ID: 1190862618

View in Genome Browser
Species Human (GRCh38)
Location X:54358595-54358617
Sequence TGTTGCCCCCGCAACGTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 15}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190862618_1190862634 29 Left 1190862618 X:54358595-54358617 CCAGTTACGTTGCGGGGGCAACA 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1190862634 X:54358647-54358669 ACCGCAGTGCGCGCGCGCGGGGG No data
1190862618_1190862631 26 Left 1190862618 X:54358595-54358617 CCAGTTACGTTGCGGGGGCAACA 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1190862631 X:54358644-54358666 AGGACCGCAGTGCGCGCGCGCGG No data
1190862618_1190862621 6 Left 1190862618 X:54358595-54358617 CCAGTTACGTTGCGGGGGCAACA 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1190862621 X:54358624-54358646 GCATGTCTCCCCCGCCCCCCAGG 0: 1
1: 0
2: 1
3: 15
4: 215
1190862618_1190862632 27 Left 1190862618 X:54358595-54358617 CCAGTTACGTTGCGGGGGCAACA 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1190862632 X:54358645-54358667 GGACCGCAGTGCGCGCGCGCGGG No data
1190862618_1190862633 28 Left 1190862618 X:54358595-54358617 CCAGTTACGTTGCGGGGGCAACA 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1190862633 X:54358646-54358668 GACCGCAGTGCGCGCGCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190862618 Original CRISPR TGTTGCCCCCGCAACGTAAC TGG (reversed) Intronic