ID: 1190865158

View in Genome Browser
Species Human (GRCh38)
Location X:54378297-54378319
Sequence GAGGATCTCTTGAACTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190865158_1190865167 12 Left 1190865158 X:54378297-54378319 CCTCCAGAGTTCAAGAGATCCTC No data
Right 1190865167 X:54378332-54378354 CCCAAGTAGCTGGGATTAACAGG 0: 36
1: 209
2: 1388
3: 3448
4: 6029
1190865158_1190865164 3 Left 1190865158 X:54378297-54378319 CCTCCAGAGTTCAAGAGATCCTC No data
Right 1190865164 X:54378323-54378345 TCTCAGCCTCCCAAGTAGCTGGG 0: 6552
1: 107713
2: 216650
3: 253203
4: 265968
1190865158_1190865163 2 Left 1190865158 X:54378297-54378319 CCTCCAGAGTTCAAGAGATCCTC No data
Right 1190865163 X:54378322-54378344 ATCTCAGCCTCCCAAGTAGCTGG 0: 1369
1: 20607
2: 125164
3: 234531
4: 285157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190865158 Original CRISPR GAGGATCTCTTGAACTCTGG AGG (reversed) Intergenic
No off target data available for this crispr