ID: 1190862626

View in Genome Browser
Species Human (GRCh38)
Location X:54358638-54358660
Sequence GCGCGCACTGCGGTCCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 91}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190862626_1190862643 19 Left 1190862626 X:54358638-54358660 CCCCCCAGGACCGCAGTGCGCGC 0: 1
1: 0
2: 0
3: 11
4: 91
Right 1190862643 X:54358680-54358702 ACCAAAGCAGGGATGGGAAAGGG No data
1190862626_1190862637 -9 Left 1190862626 X:54358638-54358660 CCCCCCAGGACCGCAGTGCGCGC 0: 1
1: 0
2: 0
3: 11
4: 91
Right 1190862637 X:54358652-54358674 AGTGCGCGCGCGCGGGGGCTGGG No data
1190862626_1190862641 13 Left 1190862626 X:54358638-54358660 CCCCCCAGGACCGCAGTGCGCGC 0: 1
1: 0
2: 0
3: 11
4: 91
Right 1190862641 X:54358674-54358696 GAAACGACCAAAGCAGGGATGGG No data
1190862626_1190862638 7 Left 1190862626 X:54358638-54358660 CCCCCCAGGACCGCAGTGCGCGC 0: 1
1: 0
2: 0
3: 11
4: 91
Right 1190862638 X:54358668-54358690 GGCTGGGAAACGACCAAAGCAGG No data
1190862626_1190862642 18 Left 1190862626 X:54358638-54358660 CCCCCCAGGACCGCAGTGCGCGC 0: 1
1: 0
2: 0
3: 11
4: 91
Right 1190862642 X:54358679-54358701 GACCAAAGCAGGGATGGGAAAGG No data
1190862626_1190862636 -10 Left 1190862626 X:54358638-54358660 CCCCCCAGGACCGCAGTGCGCGC 0: 1
1: 0
2: 0
3: 11
4: 91
Right 1190862636 X:54358651-54358673 CAGTGCGCGCGCGCGGGGGCTGG No data
1190862626_1190862639 8 Left 1190862626 X:54358638-54358660 CCCCCCAGGACCGCAGTGCGCGC 0: 1
1: 0
2: 0
3: 11
4: 91
Right 1190862639 X:54358669-54358691 GCTGGGAAACGACCAAAGCAGGG No data
1190862626_1190862640 12 Left 1190862626 X:54358638-54358660 CCCCCCAGGACCGCAGTGCGCGC 0: 1
1: 0
2: 0
3: 11
4: 91
Right 1190862640 X:54358673-54358695 GGAAACGACCAAAGCAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190862626 Original CRISPR GCGCGCACTGCGGTCCTGGG GGG (reversed) Intronic
901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG + Intergenic
904236899 1:29122302-29122324 GCGACCCCTGCGGACCTGGGAGG - Intronic
904322483 1:29706900-29706922 GCGATCTCTGCTGTCCTGGGAGG - Intergenic
904376737 1:30086397-30086419 GCGATCTCTGCTGTCCTGGGAGG + Intergenic
905205866 1:36342589-36342611 GCCCTCACTGCGGGCCTGCGTGG - Intronic
906109282 1:43312470-43312492 GAGGGCAGTGCGGGCCTGGGGGG - Exonic
906200919 1:43959778-43959800 GAGCAGACTGAGGTCCTGGGAGG - Intronic
907371886 1:54009099-54009121 GCCCACCCTGCGGCCCTGGGTGG - Exonic
907966111 1:59331447-59331469 GCGAGCGCAGAGGTCCTGGGAGG - Intronic
918601997 1:186375238-186375260 GCGCGCACTTCGGTCGCGGGCGG - Exonic
921692270 1:218164937-218164959 GCGCGCCCTCCAGTCCCGGGCGG + Intergenic
1070984880 10:80680109-80680131 GAGCGCACTGAGGTGCTGGGAGG + Intergenic
1073287306 10:102396661-102396683 GCGGTCACTGCTGGCCTGGGTGG + Intronic
1076852363 10:133099330-133099352 GCACACACTCCGGTCCAGGGAGG + Intronic
1080887133 11:36377249-36377271 GCGCGCTCTGCGGACTAGGGTGG + Intronic
1084735572 11:71103211-71103233 GCAGGCACCGCTGTCCTGGGAGG - Intronic
1088869009 11:113875604-113875626 GCGCGCGCTGCGGGCGGGGGCGG - Intergenic
1089615726 11:119693651-119693673 TGGGGCACTGGGGTCCTGGGAGG + Intronic
1100679776 12:96907055-96907077 GCGGGAACTGCGGGCCGGGGCGG - Intergenic
1103649698 12:122422811-122422833 GCGCCCACCGCGGCCCCGGGAGG + Intergenic
1103932015 12:124455776-124455798 GAGAGCACTGTGGTACTGGGAGG + Intronic
1104929309 12:132329665-132329687 GCGCGCGGGGCGGTCCCGGGGGG - Intergenic
1105437895 13:20392269-20392291 GGGCGCTCTGGGGTCCGGGGTGG - Intergenic
1119240832 14:73058499-73058521 GCGTGCACTGCGGCCGGGGGCGG - Exonic
1120789082 14:88562976-88562998 GCGCGCAGTGCCGGCCGGGGCGG + Exonic
1120993524 14:90398023-90398045 GCCCGCACTGCTGCACTGGGTGG - Intronic
1122176692 14:99926003-99926025 GCCAGCACAGCGGTCCTGGCAGG - Intronic
1122940260 14:104978079-104978101 GCGCGCAGTGCGGGCCTTGGGGG - Intronic
1129387011 15:75201868-75201890 GCGCCGTCTGCGGTCCCGGGCGG - Intronic
1129525695 15:76212699-76212721 GCTCCCACTGCTATCCTGGGAGG + Intronic
1131350669 15:91696963-91696985 GTGCACACTGGGGACCTGGGTGG - Intergenic
1132553006 16:560918-560940 GGGCGCCCTGCGTTCCCGGGGGG + Intronic
1132604563 16:788378-788400 GCGCGCGCAGCGGTGCAGGGCGG - Intronic
1132720331 16:1312516-1312538 GCCCGCACTCAGGTTCTGGGTGG - Intronic
1132764855 16:1529176-1529198 GCCCGCCCTGCGTCCCTGGGTGG - Intronic
1132837487 16:1961622-1961644 GCACGCACAGCGGTCCTGGTAGG - Exonic
1136153055 16:28364803-28364825 CCGGGCCCTGCGGCCCTGGGAGG + Intergenic
1136210028 16:28750470-28750492 CCGGGCCCTGCGGCCCTGGGAGG - Intergenic
1142209871 16:88803925-88803947 GCGCGGAGTGCGGGCCTGGCGGG - Exonic
1143584434 17:7844231-7844253 TCGCGCACCGCGGTCCCGAGTGG - Intronic
1146736331 17:35242230-35242252 GCGCGCGCTGCTGCCCTGTGTGG - Intergenic
1147418334 17:40309402-40309424 TCGCTCACTGTAGTCCTGGGAGG + Intronic
1151890413 17:76947964-76947986 GCACGCCCTGCGGGCCTGGCTGG + Exonic
1152778893 17:82217838-82217860 GCGGGGCCTGCGGTCCTGGCCGG + Intergenic
1152905944 17:82971018-82971040 GGGCGCAGTGCGTTCCTGCGAGG + Intronic
1152927618 17:83094622-83094644 GTGGGCGCTGCGGTCCTGGTGGG + Exonic
1156047899 18:32897832-32897854 GGGCACACTGCTGTTCTGGGTGG - Intergenic
1160594515 18:79964597-79964619 GAGCGCGCTGCGTTCCAGGGCGG - Exonic
1160594657 18:79965010-79965032 GGGGACCCTGCGGTCCTGGGGGG + Intronic
1160725808 19:617367-617389 GCTCGAACTGCGGGCCAGGGCGG - Intronic
1160753648 19:747117-747139 GCGCCCACCGGGGTCCTGGCGGG + Exonic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1161469017 19:4447201-4447223 GCAGGGACTGGGGTCCTGGGCGG - Intronic
1163036996 19:14575807-14575829 CCGAGCACTGGGGACCTGGGGGG + Intergenic
1163618064 19:18341190-18341212 CCGCGCCCTGCGCTCCTGGGGGG + Intronic
1167264790 19:48478162-48478184 CCGGGCTCTGGGGTCCTGGGCGG + Intronic
926697423 2:15780458-15780480 GGGCCCACTGAGCTCCTGGGTGG + Intergenic
937448067 2:121975489-121975511 GGGAGCACTGAGGTCCTGGAAGG + Intergenic
947860500 2:233354482-233354504 GCGCGCACCGCGGGCGGGGGCGG - Intergenic
1168876370 20:1174815-1174837 GCGTGCACTGCGGTGGTGGTGGG - Intronic
1171355606 20:24543385-24543407 GGGCGTGCTGCGCTCCTGGGGGG + Exonic
1174607126 20:51768745-51768767 GCGCGCACGGCGGGCGTGGGCGG - Intergenic
1176062295 20:63177771-63177793 CCGCGCGCTGCTGCCCTGGGCGG - Intergenic
1176098138 20:63353500-63353522 GGGGGGGCTGCGGTCCTGGGGGG + Intronic
1176098166 20:63353568-63353590 GGGGGGGCTGCGGTCCTGGGGGG + Intronic
1176098212 20:63353702-63353724 GGGGGGGCTGCGGTCCTGGGGGG + Intronic
1176098303 20:63353951-63353973 GGGGGGGCTGCGGTCCTGGGAGG + Intronic
1176205543 20:63886159-63886181 GCTGGCACTGCTGTCCTGGAAGG - Intronic
1178915406 21:36703081-36703103 GCTGCCACTGCGGTCCTGTGGGG + Intronic
1179785715 21:43728647-43728669 GCGCGCACGTGGGCCCTGGGAGG + Intronic
1185132063 22:49044882-49044904 GCGGCCACTGCGGTGCTGAGCGG + Intergenic
953537158 3:43785147-43785169 GTGGGCACAGCAGTCCTGGGAGG + Intergenic
954793113 3:53147420-53147442 GGGCACAAAGCGGTCCTGGGTGG + Intergenic
967100351 3:186210714-186210736 GCCCGCACTGCAGTCCAGTGGGG - Intronic
967875278 3:194264791-194264813 GCACGCACTGCAGTCCTGTGGGG - Intergenic
968468258 4:764058-764080 GCGGGCACAGGGCTCCTGGGCGG + Intronic
968510484 4:993356-993378 GAGGGCCCTGCGGTCCTCGGTGG - Exonic
977421208 4:96802174-96802196 GGCAGCACTGTGGTCCTGGGTGG + Intergenic
988595393 5:32585866-32585888 GCGGGCGCTGCGGCCCGGGGCGG + Intronic
988966667 5:36425582-36425604 GAGCACACTGAGGTGCTGGGAGG - Intergenic
997582799 5:135028050-135028072 GCGGGCAGTGCGGGCCTGGCGGG - Exonic
1004233061 6:13850244-13850266 GAGGGCCCTGCTGTCCTGGGAGG + Intergenic
1004907459 6:20249994-20250016 GGGAGCACTGAGGTCCTGGTTGG - Intergenic
1006224223 6:32522463-32522485 GCGCGGGCTCCGGTGCTGGGCGG - Intronic
1006230817 6:32584665-32584687 GCGCGGGCTGCGGTGCTGGGCGG - Intronic
1006472681 6:34237399-34237421 GCGCGCGCTGCAGCCCCGGGCGG - Intronic
1006644412 6:35506084-35506106 GCGCACCGTGCGGCCCTGGGGGG + Exonic
1014103175 6:117533984-117534006 GCATGCACTGCTGTCCTTGGTGG - Intronic
1025208757 7:57008930-57008952 GCGCGCACTGCGGGCACGCGGGG - Intergenic
1031495490 7:122442380-122442402 GTGGGAACTGCAGTCCTGGGAGG - Intronic
1040298471 8:46175636-46175658 GCACCCAGTGCTGTCCTGGGTGG + Intergenic
1041257488 8:55991641-55991663 GAGCCCACTGCTGTCCTGGGAGG - Intronic
1049272735 8:141704601-141704623 TCGCCCACTGCTGTCCTGTGAGG + Intergenic
1049641658 8:143718741-143718763 GTGCGCACTGCAGTCGGGGGTGG - Intronic
1049741451 8:144242957-144242979 GTGCTCACTGGGGTCCGGGGAGG - Intronic
1056732483 9:89178122-89178144 GGGCGCACTGCCGTCCGGGGCGG + Exonic
1057600086 9:96450251-96450273 GCGACCACTGCGGGCCCGGGAGG - Exonic
1060825086 9:126683208-126683230 GCGCGCTCTGCGGGCCTCGCGGG - Intronic
1060939718 9:127536335-127536357 GCGAGCACTGCAGCCCTGGTGGG + Intronic
1062035148 9:134379648-134379670 CCCCACCCTGCGGTCCTGGGAGG + Intronic
1189333113 X:40155015-40155037 GGGCGCACTGCGGGCCGCGGCGG - Intronic
1190862626 X:54358638-54358660 GCGCGCACTGCGGTCCTGGGGGG - Intronic
1199987355 X:152962255-152962277 GCTCACATTGCAGTCCTGGGGGG + Intronic