ID: 1190862633

View in Genome Browser
Species Human (GRCh38)
Location X:54358646-54358668
Sequence GACCGCAGTGCGCGCGCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190862623_1190862633 -10 Left 1190862623 X:54358633-54358655 CCCCGCCCCCCAGGACCGCAGTG 0: 1
1: 0
2: 0
3: 25
4: 249
Right 1190862633 X:54358646-54358668 GACCGCAGTGCGCGCGCGCGGGG No data
1190862622_1190862633 -9 Left 1190862622 X:54358632-54358654 CCCCCGCCCCCCAGGACCGCAGT 0: 1
1: 0
2: 2
3: 37
4: 292
Right 1190862633 X:54358646-54358668 GACCGCAGTGCGCGCGCGCGGGG No data
1190862617_1190862633 29 Left 1190862617 X:54358594-54358616 CCCAGTTACGTTGCGGGGGCAAC 0: 1
1: 0
2: 0
3: 1
4: 8
Right 1190862633 X:54358646-54358668 GACCGCAGTGCGCGCGCGCGGGG No data
1190862618_1190862633 28 Left 1190862618 X:54358595-54358617 CCAGTTACGTTGCGGGGGCAACA 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1190862633 X:54358646-54358668 GACCGCAGTGCGCGCGCGCGGGG No data
1190862620_1190862633 4 Left 1190862620 X:54358619-54358641 CCACGGCATGTCTCCCCCGCCCC 0: 1
1: 0
2: 3
3: 26
4: 291
Right 1190862633 X:54358646-54358668 GACCGCAGTGCGCGCGCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190862633 Original CRISPR GACCGCAGTGCGCGCGCGCG GGG Intergenic