ID: 1190862623

View in Genome Browser
Species Human (GRCh38)
Location X:54358633-54358655
Sequence CACTGCGGTCCTGGGGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 249}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190862623_1190862643 24 Left 1190862623 X:54358633-54358655 CCCCGCCCCCCAGGACCGCAGTG 0: 1
1: 0
2: 0
3: 25
4: 249
Right 1190862643 X:54358680-54358702 ACCAAAGCAGGGATGGGAAAGGG No data
1190862623_1190862642 23 Left 1190862623 X:54358633-54358655 CCCCGCCCCCCAGGACCGCAGTG 0: 1
1: 0
2: 0
3: 25
4: 249
Right 1190862642 X:54358679-54358701 GACCAAAGCAGGGATGGGAAAGG No data
1190862623_1190862633 -10 Left 1190862623 X:54358633-54358655 CCCCGCCCCCCAGGACCGCAGTG 0: 1
1: 0
2: 0
3: 25
4: 249
Right 1190862633 X:54358646-54358668 GACCGCAGTGCGCGCGCGCGGGG No data
1190862623_1190862640 17 Left 1190862623 X:54358633-54358655 CCCCGCCCCCCAGGACCGCAGTG 0: 1
1: 0
2: 0
3: 25
4: 249
Right 1190862640 X:54358673-54358695 GGAAACGACCAAAGCAGGGATGG No data
1190862623_1190862638 12 Left 1190862623 X:54358633-54358655 CCCCGCCCCCCAGGACCGCAGTG 0: 1
1: 0
2: 0
3: 25
4: 249
Right 1190862638 X:54358668-54358690 GGCTGGGAAACGACCAAAGCAGG No data
1190862623_1190862641 18 Left 1190862623 X:54358633-54358655 CCCCGCCCCCCAGGACCGCAGTG 0: 1
1: 0
2: 0
3: 25
4: 249
Right 1190862641 X:54358674-54358696 GAAACGACCAAAGCAGGGATGGG No data
1190862623_1190862634 -9 Left 1190862623 X:54358633-54358655 CCCCGCCCCCCAGGACCGCAGTG 0: 1
1: 0
2: 0
3: 25
4: 249
Right 1190862634 X:54358647-54358669 ACCGCAGTGCGCGCGCGCGGGGG No data
1190862623_1190862637 -4 Left 1190862623 X:54358633-54358655 CCCCGCCCCCCAGGACCGCAGTG 0: 1
1: 0
2: 0
3: 25
4: 249
Right 1190862637 X:54358652-54358674 AGTGCGCGCGCGCGGGGGCTGGG No data
1190862623_1190862636 -5 Left 1190862623 X:54358633-54358655 CCCCGCCCCCCAGGACCGCAGTG 0: 1
1: 0
2: 0
3: 25
4: 249
Right 1190862636 X:54358651-54358673 CAGTGCGCGCGCGCGGGGGCTGG No data
1190862623_1190862639 13 Left 1190862623 X:54358633-54358655 CCCCGCCCCCCAGGACCGCAGTG 0: 1
1: 0
2: 0
3: 25
4: 249
Right 1190862639 X:54358669-54358691 GCTGGGAAACGACCAAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190862623 Original CRISPR CACTGCGGTCCTGGGGGGCG GGG (reversed) Intronic