ID: 1190862717

View in Genome Browser
Species Human (GRCh38)
Location X:54359002-54359024
Sequence GCCTGGCGGCGGCGAGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190862717_1190862726 3 Left 1190862717 X:54359002-54359024 CCGCCCCCTCGCCGCCGCCAGGC No data
Right 1190862726 X:54359028-54359050 TAGAGCGCGCGCATGCGGAAAGG No data
1190862717_1190862725 -2 Left 1190862717 X:54359002-54359024 CCGCCCCCTCGCCGCCGCCAGGC No data
Right 1190862725 X:54359023-54359045 GCTTCTAGAGCGCGCGCATGCGG No data
1190862717_1190862727 23 Left 1190862717 X:54359002-54359024 CCGCCCCCTCGCCGCCGCCAGGC No data
Right 1190862727 X:54359048-54359070 AGGCTGCCTCCCACTGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190862717 Original CRISPR GCCTGGCGGCGGCGAGGGGG CGG (reversed) Intergenic
No off target data available for this crispr