ID: 1190862620

View in Genome Browser
Species Human (GRCh38)
Location X:54358619-54358641
Sequence GGGGCGGGGGAGACATGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 291}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190862620_1190862631 2 Left 1190862620 X:54358619-54358641 CCACGGCATGTCTCCCCCGCCCC 0: 1
1: 0
2: 3
3: 26
4: 291
Right 1190862631 X:54358644-54358666 AGGACCGCAGTGCGCGCGCGCGG No data
1190862620_1190862639 27 Left 1190862620 X:54358619-54358641 CCACGGCATGTCTCCCCCGCCCC 0: 1
1: 0
2: 3
3: 26
4: 291
Right 1190862639 X:54358669-54358691 GCTGGGAAACGACCAAAGCAGGG No data
1190862620_1190862636 9 Left 1190862620 X:54358619-54358641 CCACGGCATGTCTCCCCCGCCCC 0: 1
1: 0
2: 3
3: 26
4: 291
Right 1190862636 X:54358651-54358673 CAGTGCGCGCGCGCGGGGGCTGG No data
1190862620_1190862638 26 Left 1190862620 X:54358619-54358641 CCACGGCATGTCTCCCCCGCCCC 0: 1
1: 0
2: 3
3: 26
4: 291
Right 1190862638 X:54358668-54358690 GGCTGGGAAACGACCAAAGCAGG No data
1190862620_1190862633 4 Left 1190862620 X:54358619-54358641 CCACGGCATGTCTCCCCCGCCCC 0: 1
1: 0
2: 3
3: 26
4: 291
Right 1190862633 X:54358646-54358668 GACCGCAGTGCGCGCGCGCGGGG No data
1190862620_1190862632 3 Left 1190862620 X:54358619-54358641 CCACGGCATGTCTCCCCCGCCCC 0: 1
1: 0
2: 3
3: 26
4: 291
Right 1190862632 X:54358645-54358667 GGACCGCAGTGCGCGCGCGCGGG No data
1190862620_1190862634 5 Left 1190862620 X:54358619-54358641 CCACGGCATGTCTCCCCCGCCCC 0: 1
1: 0
2: 3
3: 26
4: 291
Right 1190862634 X:54358647-54358669 ACCGCAGTGCGCGCGCGCGGGGG No data
1190862620_1190862637 10 Left 1190862620 X:54358619-54358641 CCACGGCATGTCTCCCCCGCCCC 0: 1
1: 0
2: 3
3: 26
4: 291
Right 1190862637 X:54358652-54358674 AGTGCGCGCGCGCGGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190862620 Original CRISPR GGGGCGGGGGAGACATGCCG TGG (reversed) Intronic