ID: 1190862739

View in Genome Browser
Species Human (GRCh38)
Location X:54359109-54359131
Sequence CACTACCAGCTAGAGGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190862739_1190862745 18 Left 1190862739 X:54359109-54359131 CCCAGATCCTCTAGCTGGTAGTG No data
Right 1190862745 X:54359150-54359172 CTTTCGGTACATGTTAGCCTCGG No data
1190862739_1190862746 26 Left 1190862739 X:54359109-54359131 CCCAGATCCTCTAGCTGGTAGTG No data
Right 1190862746 X:54359158-54359180 ACATGTTAGCCTCGGCGCAGCGG No data
1190862739_1190862742 2 Left 1190862739 X:54359109-54359131 CCCAGATCCTCTAGCTGGTAGTG No data
Right 1190862742 X:54359134-54359156 TGCTGCCTCCTTCGAGCTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190862739 Original CRISPR CACTACCAGCTAGAGGATCT GGG (reversed) Intergenic
No off target data available for this crispr