783 ATGTATTAACTAGATCAACTGGG - Intergenic
909503913 1:76365914-76365936 ATGTAGGAACTGGAAGGAGATGG - Intronic
909889153 1:80981219-80981241 ATGAAGAAACTGTATCAAAAAGG + Intergenic
911803948 1:102181062-102181084 AGGTAGTAACTGGAGGATGAAGG - Intergenic
911991289 1:104699845-104699867 ATGTAGTAAATGGATATAAATGG - Intergenic
912327145 1:108777330-108777352 ATGAAGTAACATGATAAAGAGGG + Intronic
913185421 1:116366315-116366337 ATGTAGTAACTGTTCAAAGAGGG - Intergenic
914874509 1:151502757-151502779 AGGTAGTCTCTGGAACAAGATGG - Intergenic
915826130 1:159078856-159078878 CTGTAGCAACTGGCCCAAGAAGG + Intronic
917202201 1:172529674-172529696 AGGTAGTAACTAAATAAAGAAGG + Intergenic
918574372 1:186038815-186038837 ATGTAATAACTGAAAGAAGAAGG - Exonic
922011864 1:221596819-221596841 ATATAGTAATTGGATCCTGAGGG + Intergenic
922357437 1:224789626-224789648 ATGAAGCAACTGGAGGAAGAGGG + Intergenic
1063471831 10:6293963-6293985 ATGAAGCCATTGGATCAAGATGG - Intergenic
1066329862 10:34409161-34409183 ATGTTGTATATGTATCAAGACGG - Intronic
1070874405 10:79789162-79789184 ATTAAGTAACTAGATCCAGAAGG + Intergenic
1075028373 10:119003749-119003771 GTGTAGTAACTGGACCCAGCTGG - Intergenic
1076122122 10:127944604-127944626 AGGCAGAAACTGGATCATGAAGG + Intronic
1080374215 11:31688577-31688599 ATGTAGTAAATAGAACAAGAAGG + Intronic
1084057693 11:66647170-66647192 CTGTAGAAACTGGAGCAAGAAGG - Intronic
1085206138 11:74733078-74733100 ATGTAAGAAGTGGATTAAGATGG + Intergenic
1085366610 11:75952635-75952657 ATAAAGCAACTGGATCAAGTGGG - Intronic
1086261671 11:84947351-84947373 CTGCAGTAACTGGCTCAAAATGG + Intronic
1086527206 11:87741592-87741614 CTGTAGAAACAGGGTCAAGAGGG - Intergenic
1086762652 11:90652218-90652240 ATTAAGTAACTTGATCAAGTTGG - Intergenic
1086775253 11:90823092-90823114 GGGTTGTAGCTGGATCAAGAGGG - Intergenic
1086915581 11:92526450-92526472 AAGTAGCAATGGGATCAAGATGG - Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087901564 11:103647266-103647288 AGGAAGTGACTGGATCATGAAGG - Intergenic
1095503530 12:42867262-42867284 ATGTAGTAGCTAGATTATGAGGG + Intergenic
1096932472 12:55228152-55228174 ATGTAGTATTTGGATCCAGAAGG - Intergenic
1097046829 12:56193194-56193216 ATGGAGGATCTGGACCAAGAAGG + Intergenic
1101804695 12:108053155-108053177 ATTTAGAAAATGAATCAAGATGG + Intergenic
1108294138 13:48996227-48996249 CAGTAGCAACTGTATCAAGATGG - Intronic
1108598860 13:51973410-51973432 AAGAAGTGACTGGATCATGAGGG + Intronic
1108820328 13:54341674-54341696 ATGTAGTAACTGCTTCAAAAGGG + Intergenic
1110761246 13:79232838-79232860 AGGGAGTAACTGGATGCAGATGG - Intergenic
1110870819 13:80450740-80450762 AAGAAGTGACTGGATCATGAAGG - Intergenic
1113203284 13:107889853-107889875 ATCCAGGAACTGAATCAAGAGGG + Intergenic
1119847143 14:77839126-77839148 ATGTAGTCATGGGATAAAGAGGG + Intronic
1120168272 14:81222760-81222782 TTGTAGTTACTGGATTAAAATGG + Intergenic
1121382254 14:93482955-93482977 ATGTAGTAATTGAAACAGGAAGG - Intronic
1126355837 15:47795186-47795208 ATGTAGTAATTGAATCTAGTTGG + Intergenic
1128607057 15:69044630-69044652 ATGTAGTAAGTGGAAAAAGCAGG + Intronic
1131622755 15:94084463-94084485 AAGGAGAAACTGGATAAAGATGG - Intergenic
1134224184 16:12378950-12378972 CCGTAGTAACTGGTTCAGGATGG - Intronic
1135167250 16:20149933-20149955 ATGTAGTGACTGGATGTTGAAGG + Intergenic
1136715315 16:32276978-32277000 CTCTCTTAACTGGATCAAGAAGG + Intergenic
1136752600 16:32652751-32652773 CTCTCTTAACTGGATCAAGAAGG - Intergenic
1136821991 16:33327690-33327712 CTCTCTTAACTGGATCAAGAAGG + Intergenic
1136828554 16:33384229-33384251 CTCTCTTAACTGGATCAAGAAGG + Intergenic
1136833620 16:33483003-33483025 CTCTCTTAACTGGATCAAGAAGG + Intergenic
1138389429 16:56659232-56659254 ATGTAGCAAATGGGTCAAGGTGG - Exonic
1202994092 16_KI270728v1_random:40586-40608 CTCTCTTAACTGGATCAAGAAGG + Intergenic
1203011296 16_KI270728v1_random:241519-241541 CTCTCTTAACTGGATCAAGAAGG - Intergenic
1203054739 16_KI270728v1_random:912791-912813 CTCTCTTAACTGGATCAAGAAGG - Intergenic
1143419715 17:6779241-6779263 ATGGAGGAACTGGATCACGTGGG - Intronic
1148318414 17:46725480-46725502 AGGAAGGAACTGAATCAAGATGG + Intronic
1149947600 17:60947505-60947527 ATGTATTTACTGGGTCAAAACGG - Intronic
1150836896 17:68572488-68572510 TAGTAGTAACTGGGCCAAGAAGG + Intronic
1155607690 18:27626133-27626155 AAGAAGTGACTGGATCATGAGGG + Intergenic
1156782295 18:40865366-40865388 ATGAAGTGACTGGTTCATGAGGG - Intergenic
1159556122 18:69946682-69946704 ATGTTGTAAGTGGATAAAAAGGG + Intronic
1160327090 18:77960511-77960533 ACGTAGTAACTCCATCAGGAAGG - Intergenic
1166001736 19:39881548-39881570 ATGTAGTAACTGTACGAACAGGG - Intronic
1166004518 19:39897799-39897821 ATGTAGTAACTGTACGAACAGGG - Intronic
1166177223 19:41082708-41082730 ATGTAGAAAGGTGATCAAGATGG - Intergenic
925237682 2:2293612-2293634 AAGTAGTAACTGGTATAAGATGG + Intronic
925893728 2:8456210-8456232 ATGAAGTATCTTGATAAAGAAGG + Intergenic
931166674 2:59756292-59756314 ATATAGTAATAGGTTCAAGAGGG + Intergenic
932202327 2:69841697-69841719 ATTTAGTGAATGGATAAAGAAGG + Intronic
937371762 2:121303096-121303118 ATGTAGCCACTGCATCAACATGG + Intergenic
938027179 2:127959884-127959906 ATGTAATAACTGAAATAAGACGG + Intronic
938636314 2:133230592-133230614 GTGTTATTACTGGATCAAGAAGG - Intronic
938943176 2:136187130-136187152 ATGGAGCAACTGGCTCAAGTAGG + Intergenic
939017214 2:136916717-136916739 ATGAACTATCTGGATCAAAAAGG - Intronic
1173321740 20:41993626-41993648 AAGTAGAAACTGGAAAAAGAGGG + Intergenic
1174119542 20:48252374-48252396 ATGTTCTAACTGGATCATGCTGG - Intergenic
1175437202 20:58961845-58961867 ATGGAGTGACTGGTTCAGGATGG - Intergenic
1175796093 20:61771919-61771941 GTGGAGTTACTGGATCAAAAGGG + Intronic
1177865506 21:26508260-26508282 AGGCAGGAACTGGATCATGAGGG + Intronic
1178384112 21:32135480-32135502 ATGTAGAAACCGGAGCAAGCTGG - Intergenic
1179337678 21:40473376-40473398 AGGCAGTAACTAAATCAAGAGGG + Intronic
1180617659 22:17138971-17138993 ATTAAGTAACTTGTTCAAGAGGG + Intronic
1180683446 22:17645824-17645846 ATATGGAAACTGGATAAAGAGGG - Intronic
1182765524 22:32755256-32755278 ATGAAATTACTGGTTCAAGATGG + Intronic
949269806 3:2201522-2201544 AAGTAGTCACTGGAGGAAGAAGG - Intronic
950772437 3:15323226-15323248 TTGTAGTCACTGGATCAGCAGGG - Intronic
953179261 3:40581337-40581359 ATGTAAGAACAGAATCAAGAGGG + Intergenic
953202611 3:40790889-40790911 AAGTAATAACTGGATCATGTGGG + Intergenic
956430507 3:69181333-69181355 ATGTAGTAACTGGAAGACGGTGG + Exonic
957716612 3:83936373-83936395 ATGAAGTGATTGGATCATGAGGG + Intergenic
962455198 3:135558685-135558707 ATGAAGTAAATGGATCATGTAGG - Intergenic
964013177 3:151915144-151915166 GTGAGGTAACTGGATCATGAGGG + Intergenic
964250045 3:154703625-154703647 ATGTAGTAACCAGATCAATTAGG + Intergenic
965045997 3:163577288-163577310 ATTTAATAACTGGATGACGAGGG - Intergenic
965553069 3:169989500-169989522 GTGTAATACCTGCATCAAGAAGG + Intronic
965568307 3:170145060-170145082 ATGTAATAACTAAGTCAAGATGG - Intronic
970111928 4:12647263-12647285 ATGTTCAAACTGGATAAAGAAGG + Intergenic
971406489 4:26325299-26325321 ATGTAGAAGCTGGATAAAGGTGG - Intronic
972223521 4:36984436-36984458 ATGGAATTACTGGATCAATACGG - Intergenic
972313039 4:37899178-37899200 AGGTAGTAATAGGATGAAGAAGG + Intronic
976607874 4:86999448-86999470 CTGTTGTAACTGCATCCAGATGG + Intronic
979676352 4:123414077-123414099 ATGTAATGACTGGATTAGGAGGG - Intergenic
980805981 4:137813971-137813993 ATCAAGTCACTGGATAAAGATGG - Intergenic
981080353 4:140633997-140634019 ATCTAATAACTGGAACAAGCGGG + Exonic
982471540 4:155797249-155797271 ATGTAGTAACACAGTCAAGAAGG + Intronic
982658629 4:158179250-158179272 ATGTAGAAACCGGAAAAAGAAGG + Intergenic
984480945 4:180301223-180301245 ATGTAATAACTGTATTAAAAAGG - Intergenic
985663176 5:1167541-1167563 AGGAAGCACCTGGATCAAGAAGG - Intergenic
986671200 5:10144593-10144615 AAGAAGTAATTGGATCATGAGGG + Intergenic
986942058 5:12965745-12965767 ATGTAGTAAGTGGCTCAAAATGG + Intergenic
989735184 5:44694948-44694970 ATGTATTAACTGGGTAAAGATGG + Intergenic
990501357 5:56399616-56399638 AGGTAGTAACTGGGTACAGATGG + Intergenic
991122964 5:63037046-63037068 AGATAGTCACTGGATCAAGATGG - Intergenic
992791838 5:80220774-80220796 AAGTAGTAACTGGAAAAAAAAGG + Intronic
993918836 5:93774540-93774562 ATGTAAGAACTGAAACAAGAAGG - Intronic
994336385 5:98571281-98571303 ATGTAGTCACTTGATCTACAAGG + Intergenic
994516724 5:100781854-100781876 ATGTAGAAATTGGCTCATGATGG + Intergenic
994596701 5:101847186-101847208 AAGAAGTAATTGGATCATGAGGG + Intergenic
994880107 5:105480349-105480371 TTATAGTAACTGAATCAATATGG + Intergenic
999896969 5:156045036-156045058 ATGGAATAACTGTAGCAAGAAGG - Intronic
1002350688 5:178581613-178581635 GTGGAGTAACTGGATACAGAAGG - Intronic
1002978756 6:2112948-2112970 AAGTAGTAACTGGAGAAAGACGG - Intronic
1005233245 6:23729211-23729233 ATATAGAAAATGTATCAAGATGG + Intergenic
1007596313 6:43053355-43053377 CTGGAGCAACTGGAACAAGAGGG + Intronic
1011717933 6:90126462-90126484 ATTTAGTTACGGGATGAAGAGGG + Intronic
1012761494 6:103308863-103308885 GTGGAGTAGATGGATCAAGATGG + Intergenic
1013252957 6:108352924-108352946 ATGTAGAAACTAGATACAGAGGG + Intronic
1014080392 6:117280418-117280440 AGGTAGCAACTGGAAGAAGATGG - Intergenic
1017123122 6:151042826-151042848 ATGTAGTAATTTGATCTATATGG - Intronic
1020541921 7:9469424-9469446 GGGGAGTAACTGGATCATGAAGG + Intergenic
1020758457 7:12237039-12237061 ATGTAGTAAGTGTGTCATGATGG - Exonic
1027693982 7:81385711-81385733 ATTTAGTAAATGTATCAAAATGG + Intergenic
1027899144 7:84086836-84086858 ATGAAGTAATTGGGTAAAGAAGG - Intronic
1029602247 7:101574357-101574379 AGGAGGTAACTGGATCATGAGGG - Intergenic
1031044217 7:116869445-116869467 ATTTAGTAAATGAATGAAGATGG - Intronic
1031526307 7:122825111-122825133 GTGCAGTAACTGGATGAGGAGGG + Intronic
1031658486 7:124389485-124389507 ATGGAATAACTGGATTTAGATGG - Intergenic
1034241393 7:149613932-149613954 ATCTAGTCCCTGGTTCAAGATGG - Intergenic
1034246393 7:149647803-149647825 AAGTAGTCCCTGGTTCAAGATGG - Intergenic
1035550001 8:514924-514946 ATGAAGGAATTGGATCATGATGG + Intronic
1036232949 8:7014864-7014886 AACTATGAACTGGATCAAGATGG - Intronic
1039634473 8:39148102-39148124 ATGTCTTAACAGGATCAATATGG - Intronic
1043085741 8:75828923-75828945 ATGAAGTCACTGAATCAACAGGG + Intergenic
1043667542 8:82835585-82835607 ATGTTGTAATAGGATCCAGAGGG - Intergenic
1046511662 8:115211831-115211853 AAGAAGTGACTGGATCATGAAGG + Intergenic
1047981192 8:130184405-130184427 AGGGACTAACAGGATCAAGAGGG + Intronic
1050378681 9:5000792-5000814 AAGTAAGAACTGGATAAAGAAGG + Intronic
1054791661 9:69262143-69262165 ACATAGTAACTGGACCTAGAAGG - Intergenic
1054975249 9:71136243-71136265 ATGTAGCTAGTGGCTCAAGAAGG + Intronic
1055535069 9:77232779-77232801 GGGAGGTAACTGGATCAAGAGGG - Intronic
1056801355 9:89694276-89694298 ATGCAGAAACTGGATGAACAGGG + Intergenic
1185848680 X:3464900-3464922 AGGAGGTAACTGGATCATGACGG - Intergenic
1186518971 X:10188734-10188756 ATGTAGTAAGTGGTCTAAGAAGG + Intronic
1189020474 X:37332418-37332440 ACGTAGTAAGTGGATGGAGAGGG - Intergenic
1190477068 X:50839091-50839113 CTGTAGTCGCTGGATCAAGTTGG + Intergenic
1190850897 X:54240507-54240529 ATGTAGTAACTGGATCAAGATGG + Intronic
1192041246 X:67624138-67624160 AGGAAGTAATTGGATCATGAGGG - Intronic
1193382419 X:80830799-80830821 ATAGAGAAACTGGAGCAAGATGG + Intergenic
1194997629 X:100609091-100609113 ATGTAGACACTGGGTAAAGAAGG - Intergenic
1198527852 X:137520120-137520142 ATGTAGAAAATAGATCAAGGCGG + Intergenic
1199871038 X:151899267-151899289 ATGTAGCAAGTGGATGAAGCAGG + Intergenic