ID: 1190862622

View in Genome Browser
Species Human (GRCh38)
Location X:54358632-54358654
Sequence ACTGCGGTCCTGGGGGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 292}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190862622_1190862643 25 Left 1190862622 X:54358632-54358654 CCCCCGCCCCCCAGGACCGCAGT 0: 1
1: 0
2: 2
3: 37
4: 292
Right 1190862643 X:54358680-54358702 ACCAAAGCAGGGATGGGAAAGGG No data
1190862622_1190862639 14 Left 1190862622 X:54358632-54358654 CCCCCGCCCCCCAGGACCGCAGT 0: 1
1: 0
2: 2
3: 37
4: 292
Right 1190862639 X:54358669-54358691 GCTGGGAAACGACCAAAGCAGGG No data
1190862622_1190862632 -10 Left 1190862622 X:54358632-54358654 CCCCCGCCCCCCAGGACCGCAGT 0: 1
1: 0
2: 2
3: 37
4: 292
Right 1190862632 X:54358645-54358667 GGACCGCAGTGCGCGCGCGCGGG No data
1190862622_1190862638 13 Left 1190862622 X:54358632-54358654 CCCCCGCCCCCCAGGACCGCAGT 0: 1
1: 0
2: 2
3: 37
4: 292
Right 1190862638 X:54358668-54358690 GGCTGGGAAACGACCAAAGCAGG No data
1190862622_1190862640 18 Left 1190862622 X:54358632-54358654 CCCCCGCCCCCCAGGACCGCAGT 0: 1
1: 0
2: 2
3: 37
4: 292
Right 1190862640 X:54358673-54358695 GGAAACGACCAAAGCAGGGATGG No data
1190862622_1190862637 -3 Left 1190862622 X:54358632-54358654 CCCCCGCCCCCCAGGACCGCAGT 0: 1
1: 0
2: 2
3: 37
4: 292
Right 1190862637 X:54358652-54358674 AGTGCGCGCGCGCGGGGGCTGGG No data
1190862622_1190862636 -4 Left 1190862622 X:54358632-54358654 CCCCCGCCCCCCAGGACCGCAGT 0: 1
1: 0
2: 2
3: 37
4: 292
Right 1190862636 X:54358651-54358673 CAGTGCGCGCGCGCGGGGGCTGG No data
1190862622_1190862634 -8 Left 1190862622 X:54358632-54358654 CCCCCGCCCCCCAGGACCGCAGT 0: 1
1: 0
2: 2
3: 37
4: 292
Right 1190862634 X:54358647-54358669 ACCGCAGTGCGCGCGCGCGGGGG No data
1190862622_1190862641 19 Left 1190862622 X:54358632-54358654 CCCCCGCCCCCCAGGACCGCAGT 0: 1
1: 0
2: 2
3: 37
4: 292
Right 1190862641 X:54358674-54358696 GAAACGACCAAAGCAGGGATGGG No data
1190862622_1190862642 24 Left 1190862622 X:54358632-54358654 CCCCCGCCCCCCAGGACCGCAGT 0: 1
1: 0
2: 2
3: 37
4: 292
Right 1190862642 X:54358679-54358701 GACCAAAGCAGGGATGGGAAAGG No data
1190862622_1190862633 -9 Left 1190862622 X:54358632-54358654 CCCCCGCCCCCCAGGACCGCAGT 0: 1
1: 0
2: 2
3: 37
4: 292
Right 1190862633 X:54358646-54358668 GACCGCAGTGCGCGCGCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190862622 Original CRISPR ACTGCGGTCCTGGGGGGCGG GGG (reversed) Intronic