ID: 1190856349

View in Genome Browser
Species Human (GRCh38)
Location X:54298714-54298736
Sequence CTACTTCTCCAGTTCTCACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190856349_1190856350 -7 Left 1190856349 X:54298714-54298736 CCTAGTGAGAACTGGAGAAGTAG 0: 1
1: 0
2: 2
3: 13
4: 173
Right 1190856350 X:54298730-54298752 GAAGTAGCTTAGTACATGTTAGG 0: 1
1: 0
2: 0
3: 12
4: 115
1190856349_1190856351 14 Left 1190856349 X:54298714-54298736 CCTAGTGAGAACTGGAGAAGTAG 0: 1
1: 0
2: 2
3: 13
4: 173
Right 1190856351 X:54298751-54298773 GGCAAATTTCCCTAAGCCACTGG 0: 1
1: 0
2: 0
3: 12
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190856349 Original CRISPR CTACTTCTCCAGTTCTCACT AGG (reversed) Intronic
902848901 1:19137409-19137431 CTATTTCTCTAGTTATCTCTGGG + Intronic
903754902 1:25653833-25653855 CATCTTCTCCAGTTCTCAACTGG + Intronic
904059512 1:27697063-27697085 ATACTTCTCCAGCTCTCTATTGG - Intergenic
905552963 1:38859080-38859102 CGTACTCTCCAGTTCTCACTTGG - Intronic
907914939 1:58860205-58860227 CCACAGTTCCAGTTCTCACTGGG - Intergenic
909018254 1:70403167-70403189 CTTCTTCTCCTGCTCTCCCTTGG + Intergenic
909031017 1:70540236-70540258 TTACTTTGCCAGTTCTCATTTGG - Intergenic
912245314 1:107956032-107956054 CTGCATCATCAGTTCTCACTTGG - Intronic
912485566 1:110024832-110024854 CTACATCCCCAGTTCCCACAAGG - Intergenic
915729380 1:158042357-158042379 CTATTGCTTCAGTTTTCACTGGG + Intronic
915872641 1:159577449-159577471 GTACTTCTCCCGTTGTCACCTGG + Intergenic
916386703 1:164281317-164281339 ATTTTTCTCCAGTACTCACTAGG - Intergenic
919247414 1:195005951-195005973 CTGCTTTTCCAGTTCTGCCTTGG + Intergenic
920082076 1:203382203-203382225 CTCCTCCTCCCCTTCTCACTAGG + Intergenic
923782080 1:237033694-237033716 CAACTTCTACAGTTCTTAGTTGG - Intergenic
1063560763 10:7124649-7124671 CTTCTTATCAAGTTATCACTAGG - Intergenic
1065849006 10:29771240-29771262 CTGCTGATCCAGTTCTCACTGGG - Intergenic
1070105043 10:73423714-73423736 CTACTTTTCCTGTTTTCTCTTGG - Exonic
1070835411 10:79444639-79444661 CTTCTCCTGCTGTTCTCACTCGG - Intronic
1073090105 10:100929377-100929399 CTTCTTCTCCAATTCTGATTGGG - Exonic
1073485859 10:103818810-103818832 CCCCTTCTCCAGACCTCACTGGG + Intronic
1075289999 10:121221041-121221063 CTACATTTTCAGTTTTCACTGGG - Intergenic
1078615280 11:12859554-12859576 CTACTTCTCCATCTCTCAGATGG - Intronic
1078921760 11:15837267-15837289 CTACTTCTCCAGCTACCACCTGG - Intergenic
1080060639 11:27953005-27953027 CAATTTCTCCAATTCTCACTTGG + Intergenic
1082095602 11:48126990-48127012 CCACTGCCCCAGCTCTCACTGGG - Intronic
1084947616 11:72647097-72647119 CTTCTTCACCAGAGCTCACTGGG - Intronic
1085888452 11:80548637-80548659 GTACTGCTCCAGTTCTCAAGGGG - Intergenic
1086220413 11:84436613-84436635 CTAATTCTCCAGTGCTTTCTGGG - Intronic
1087035068 11:93747172-93747194 CCACTTGTCTATTTCTCACTTGG + Intronic
1088438498 11:109841695-109841717 CTTCTTCTCTTGTTCTCTCTTGG - Intergenic
1088973226 11:114791696-114791718 CTGTTTCTCCAGTTCACCCTTGG - Intergenic
1089530254 11:119123383-119123405 TTACTTCTCCAGTTCTAGGTAGG - Intronic
1089603558 11:119628959-119628981 TTTCTTCTCCTGTTCTCACCAGG + Intronic
1092056238 12:5510468-5510490 TTTCTTCTCCAGGCCTCACTGGG + Intronic
1095142503 12:38682962-38682984 CTCCTTTTCCAGTGCTCTCTGGG - Intronic
1096436200 12:51592199-51592221 CCTCCTCTCTAGTTCTCACTTGG + Intronic
1096666977 12:53172426-53172448 CTCCTTCTCCAGGTCACCCTCGG - Exonic
1098698994 12:73598609-73598631 CTAATTCTTCAGTTCTGTCTTGG + Intergenic
1102384685 12:112498399-112498421 CTACTTGTCCAGTGCACTCTGGG - Intronic
1106121785 13:26865748-26865770 CGCTGTCTCCAGTTCTCACTGGG + Intergenic
1106130735 13:26937308-26937330 CTGCTTCACCAGGTCCCACTGGG + Intergenic
1106196328 13:27497341-27497363 CTACTTAGCTAATTCTCACTGGG - Intergenic
1108342027 13:49506598-49506620 CCACTTTTCCATTTCTCACCAGG + Intronic
1109240777 13:59884514-59884536 CTAATTCTTCAGTTCTCTATGGG + Intronic
1110021105 13:70474507-70474529 CTACTTCTGCAGGTCTCCCATGG + Intergenic
1114385218 14:22247229-22247251 CTCCTCCTCCAGTTCACACATGG - Intergenic
1114996957 14:28365583-28365605 CTATTTTTCCAGTACTCTCTAGG + Intergenic
1116799277 14:49426429-49426451 CCATTTCTCCAGATCTCACAGGG + Intergenic
1117101785 14:52355949-52355971 TTACTTCTCCAGTTCCCCATTGG + Intergenic
1119076840 14:71648610-71648632 GTACTGCCCCAGATCTCACTGGG - Intronic
1120204751 14:81575404-81575426 CTAATGCTCCAGTGCTTACTGGG + Intergenic
1120626761 14:86837029-86837051 CTGCTTCTGCAGATCTCTCTTGG + Intergenic
1121822185 14:96979940-96979962 GTCCTTCTCCAGTTCGCACGCGG - Intergenic
1130389850 15:83446222-83446244 TTACTTGCCCAGTCCTCACTAGG + Intergenic
1133872710 16:9704336-9704358 CTCAATCTCCACTTCTCACTGGG - Intergenic
1134074252 16:11279576-11279598 GTCCTTCCCCAGATCTCACTGGG + Intronic
1135349038 16:21713354-21713376 ATCCTGCTCCAGTTCCCACTTGG - Intronic
1135571274 16:23551240-23551262 CAGCTCCTCCAGTTCCCACTTGG + Intronic
1137224235 16:46487115-46487137 TGACTTCTTCAGTTCTTACTTGG - Intergenic
1137940022 16:52674931-52674953 ATCCTTCCCCAGTCCTCACTGGG - Intergenic
1140054739 16:71516099-71516121 CAACTTCTCCAGTGCGCAGTCGG - Intronic
1141595750 16:85095867-85095889 CTCCTTCTCCACTGGTCACTTGG - Intergenic
1142329206 16:89440141-89440163 CTACTTCTCCAGTCCTCAAGGGG + Intronic
1148568588 17:48648113-48648135 ATATTTCAACAGTTCTCACTTGG - Intergenic
1149116278 17:53100305-53100327 CTACTTCTCATATTCTCATTTGG + Intergenic
1150702756 17:67462009-67462031 CTTCTGCTCCAGGTCTCTCTGGG + Intronic
1153532250 18:6058974-6058996 CTGCTTCTCCGGTTGTCTCTGGG + Intronic
1155088891 18:22486684-22486706 CTTCTGCTCCAGTTGTCAATGGG + Intergenic
1155813575 18:30272611-30272633 CTACTGTGCAAGTTCTCACTGGG + Intergenic
1156541764 18:37919026-37919048 CTACATCACTAGTTCTCAATGGG - Intergenic
1158225126 18:55192866-55192888 CTCCTTCTACAGTTCTCACCAGG - Intergenic
1160099099 18:75904066-75904088 CTGCTTCTCCAGTTATCTCTGGG + Intergenic
1160625497 18:80201555-80201577 CTGCATCTGCAGTTCTCACTGGG - Intronic
1163229363 19:15989840-15989862 CAACTTCCCCACTTCCCACTTGG + Intergenic
1164726386 19:30468563-30468585 CGACTTGTCCAGATGTCACTTGG + Intronic
1165090565 19:33386054-33386076 CTGCTTGTCCAGTTCTCCCAGGG - Intergenic
928199515 2:29238564-29238586 CTCCATCTCCAGTTCTCACTAGG - Intronic
930413660 2:51061442-51061464 TTACTTCTCCCTTTCTGACTTGG - Intergenic
930766342 2:55089448-55089470 CTACTTCTACAGTTCTTTCTAGG + Intronic
931487064 2:62704926-62704948 ATCCATCTACAGTTCTCACTAGG + Intronic
931620127 2:64201325-64201347 CTCCTTCTGCATTTCTCCCTAGG + Intergenic
932095614 2:68845877-68845899 CTATTTCTCGATTTCTCATTAGG - Intergenic
935656776 2:105430011-105430033 CTAGTTCTGCTGTTCACACTGGG - Intronic
936413925 2:112286835-112286857 ATGCTTCTCCAATTCTCCCTTGG - Intronic
939385497 2:141491478-141491500 CTACTTTACCTGTTCTAACTGGG + Intronic
941736274 2:168980454-168980476 CTACTATTCCAGTAGTCACTGGG + Intronic
942925304 2:181425344-181425366 CTACATCTACAGCTCTCTCTAGG + Intergenic
946048475 2:216841126-216841148 CTACTATTCCAGCTCTCACTGGG - Intergenic
946332703 2:219019270-219019292 CAGATTCTCCAGTTCCCACTTGG - Intronic
947485696 2:230546697-230546719 CTAGTTCTCTATTTCTCACCTGG - Intergenic
948195737 2:236094644-236094666 AAATTTCTCCAGCTCTCACTGGG - Intronic
948289029 2:236810809-236810831 TTATTACTCCACTTCTCACTTGG + Intergenic
1173629107 20:44496829-44496851 TTCCTTCTCCATTCCTCACTTGG + Intronic
1175689724 20:61056697-61056719 CTGCTTCTCGAGTTCTAACCAGG - Intergenic
1177804445 21:25860269-25860291 CTTGTTCTCCATTTCTCAGTGGG - Intergenic
1179619061 21:42600529-42600551 CAGCTTGTCCAGTTCTCTCTGGG + Intergenic
1183058006 22:35318832-35318854 TTCCCTCTCCAGTTCTCACTGGG + Intronic
1183371272 22:37433796-37433818 CTCCTCCTCCAGCTCTCCCTGGG - Intergenic
1183779911 22:39992808-39992830 CTTCTTACCCAGTTCCCACTGGG + Intergenic
952432336 3:33235828-33235850 CTACTTCTCGACTTCTTACTTGG - Intergenic
953434905 3:42870683-42870705 CAACTTCTACACTTCTCCCTAGG - Intronic
955097693 3:55815981-55816003 CTGCTCCACCAGTTCTCACCTGG + Intronic
955673757 3:61428906-61428928 CTTCTGCTCACGTTCTCACTTGG + Intergenic
955749742 3:62175829-62175851 CTTCTTCTCCAGATCTCTGTGGG - Intronic
955921505 3:63961506-63961528 CTACTTCAGCAGTTCTGATTTGG + Intronic
955993511 3:64654058-64654080 CCATTTCTCCAGTTCCCAGTAGG + Intronic
956614061 3:71153269-71153291 CCACTTCTCCCCATCTCACTGGG - Intronic
960000133 3:112722779-112722801 CTACTGCTCCCTTTCCCACTGGG - Intergenic
960490039 3:118306169-118306191 CCACTTCTCCAATTCTTATTAGG - Intergenic
961585760 3:127921996-127922018 CACCTTTTCCAGTTCTAACTTGG - Intronic
964327003 3:155557859-155557881 TGACTTCTCCAGTTATCTCTGGG - Intronic
967811976 3:193768195-193768217 CTATTACTCCAGCTCTCCCTTGG - Intergenic
969073472 4:4558467-4558489 CTCCTTCTCCAGGTCACACTTGG - Intergenic
974817952 4:67030335-67030357 CTACTTTTCAAGTGCTCACAAGG - Intergenic
978074672 4:104513756-104513778 CTACTTCTCCTATTCTCAGAGGG + Intergenic
978824263 4:113001878-113001900 TTATTTCTCCAGTCCTGACTAGG + Intronic
979000897 4:115217556-115217578 ATTCTTCTCCATCTCTCACTAGG - Intergenic
979798223 4:124874151-124874173 CAAATTCCCCAGTTCTCTCTTGG - Intergenic
979846539 4:125520293-125520315 CTGCTTCTCCAGTTCTCTCTCGG + Intergenic
980208384 4:129752684-129752706 GTACTTCTGGAGTTCTGACTGGG + Intergenic
980252377 4:130334747-130334769 CTACTTCCCAAGTCCTTACTTGG - Intergenic
982846992 4:160266497-160266519 CAATTTCTCCTGTTCTCATTTGG + Intergenic
984622877 4:181973870-181973892 CTTCTTCTCCAGTTATCTCCTGG - Intergenic
984891727 4:184499961-184499983 CTACTTCTCCAGCTTACACATGG - Intergenic
985673307 5:1217546-1217568 CTGCTTCTCCAGTGGCCACTGGG + Intronic
985684540 5:1274995-1275017 TTCCTTCTCCAGGTCTCGCTAGG - Intronic
986372369 5:7092821-7092843 CTTCCTCTCCAATTCTCTCTTGG - Intergenic
989952818 5:50320849-50320871 ATTCTTTTCCAGTTCTCTCTGGG - Intergenic
992413320 5:76528996-76529018 CTTCTTCTCCAGTTACAACTTGG - Intronic
992850647 5:80804341-80804363 CTAATTCTTCAATGCTCACTGGG - Intronic
995354532 5:111223739-111223761 CTTTTCCTCCAGCTCTCACTGGG + Intronic
997721957 5:136085477-136085499 CTACTTCTTCCTTTCTCAATTGG - Intergenic
998678181 5:144433960-144433982 CCACTTCTCGAGTTCTTTCTGGG - Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1000446966 5:161333671-161333693 CTACTTCCCCTGAACTCACTTGG + Intronic
1005251149 6:23947716-23947738 CTACTTCTCGATTTCTGATTTGG - Intergenic
1006279543 6:33038544-33038566 CTACTTCTCTGCCTCTCACTGGG + Intergenic
1008046884 6:46860134-46860156 CTAAGTCTTCAGCTCTCACTGGG + Intronic
1011707837 6:90020717-90020739 CTGCTTCTCCTGTTTCCACTAGG + Intronic
1013126087 6:107185983-107186005 CAACTTCTGCAGTTTTAACTAGG + Intronic
1015166108 6:130201898-130201920 TTACTTCTCCATTTCTCTTTTGG + Intronic
1016783116 6:147981874-147981896 CCACTTCTCCAGCTATCAATGGG + Intergenic
1017422220 6:154284402-154284424 CTAGTTCTCCTCTTCTCCCTCGG + Intronic
1018650297 6:165987035-165987057 GCCCTTCTCCAGTTCTCAGTGGG - Intergenic
1023914070 7:44575417-44575439 CCAATTCCCCAGCTCTCACTGGG - Intergenic
1024927969 7:54637874-54637896 TTACGTCTCCCCTTCTCACTGGG - Intergenic
1025163578 7:56689378-56689400 TTAGTTCTCCACTTCTCATTTGG - Intergenic
1025706736 7:63873063-63873085 TTAGTTCTCCAGCTCTCATTTGG + Intergenic
1027898483 7:84077150-84077172 TTACTTTACCAGGTCTCACTGGG - Intronic
1030052436 7:105550554-105550576 TTTCTTCTCCAGTTCTAAATAGG + Intronic
1032887194 7:136153376-136153398 GTACTTCTCCATTTCCCAGTAGG + Intergenic
1033234198 7:139625241-139625263 CTATTTCTTCACCTCTCACTTGG + Intronic
1034233472 7:149550711-149550733 CCACTTCCTCAGATCTCACTTGG + Intergenic
1035020558 7:155797709-155797731 CTCCTTCTGCAGTTCCAACTCGG - Intergenic
1035447415 7:158952283-158952305 CTGCTCCTCCCGTGCTCACTGGG - Intronic
1036530518 8:9581944-9581966 CTACTTCCTCAGTTCACAGTAGG + Intronic
1038888924 8:31696495-31696517 GTACTTCCACAGTGCTCACTGGG + Intronic
1038939562 8:32288950-32288972 ATAACTCTCCAATTCTCACTAGG + Intronic
1041135790 8:54757467-54757489 TCACTTCTCCAGTGCTTACTGGG - Intergenic
1041189347 8:55337819-55337841 CTACTTATCCTGTTCTCAAAAGG - Intronic
1044620898 8:94190012-94190034 CTACTACTCCAGTCTTGACTTGG - Intronic
1045506624 8:102783149-102783171 CTGGTTCTCCAGTTCTCAACTGG - Intergenic
1046349537 8:112989309-112989331 CTTCCTATCCAGTTATCACTTGG + Intronic
1047810654 8:128405312-128405334 CTACTTCTCCAGTTCTCTGGAGG - Intergenic
1048474956 8:134734604-134734626 CTGCTTCTCCAGTGCTCCCCTGG - Intergenic
1048667995 8:136685990-136686012 CTAATTCTTCATTTCTGACTTGG - Intergenic
1049926131 9:409215-409237 CTACAGCTCCAGTTTCCACTGGG + Intronic
1050753952 9:8976938-8976960 CTACTTCTCCATTTGTCTGTTGG + Intronic
1051210609 9:14738576-14738598 CTATTTCTGCAGTGCTCAGTGGG - Intronic
1051386974 9:16519653-16519675 CTACTTGTGGAGTTCTCATTAGG + Intronic
1053282966 9:36833008-36833030 CTACTTCTTCAGTTCCCAAATGG - Intergenic
1054913461 9:70475050-70475072 CTGAGTCTCCAGTTCTCATTAGG + Intergenic
1055613349 9:78045344-78045366 CTCCTTCTCAAGCTCTCAGTTGG - Intergenic
1055664419 9:78539146-78539168 CCACAGCTCCTGTTCTCACTGGG - Intergenic
1055741108 9:79390584-79390606 TTACTTCTCCCTTTCTTACTGGG - Intergenic
1056607718 9:88100224-88100246 ACCCTTCTCCAGTCCTCACTGGG - Intergenic
1059133177 9:111776755-111776777 CTACTCCTGTAGTTCTTACTAGG + Intronic
1059224506 9:112659511-112659533 CTACTTCTCCCTTTCTGACGAGG + Exonic
1059226180 9:112675162-112675184 CTTCTTCTTCAGTTCTCATCTGG + Intergenic
1060129460 9:121081065-121081087 CTACCTCTCCAGATTTCTCTTGG + Intronic
1060423080 9:123483363-123483385 CTGCTGCTCCAGTCCTCCCTTGG + Intronic
1187065403 X:15831986-15832008 CTACTTTTCCAGTTTTTATTGGG - Intronic
1190856349 X:54298714-54298736 CTACTTCTCCAGTTCTCACTAGG - Intronic
1192268230 X:69555273-69555295 CTCCCTCTCAAGTGCTCACTAGG - Intergenic
1193660824 X:84255746-84255768 ACACTTCTTCAGTTCTCACTGGG + Intergenic
1194701000 X:97113375-97113397 CTATTTCTTCAGTACTCACATGG - Intronic
1198371264 X:135991586-135991608 CTGCTTCATCACTTCTCACTTGG + Intronic
1198961981 X:142193132-142193154 CTACTTCTGTAGTTCCCTCTGGG - Intergenic